microRNA information: hsa-miR-27a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-27a-5p | miRbase |
| Accession: | MIMAT0004501 | miRbase |
| Precursor name: | hsa-mir-27a | miRbase |
| Precursor accession: | MI0000085 | miRbase |
| Symbol: | MIR27A | HGNC |
| RefSeq ID: | NR_029501 | GenBank |
| Sequence: | AGGGCUUAGCUGCUUGUGAGCA |
Reported expression in cancers: hsa-miR-27a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-27a-5p | breast cancer | downregulation | "These miRNAs include miR-21 and miR-27 that were f ......" | 20952761 | |
| hsa-miR-27a-5p | breast cancer | deregulation | "The effect of miR-27a expression on invasive capab ......" | 25223182 | qPCR |
| hsa-miR-27a-5p | breast cancer | deregulation | "Among 1066 miRNAs the most downregulated miRNA was ......" | 25954907 | |
| hsa-miR-27a-5p | breast cancer | upregulation | "MicroRNA-27a miR-27a has been reported to be an on ......" | 26662313 | qPCR |
| hsa-miR-27a-5p | cervical and endocervical cancer | upregulation | "RT-qPCR showed miR-27a was also upregulated and pr ......" | 26987623 | qPCR |
| hsa-miR-27a-5p | colorectal cancer | upregulation | "We performed a preliminary survey of independent a ......" | 26913609 | |
| hsa-miR-27a-5p | esophageal cancer | downregulation | "However the expression of miR-27a in esophageal sq ......" | 24154848 | |
| hsa-miR-27a-5p | gastric cancer | upregulation | "By integrating CNV and miRNA profiles in the same ......" | 23553990 | qPCR |
| hsa-miR-27a-5p | gastric cancer | upregulation | "We previously identified five miRNAs miR-1 miR-20a ......" | 24122958 | Reverse transcription PCR; qPCR |
| hsa-miR-27a-5p | kidney renal cell cancer | upregulation | "miR 27a promotes cell proliferation and metastasis ......" | 25973137 | qPCR |
| hsa-miR-27a-5p | liver cancer | upregulation | "miR 27a as an oncogenic microRNA of hepatitis B vi ......" | 23621256 | |
| hsa-miR-27a-5p | liver cancer | upregulation | "In this study we clearly demonstrated that miR-27a ......" | 25897249 | |
| hsa-miR-27a-5p | ovarian cancer | upregulation | "Total RNA was extracted from tumor samples and mic ......" | 19446316 | Microarray |
| hsa-miR-27a-5p | ovarian cancer | downregulation | "In this study we reported that expression of miR-2 ......" | 23438830 | |
| hsa-miR-27a-5p | pancreatic cancer | upregulation | "A growing body of data implicates altered miRNA pa ......" | 20638779 | |
| hsa-miR-27a-5p | pancreatic cancer | downregulation | "Grape seed proanthocyanidins extract inhibits panc ......" | 25652374 | |
| hsa-miR-27a-5p | prostate cancer | deregulation | "Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......" | 23781281 | |
| hsa-miR-27a-5p | prostate cancer | deregulation | "We found miR-27a to be down-regulated in prostate ......" | 27594411 | |
| hsa-miR-27a-5p | sarcoma | downregulation | "Further higher expression of miR-27a and miR-181c* ......" | 22350417 | qPCR |
Reported cancer pathway affected by hsa-miR-27a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-27a-5p | bladder cancer | Apoptosis pathway | "rs11671784 G/A variation in miR 27a decreases chem ......" | 25656571 | |
| hsa-miR-27a-5p | breast cancer | cell cycle pathway | "The BA-induced Sp1 Sp3 and Sp4 downregulation was ......" | 22407812 | |
| hsa-miR-27a-5p | breast cancer | Apoptosis pathway | "Arsenic trioxide suppresses cell growth and migrat ......" | 26592661 | Western blot; MTT assay; Wound Healing Assay |
| hsa-miR-27a-5p | breast cancer | Apoptosis pathway | "miR 27a regulates the sensitivity of breast cancer ......" | 26662313 | |
| hsa-miR-27a-5p | colorectal cancer | Apoptosis pathway | "The miR 27a calreticulin axis affects drug induced ......" | 26913599 | |
| hsa-miR-27a-5p | colorectal cancer | Apoptosis pathway | "Proteomic screening identifies calreticulin as a m ......" | 26913609 | |
| hsa-miR-27a-5p | esophageal cancer | Apoptosis pathway | "Down regulation of miR 27a might reverse multidrug ......" | 19960259 | Flow cytometry; MTT assay |
| hsa-miR-27a-5p | gastric cancer | Epithelial mesenchymal transition pathway | "miR 27 promotes human gastric cancer cell metastas ......" | 22018270 | Western blot; Luciferase |
| hsa-miR-27a-5p | glioblastoma | Apoptosis pathway | "MicroRNA 27a distinguishes glioblastoma multiforme ......" | 25628931 | |
| hsa-miR-27a-5p | kidney renal cell cancer | Apoptosis pathway | "Genome wide microRNA expression analysis of clear ......" | 22745662 | |
| hsa-miR-27a-5p | liver cancer | Apoptosis pathway | "MiR 27a modulates the MDR1/P glycoprotein expressi ......" | 24018051 | RNAi |
| hsa-miR-27a-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "MiR 27a promotes hepatocellular carcinoma cell pro ......" | 25836616 | Luciferase; Western blot |
| hsa-miR-27a-5p | liver cancer | cell cycle pathway | "Adipose tissue secreted miR 27a promotes liver can ......" | 25897249 | |
| hsa-miR-27a-5p | lung cancer | Epithelial mesenchymal transition pathway | "miR 27a regulates cisplatin resistance and metasta ......" | 25128483 | |
| hsa-miR-27a-5p | lung cancer | Apoptosis pathway | "Genistein inhibits A549 human lung cancer cell pro ......" | 27602162 | Western blot |
| hsa-miR-27a-5p | ovarian cancer | Apoptosis pathway | "MiR 27a modulates MDR1/P glycoprotein expression b ......" | 20624637 | Western blot; MTT assay |
| hsa-miR-27a-5p | ovarian cancer | Apoptosis pathway | "Expression of microRNA 27a and its correlation wit ......" | 20646448 | Western blot; MTT assay |
| hsa-miR-27a-5p | pancreatic cancer | Apoptosis pathway | "Genistein inhibits cell growth and invasion throug ......" | 24479798 | Western blot; MTT assay |
| hsa-miR-27a-5p | pancreatic cancer | Apoptosis pathway | "Grape seed proanthocyanidins extract inhibits panc ......" | 25652374 | Cell migration assay; Western blot |
| hsa-miR-27a-5p | prostate cancer | PI3K/Akt signaling pathway; cell cycle pathway; Apoptosis pathway | "Androgen induced miR 27A acted as a tumor suppress ......" | 27594411 | |
| hsa-miR-27a-5p | sarcoma | cell cycle pathway | "MicroRNA 27a Contributes to Rhabdomyosarcoma Cell ......" | 25915942 | |
| hsa-miR-27a-5p | sarcoma | Apoptosis pathway | "EMMPRIN SP1 and microRNA 27a mediate physcion 8 O ......" | 27429847 |
Reported cancer prognosis affected by hsa-miR-27a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-27a-5p | bladder cancer | drug resistance | "By changing the cellular level of the response-ide ......" | 22954303 | |
| hsa-miR-27a-5p | breast cancer | drug resistance | "The oncogenic microRNA 27a targets genes that regu ......" | 18006846 | |
| hsa-miR-27a-5p | breast cancer | drug resistance | "Individual or combined knockdown of Sp1 Sp3 Sp4 by ......" | 22553354 | RNAi |
| hsa-miR-27a-5p | breast cancer | progression; poor survival; metastasis; tumor size | "MiR 27 as a prognostic marker for breast cancer pr ......" | 23240057 | |
| hsa-miR-27a-5p | breast cancer | differentiation; metastasis | "miR 27a regulates endothelial differentiation of b ......" | 23752185 | |
| hsa-miR-27a-5p | breast cancer | drug resistance | "MiR 27a modulates radiosensitivity of triple negat ......" | 25943633 | Luciferase |
| hsa-miR-27a-5p | breast cancer | motility | "Arsenic trioxide suppresses cell growth and migrat ......" | 26592661 | Western blot; MTT assay; Wound Healing Assay |
| hsa-miR-27a-5p | breast cancer | metastasis | "miR 27a regulates the sensitivity of breast cancer ......" | 26662313 | |
| hsa-miR-27a-5p | breast cancer | staging | "We employed qRT-PCR to determine expression level ......" | 27596294 | |
| hsa-miR-27a-5p | colon cancer | progression; drug resistance | "Oncogenic microRNA 27a is a target for anticancer ......" | 19582879 | |
| hsa-miR-27a-5p | colon cancer | drug resistance | "The drug resistance suppression induced by curcumi ......" | 23471840 | Western blot; RNAi |
| hsa-miR-27a-5p | colorectal cancer | metastasis | "Functionally miR-23a promotes the migration and in ......" | 22628407 | |
| hsa-miR-27a-5p | colorectal cancer | tumorigenesis; motility | "Here through bioinformatic analyses and functional ......" | 24909917 | |
| hsa-miR-27a-5p | colorectal cancer | progression | "Association between miR 27a genetic variants and s ......" | 25078482 | |
| hsa-miR-27a-5p | colorectal cancer | worse prognosis; progression | "Genotype GG of rs895819 Functional Polymorphism Wi ......" | 26302683 | |
| hsa-miR-27a-5p | colorectal cancer | drug resistance | "The miR 27a calreticulin axis affects drug induced ......" | 26913599 | |
| hsa-miR-27a-5p | colorectal cancer | metastasis; worse prognosis; progression | "Proteomic screening identifies calreticulin as a m ......" | 26913609 | |
| hsa-miR-27a-5p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
| hsa-miR-27a-5p | esophageal cancer | drug resistance | "Down regulation of miR 27a might reverse multidrug ......" | 19960259 | Flow cytometry; MTT assay |
| hsa-miR-27a-5p | esophageal cancer | tumorigenesis; metastasis | "microRNA 27a functions as a tumor suppressor in es ......" | 24154848 | |
| hsa-miR-27a-5p | esophageal cancer | poor survival; metastasis | "TaqMan human miRNA arrays and bioinformatics were ......" | 25030863 | |
| hsa-miR-27a-5p | esophageal cancer | differentiation | "MicroRNA 27a directly targets KRAS to inhibit cell ......" | 25436011 | Luciferase |
| hsa-miR-27a-5p | esophageal cancer | drug resistance | "miR 27 is associated with chemoresistance in esoph ......" | 26026166 | |
| hsa-miR-27a-5p | gastric cancer | metastasis | "Quantitative reverse transcriptase-polymerase chai ......" | 19148490 | |
| hsa-miR-27a-5p | gastric cancer | progression; metastasis | "Hsa mir 27a genetic variant contributes to gastric ......" | 20666778 | |
| hsa-miR-27a-5p | gastric cancer | drug resistance | "Down regulation of miR 27a might inhibit prolifera ......" | 21569481 | Western blot; Flow cytometry; Colony formation; MTT assay |
| hsa-miR-27a-5p | gastric cancer | metastasis | "miR 27 promotes human gastric cancer cell metastas ......" | 22018270 | Western blot; Luciferase |
| hsa-miR-27a-5p | gastric cancer | tumorigenesis | "Inhibitory effect of minor allele T of rs2071504 S ......" | 22350505 | |
| hsa-miR-27a-5p | gastric cancer | drug resistance | "MicroRNA 27a inhibitors alone or in combination wi ......" | 23175237 | |
| hsa-miR-27a-5p | gastric cancer | tumorigenesis | "Genetic variations in miR 27a gene decrease mature ......" | 23246964 | |
| hsa-miR-27a-5p | gastric cancer | poor survival | "Polymorphisms of mir-26a1 rs7372209 mir-27a rs8958 ......" | 23975664 | |
| hsa-miR-27a-5p | gastric cancer | drug resistance; poor survival | "HIF 1α Induces Multidrug Resistance in Gastric Ca ......" | 26292288 | Western blot; MTT assay; Luciferase |
| hsa-miR-27a-5p | gastric cancer | worse prognosis | "Cell Free miR 27a a Potential Diagnostic and Progn ......" | 26523130 | |
| hsa-miR-27a-5p | gastric cancer | drug resistance; progression | "Role of miR 27a miR 181a and miR 20b in gastric ca ......" | 26793992 | |
| hsa-miR-27a-5p | glioblastoma | progression; poor survival | "MicroRNA 27a distinguishes glioblastoma multiforme ......" | 25628931 | |
| hsa-miR-27a-5p | kidney renal cell cancer | metastasis; cell migration; poor survival | "miR 27a promotes cell proliferation and metastasis ......" | 25973137 | |
| hsa-miR-27a-5p | kidney renal cell cancer | recurrence | "Expression of miR 27a 3p is an independent predict ......" | 26046464 | |
| hsa-miR-27a-5p | liver cancer | malignant trasformation | "Using gene expression microarrays and high-through ......" | 26646011 | |
| hsa-miR-27a-5p | lung cancer | metastasis; drug resistance; worse prognosis | "miR 27a regulates cisplatin resistance and metasta ......" | 25128483 | |
| hsa-miR-27a-5p | lung squamous cell cancer | worse prognosis; progression; tumorigenesis | "Rs895819 within miR 27a might be involved in devel ......" | 25773791 | |
| hsa-miR-27a-5p | ovarian cancer | worse prognosis | "Total RNA was extracted from tumor samples and mic ......" | 19446316 | |
| hsa-miR-27a-5p | ovarian cancer | drug resistance | "Furthermore we discuss several other microRNAs tha ......" | 20083225 | |
| hsa-miR-27a-5p | ovarian cancer | drug resistance | "MiR 27a modulates MDR1/P glycoprotein expression b ......" | 20624637 | Western blot; MTT assay |
| hsa-miR-27a-5p | ovarian cancer | drug resistance | "Expression of microRNA 27a and its correlation wit ......" | 20646448 | Western blot; MTT assay |
| hsa-miR-27a-5p | ovarian cancer | metastasis | "Oncogenic MicroRNA 27a is a target for genistein i ......" | 23438830 | |
| hsa-miR-27a-5p | pancreatic cancer | drug resistance | "Methyl 2 cyano 312 dioxooleana 19 dien 28 oate dec ......" | 20488920 | Western blot; RNAi |
| hsa-miR-27a-5p | pancreatic cancer | malignant trasformation | "miR 27a regulates the growth colony formation and ......" | 20638779 | Colony formation |
| hsa-miR-27a-5p | pancreatic cancer | poor survival | "We identified 3 miRNAs MIR21 MIR23A and MIR27A tha ......" | 24120476 | |
| hsa-miR-27a-5p | pancreatic cancer | cell migration | "Grape seed proanthocyanidins extract inhibits panc ......" | 25652374 | Cell migration assay; Western blot |
| hsa-miR-27a-5p | pancreatic cancer | poor survival | "We identified three miRNAs miR-21 miR-23a and miR- ......" | 26312859 | |
| hsa-miR-27a-5p | prostate cancer | progression | "Androgen induced miR 27A acted as a tumor suppress ......" | 27594411 | |
| hsa-miR-27a-5p | sarcoma | metastasis; tumorigenesis | "MicroRNA 27a promotes proliferation migration and ......" | 24556602 | Colony formation; Western blot; Luciferase |
| hsa-miR-27a-5p | sarcoma | worse prognosis; poor survival; staging; metastasis; drug resistance; progression | "Diagnostic and prognostic potentials of microRNA 2 ......" | 25960240 | |
| hsa-miR-27a-5p | sarcoma | progression; staging; metastasis; poor survival | "Down regulation of microRNA 26a and up regulation ......" | 26377680 |
Reported gene related to hsa-miR-27a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-27a-5p | breast cancer | ZBTB10 | "MicroRNA-27a miR-27a is thought to be an onco-micr ......" | 23240057 |
| hsa-miR-27a-5p | breast cancer | ZBTB10 | "Increased miR-27a paralleled the reduced expressio ......" | 23752185 |
| hsa-miR-27a-5p | breast cancer | ZBTB10 | "Thus miR-27a indirectly regulates E2-responsivenes ......" | 20382698 |
| hsa-miR-27a-5p | breast cancer | ZBTB10 | "Thus the oncogenic activity of miR-27a in MDA-MB-2 ......" | 18006846 |
| hsa-miR-27a-5p | colon cancer | ZBTB10 | "RQ decreased microRNA-27a miR-27a and induced zinc ......" | 23530649 |
| hsa-miR-27a-5p | colon cancer | ZBTB10 | "The drug resistance suppression induced by curcumi ......" | 23471840 |
| hsa-miR-27a-5p | colon cancer | ZBTB10 | "CDODA-Me decreased expression of microRNA-27a miR- ......" | 19582879 |
| hsa-miR-27a-5p | gastric cancer | ZBTB10 | "Here we investigated the possible role of a common ......" | 20666778 |
| hsa-miR-27a-5p | melanoma | ZBTB10 | "In the present study we explored the possible acti ......" | 19639204 |
| hsa-miR-27a-5p | pancreatic cancer | ZBTB10 | "Repression of Sp and Sp-dependent genes by CDDO-Me ......" | 20488920 |
| hsa-miR-27a-5p | bladder cancer | ABCB1 | "miR-27a mediates chemotherapy at least partially t ......" | 25656571 |
| hsa-miR-27a-5p | ovarian cancer | ABCB1 | "2 A2780/Taxol cells transfection with inhibitors o ......" | 20646448 |
| hsa-miR-27a-5p | ovarian cancer | ABCB1 | "The expression levels of miR-27a and P-gp were up- ......" | 20624637 |
| hsa-miR-27a-5p | prostate cancer | AR | "MiR-27a a transcriptional target of AR was an andr ......" | 27594411 |
| hsa-miR-27a-5p | prostate cancer | AR | "Increasing miR-27a expression results in reduced P ......" | 22505583 |
| hsa-miR-27a-5p | esophageal cancer | BCL2 | "Down-regulation of miR-27a could significantly dec ......" | 19960259 |
| hsa-miR-27a-5p | gastric cancer | BCL2 | "Inhibition of HIF-1α or miR27a expression decreas ......" | 26292288 |
| hsa-miR-27a-5p | colorectal cancer | CALR | "Proteomic screening identifies calreticulin as a m ......" | 26913609 |
| hsa-miR-27a-5p | colorectal cancer | CALR | "The miR 27a calreticulin axis affects drug induced ......" | 26913599 |
| hsa-miR-27a-5p | liver cancer | FOXO1 | "Adipose tissue secreted miR 27a promotes liver can ......" | 25897249 |
| hsa-miR-27a-5p | pancreatic cancer | FOXO1 | "The expression of miR-27a and FOXO1 in AsPC-1 cell ......" | 25652374 |
| hsa-miR-27a-5p | ovarian cancer | HIPK2 | "2 A2780/Taxol cells transfection with inhibitors o ......" | 20646448 |
| hsa-miR-27a-5p | ovarian cancer | HIPK2 | "MiR 27a modulates MDR1/P glycoprotein expression b ......" | 20624637 |
| hsa-miR-27a-5p | esophageal cancer | KRAS | "microRNA 27a functions as a tumor suppressor in es ......" | 24154848 |
| hsa-miR-27a-5p | esophageal cancer | KRAS | "MicroRNA 27a directly targets KRAS to inhibit cell ......" | 25436011 |
| hsa-miR-27a-5p | prostate cancer | MAP2K4 | "Androgen induced miR 27A acted as a tumor suppress ......" | 27594411 |
| hsa-miR-27a-5p | sarcoma | MAP2K4 | "MicroRNA 27a promotes proliferation migration and ......" | 24556602 |
| hsa-miR-27a-5p | liver cancer | TECRL | "MiR 27a modulates the MDR1/P glycoprotein expressi ......" | 24018051 |
| hsa-miR-27a-5p | ovarian cancer | TECRL | "MiR 27a modulates MDR1/P glycoprotein expression b ......" | 20624637 |
| hsa-miR-27a-5p | liver cancer | AFP | "Combination of miR 125b and miR 27a enhances sensi ......" | 26637228 |
| hsa-miR-27a-5p | bladder cancer | AGGF1 | "Role of microRNA 27a in down regulation of angioge ......" | 24462738 |
| hsa-miR-27a-5p | esophageal cancer | AKR1B1 | "Down-regulation of miR-27a could confer sensitivit ......" | 19960259 |
| hsa-miR-27a-5p | gastric cancer | APC | "Finally the APC gene was identified as the direct ......" | 22018270 |
| hsa-miR-27a-5p | cervical and endocervical cancer | B4GALT3 | "B4GALT3 up regulation by miR 27a contributes to th ......" | 26987623 |
| hsa-miR-27a-5p | breast cancer | BAK1 | "miR 27a regulates the sensitivity of breast cancer ......" | 26662313 |
| hsa-miR-27a-5p | esophageal cancer | BAX | "Down-regulation of miR-27a could significantly dec ......" | 19960259 |
| hsa-miR-27a-5p | gastric cancer | BTG2 | "MiR 27a 3p functions as an oncogene in gastric can ......" | 27409164 |
| hsa-miR-27a-5p | gastric cancer | CCND1 | "Down-regulation of miR-27a could significantly dec ......" | 21569481 |
| hsa-miR-27a-5p | breast cancer | CDC27 | "MiR 27a modulates radiosensitivity of triple negat ......" | 25943633 |
| hsa-miR-27a-5p | lung squamous cell cancer | EGFR | "Cross talk between MET and EGFR in non small cell ......" | 23650389 |
| hsa-miR-27a-5p | breast cancer | ESR1 | "MicroRNA 27a Indirectly Regulates Estrogen Recepto ......" | 20382698 |
| hsa-miR-27a-5p | esophageal cancer | FBXW7 | "MiR 27a 3p promotes esophageal cancer cell prolife ......" | 26629048 |
| hsa-miR-27a-5p | glioblastoma | FOXO3 | "FOXO3a was verified as a new target of miR-27a by ......" | 23621269 |
| hsa-miR-27a-5p | liver cancer | FZD7 | "Moreover up-regulation of miR-27a did not decrease ......" | 24018051 |
| hsa-miR-27a-5p | colorectal cancer | GNPTAB | "We sought to verify whether miR-27a is implicated ......" | 26913599 |
| hsa-miR-27a-5p | colorectal cancer | HLA-E | "Proteomic screening identifies calreticulin as a m ......" | 26913609 |
| hsa-miR-27a-5p | gastric cancer | HOXA10 | "The G/A polymorphism impaired the processing of pr ......" | 23246964 |
| hsa-miR-27a-5p | esophageal cancer | HRAS | "Furthermore expression levels of the K-ras protein ......" | 25436011 |
| hsa-miR-27a-5p | sarcoma | KIDINS220 | "Attention was focused on the role of miR-27a that ......" | 25915942 |
| hsa-miR-27a-5p | gastric cancer | PCNA | "Down-regulation of miR-27a could significantly dec ......" | 21569481 |
| hsa-miR-27a-5p | lung cancer | PEBP1 | "miR 27a regulates cisplatin resistance and metasta ......" | 25128483 |
| hsa-miR-27a-5p | prostate cancer | PHB | "Androgen regulated processing of the oncomir miR 2 ......" | 22505583 |
| hsa-miR-27a-5p | pancreatic cancer | PSMA1 | "PSMA1 was selected as the candidate target gene of ......" | 24060073 |
| hsa-miR-27a-5p | sarcoma | RARA | "MicroRNA 27a Contributes to Rhabdomyosarcoma Cell ......" | 25915942 |
| hsa-miR-27a-5p | breast cancer | RUNX1 | "VEGF enhanced the transcription of miR-27a by incr ......" | 23752185 |
| hsa-miR-27a-5p | sarcoma | RXRA | "MicroRNA 27a Contributes to Rhabdomyosarcoma Cell ......" | 25915942 |
| hsa-miR-27a-5p | lung squamous cell cancer | SCLC1 | "Our results suggest that downregulation of miR-27a ......" | 23117485 |
| hsa-miR-27a-5p | colon cancer | SLC4A1 | "The drug resistance suppression induced by curcumi ......" | 23471840 |
| hsa-miR-27a-5p | pancreatic cancer | SPRY2 | "By using a reporter-screening assay we discovered ......" | 20638779 |
| hsa-miR-27a-5p | glioblastoma | TH | "Th miR-27a inhibitor significantly suppressed inva ......" | 23621269 |
| hsa-miR-27a-5p | breast cancer | VEGFA | "VEGF enhanced the transcription of miR-27a by incr ......" | 23752185 |
| hsa-miR-27a-5p | breast cancer | XIAP | "miR 27a regulates the sensitivity of breast cancer ......" | 26662313 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-27a-5p | KCTD7 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.151; TCGA CESC -0.146; TCGA COAD -0.19; TCGA ESCA -0.15; TCGA HNSC -0.132; TCGA KIRC -0.051; TCGA KIRP -0.051; TCGA LUAD -0.085; TCGA PAAD -0.064; TCGA SARC -0.136; TCGA STAD -0.304; TCGA UCEC -0.103 |
hsa-miR-27a-5p | HLF | 9 cancers: BLCA; COAD; LGG; LIHC; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.317; TCGA COAD -0.209; TCGA LGG -0.239; TCGA LIHC -0.308; TCGA OV -0.19; TCGA PAAD -0.247; TCGA SARC -0.677; TCGA STAD -0.699; TCGA UCEC -0.238 |
hsa-miR-27a-5p | DPY19L2 | 9 cancers: BLCA; CESC; HNSC; KIRP; LUAD; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.327; TCGA CESC -0.369; TCGA HNSC -0.341; TCGA KIRP -0.188; TCGA LUAD -0.149; TCGA PAAD -0.235; TCGA SARC -0.324; TCGA STAD -0.566; TCGA UCEC -0.192 |
hsa-miR-27a-5p | PPP1R12B | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.335; TCGA CESC -0.14; TCGA COAD -0.253; TCGA ESCA -0.288; TCGA HNSC -0.122; TCGA LGG -0.093; TCGA SARC -0.936; TCGA STAD -0.63; TCGA UCEC -0.247 |
hsa-miR-27a-5p | TAB1 | 9 cancers: BLCA; ESCA; KIRP; LGG; LIHC; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.096; TCGA ESCA -0.058; TCGA KIRP -0.055; TCGA LGG -0.081; TCGA LIHC -0.092; TCGA LUSC -0.066; TCGA PAAD -0.078; TCGA SARC -0.078; TCGA STAD -0.089 |
hsa-miR-27a-5p | CELF5 | 11 cancers: BLCA; CESC; COAD; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.437; TCGA CESC -0.226; TCGA COAD -0.348; TCGA KIRC -0.249; TCGA LGG -0.404; TCGA LUAD -0.218; TCGA LUSC -0.315; TCGA PAAD -0.515; TCGA PRAD -0.099; TCGA SARC -0.276; TCGA THCA -0.152 |
hsa-miR-27a-5p | WNK2 | 10 cancers: BLCA; COAD; LGG; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.443; TCGA COAD -0.139; TCGA LGG -0.352; TCGA LUAD -0.275; TCGA LUSC -0.412; TCGA OV -0.234; TCGA PAAD -0.439; TCGA SARC -0.569; TCGA STAD -0.427; TCGA UCEC -0.095 |
hsa-miR-27a-5p | MEX3B | 11 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; OV; SARC; UCEC | mirMAP | TCGA BLCA -0.239; TCGA CESC -0.356; TCGA COAD -0.122; TCGA HNSC -0.126; TCGA KIRP -0.107; TCGA LGG -0.232; TCGA LUAD -0.161; TCGA LUSC -0.219; TCGA OV -0.137; TCGA SARC -0.114; TCGA UCEC -0.172 |
hsa-miR-27a-5p | DLG2 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; OV; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.451; TCGA CESC -0.464; TCGA COAD -0.459; TCGA ESCA -0.708; TCGA HNSC -0.391; TCGA LGG -0.273; TCGA OV -0.146; TCGA PRAD -0.117; TCGA SARC -0.504; TCGA STAD -0.677; TCGA UCEC -0.445 |
hsa-miR-27a-5p | ABAT | 11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LIHC; LUAD; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.152; TCGA BRCA -0.305; TCGA CESC -0.161; TCGA COAD -0.187; TCGA KIRC -0.236; TCGA LGG -0.194; TCGA LIHC -0.18; TCGA LUAD -0.097; TCGA PAAD -0.173; TCGA STAD -0.136; TCGA UCEC -0.203 |
hsa-miR-27a-5p | CLIP3 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.422; TCGA CESC -0.38; TCGA COAD -0.295; TCGA ESCA -0.402; TCGA HNSC -0.251; TCGA KIRC -0.107; TCGA LGG -0.096; TCGA LUAD -0.077; TCGA LUSC -0.123; TCGA PAAD -0.165; TCGA SARC -0.335; TCGA STAD -0.494; TCGA UCEC -0.126 |
hsa-miR-27a-5p | SOX12 | 10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA | mirMAP | TCGA BRCA -0.294; TCGA COAD -0.155; TCGA KIRC -0.057; TCGA KIRP -0.077; TCGA LGG -0.054; TCGA LUAD -0.145; TCGA LUSC -0.238; TCGA PAAD -0.225; TCGA SARC -0.125; TCGA THCA -0.179 |
Enriched cancer pathways of putative targets