microRNA information: hsa-miR-27b-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-27b-5p | miRbase |
Accession: | MIMAT0004588 | miRbase |
Precursor name: | hsa-mir-27b | miRbase |
Precursor accession: | MI0000440 | miRbase |
Symbol: | MIR27B | HGNC |
RefSeq ID: | NR_029665 | GenBank |
Sequence: | AGAGCUUAGCUGAUUGGUGAAC |
Reported expression in cancers: hsa-miR-27b-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-27b-5p | breast cancer | downregulation | "These miRNAs include miR-21 and miR-27 that were f ......" | 20952761 | |
hsa-miR-27b-5p | breast cancer | upregulation | "We identified miR-23b and miR-27b as miRNAs that a ......" | 23338610 | |
hsa-miR-27b-5p | cervical and endocervical cancer | upregulation | "In the present study we report that HPV16 E7 upreg ......" | 26397063 | |
hsa-miR-27b-5p | cervical and endocervical cancer | upregulation | "MicroRNA 27b up regulated by human papillomavirus ......" | 26910911 | |
hsa-miR-27b-5p | colorectal cancer | upregulation | "To address this issue we profiled 742 microRNAs in ......" | 23506979 | |
hsa-miR-27b-5p | colorectal cancer | upregulation | "High expression of miR-27b miR-148a and miR-326 we ......" | 24119443 | |
hsa-miR-27b-5p | gastric cancer | upregulation | "In this study we found that ectopic miR-27b is suf ......" | 26623719 | |
hsa-miR-27b-5p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-27b-5p | liver cancer | upregulation | "Up-regulation of miR-15a miR-16 miR-27b miR-30b mi ......" | 24314246 | qPCR |
hsa-miR-27b-5p | lymphoma | upregulation | "The up-regulation of miR-155 miR-27b miR-30c and m ......" | 22776000 | Microarray |
hsa-miR-27b-5p | prostate cancer | downregulation | "The expression of miR-23b and miR-27b which are en ......" | 23300597 | |
hsa-miR-27b-5p | prostate cancer | downregulation | "Kaplan-Meier survival curves showed that low expre ......" | 25115396 |
Reported cancer pathway affected by hsa-miR-27b-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-27b-5p | breast cancer | Epithelial mesenchymal transition pathway | "MiR 27b is epigenetically downregulated in tamoxif ......" | 27363334 | Western blot; Luciferase |
hsa-miR-27b-5p | cervical and endocervical cancer | Apoptosis pathway | "MicroRNA 27b up regulated by human papillomavirus ......" | 26910911 | Luciferase |
hsa-miR-27b-5p | gastric cancer | Epithelial mesenchymal transition pathway | "miR 27 promotes human gastric cancer cell metastas ......" | 22018270 | Western blot; Luciferase |
hsa-miR-27b-5p | gastric cancer | Wnt signaling pathway | "MicroRNA 27b suppresses Helicobacter pylori induce ......" | 26780940 | |
hsa-miR-27b-5p | gastric cancer | Apoptosis pathway | "Long Non Coding RNA LncRNA Urothelial Carcinoma As ......" | 27694794 | Western blot |
hsa-miR-27b-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "Among several miRNAs in which the expression was a ......" | 21899661 |
Reported cancer prognosis affected by hsa-miR-27b-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-27b-5p | breast cancer | progression; poor survival | "MiR 27 as a prognostic marker for breast cancer pr ......" | 23240057 | |
hsa-miR-27b-5p | breast cancer | drug resistance | "MiR 27b is epigenetically downregulated in tamoxif ......" | 27363334 | Western blot; Luciferase |
hsa-miR-27b-5p | breast cancer | staging | "Our results showed significant increase of miR-17 ......" | 27596294 | |
hsa-miR-27b-5p | cervical and endocervical cancer | progression | "Elevation of miR 27b by HPV16 E7 inhibits PPARγ e ......" | 26397063 | |
hsa-miR-27b-5p | colorectal cancer | drug resistance | "To address this issue we profiled 742 microRNAs in ......" | 23506979 | |
hsa-miR-27b-5p | colorectal cancer | progression | "A tumor suppressor role for miR-27b has recently b ......" | 23593282 | Colony formation |
hsa-miR-27b-5p | colorectal cancer | progression; poor survival | "High expression of miR-27b miR-148a and miR-326 we ......" | 24119443 | |
hsa-miR-27b-5p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
hsa-miR-27b-5p | esophageal cancer | drug resistance | "miR 27 is associated with chemoresistance in esoph ......" | 26026166 | |
hsa-miR-27b-5p | gastric cancer | metastasis | "miR 27 promotes human gastric cancer cell metastas ......" | 22018270 | Western blot; Luciferase |
hsa-miR-27b-5p | gastric cancer | drug resistance | "The miR27b CCNG1 P53 miR 508 5p axis regulates mul ......" | 26623719 | |
hsa-miR-27b-5p | gastric cancer | tumorigenesis | "MicroRNA 27b suppresses Helicobacter pylori induce ......" | 26780940 | |
hsa-miR-27b-5p | gastric cancer | drug resistance | "Long Non Coding RNA LncRNA Urothelial Carcinoma As ......" | 27694794 | Western blot |
hsa-miR-27b-5p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-27b-5p | liver cancer | drug resistance | "The cell viability MTT assay was used to detect dr ......" | 23229111 | MTT assay |
hsa-miR-27b-5p | liver cancer | malignant trasformation | "Using gene expression microarrays and high-through ......" | 26646011 | |
hsa-miR-27b-5p | lymphoma | staging | "The miRNA expression profiles of skin biopsies fro ......" | 22776000 | |
hsa-miR-27b-5p | pancreatic cancer | staging | "Based on relevance to cancer a seven-miRNA signatu ......" | 25184537 | |
hsa-miR-27b-5p | prostate cancer | progression; poor survival | "The expression of miR-23b and miR-27b which are en ......" | 23300597 | Colony formation |
hsa-miR-27b-5p | prostate cancer | progression; poor survival | "Kaplan-Meier survival curves showed that low expre ......" | 25115396 |
Reported gene related to hsa-miR-27b-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-27b-5p | gastric cancer | APC | "Finally the APC gene was identified as the direct ......" | 22018270 |
hsa-miR-27b-5p | gastric cancer | CCNG1 | "Moreover miR-27b directly targets the 3' untransla ......" | 26623719 |
hsa-miR-27b-5p | cervical and endocervical cancer | DGCR8 | "Furthermore DGCR8 was found to mediate the up-regu ......" | 26910911 |
hsa-miR-27b-5p | bladder cancer | DROSHA | "Genetic variation in DROSHA 3'UTR regulated by hsa ......" | 24312312 |
hsa-miR-27b-5p | breast cancer | EGF | "Prooncogenic factors miR 23b and miR 27b are regul ......" | 23338610 |
hsa-miR-27b-5p | breast cancer | ENPP1 | "Loss of microRNA 27b contributes to breast cancer ......" | 26065921 |
hsa-miR-27b-5p | gastric cancer | FZD7 | "Restoration of FZD7 expression significantly atten ......" | 26780940 |
hsa-miR-27b-5p | prostate cancer | GOLM1 | "GOLM1 was directly regulated by miR-27b in PCa cel ......" | 25115396 |
hsa-miR-27b-5p | head and neck cancer | HGF | "Among several miRNAs in which the expression was a ......" | 21899661 |
hsa-miR-27b-5p | breast cancer | HMGB3 | "MiR 27b is epigenetically downregulated in tamoxif ......" | 27363334 |
hsa-miR-27b-5p | breast cancer | NISCH | "Nischarin NISCH expression was augmented by knockd ......" | 23338610 |
hsa-miR-27b-5p | cervical and endocervical cancer | PLK2 | "Dual-luciferase experiment confirmed miR-27b down- ......" | 26910911 |
hsa-miR-27b-5p | cervical and endocervical cancer | PPIE | "The results showed that PPARγ as a target of miR- ......" | 26397063 |
hsa-miR-27b-5p | melanoma | PRDX2 | "Treatment with 125OH2D3 and/or epigenetic drugs 5- ......" | 22213330 |
hsa-miR-27b-5p | cervical and endocervical cancer | SLC9A1 | "The results showed that PPARγ as a target of miR- ......" | 26397063 |
hsa-miR-27b-5p | breast cancer | TNF | "Prooncogenic factors miR 23b and miR 27b are regul ......" | 23338610 |
hsa-miR-27b-5p | gastric cancer | TP53 | "Moreover miR-27b directly targets the 3' untransla ......" | 26623719 |
hsa-miR-27b-5p | gastric cancer | UCA1 | "Long Non Coding RNA LncRNA Urothelial Carcinoma As ......" | 27694794 |
hsa-miR-27b-5p | melanoma | VDR | "The expression of VDR mRNA protein and two candida ......" | 22213330 |
hsa-miR-27b-5p | colorectal cancer | VEGFC | "We identified vascular endothelial growth factor C ......" | 23593282 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-27b-5p | RAB11FIP2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV | MirTarget | TCGA BLCA -0.102; TCGA BRCA -0.051; TCGA CESC -0.092; TCGA COAD -0.128; TCGA ESCA -0.267; TCGA HNSC -0.137; TCGA LGG -0.12; TCGA LIHC -0.096; TCGA LUAD -0.091; TCGA LUSC -0.193; TCGA OV -0.116 |
hsa-miR-27b-5p | ZEB2 | 12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.266; TCGA COAD -0.289; TCGA ESCA -0.353; TCGA HNSC -0.366; TCGA KIRC -0.142; TCGA LGG -0.069; TCGA LUAD -0.249; TCGA LUSC -0.494; TCGA PAAD -0.397; TCGA SARC -0.12; TCGA THCA -0.306; TCGA STAD -0.245 |
hsa-miR-27b-5p | FKBP5 | 10 cancers: BLCA; BRCA; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.268; TCGA BRCA -0.12; TCGA KIRC -0.379; TCGA LIHC -0.22; TCGA LUAD -0.197; TCGA LUSC -0.277; TCGA PAAD -0.39; TCGA PRAD -0.225; TCGA THCA -0.174; TCGA STAD -0.276 |
hsa-miR-27b-5p | CRTC1 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUSC; OV; STAD | mirMAP | TCGA BLCA -0.097; TCGA BRCA -0.108; TCGA CESC -0.16; TCGA COAD -0.105; TCGA ESCA -0.147; TCGA LGG -0.16; TCGA LUSC -0.149; TCGA OV -0.077; TCGA STAD -0.134 |
hsa-miR-27b-5p | MKLN1 | 9 cancers: BLCA; BRCA; ESCA; LGG; LIHC; OV; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.071; TCGA BRCA -0.089; TCGA ESCA -0.083; TCGA LGG -0.185; TCGA LIHC -0.067; TCGA OV -0.063; TCGA PRAD -0.114; TCGA THCA -0.05; TCGA UCEC -0.071 |
hsa-miR-27b-5p | ACE | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; SARC | mirMAP | TCGA BLCA -0.179; TCGA BRCA -0.13; TCGA CESC -0.395; TCGA ESCA -0.403; TCGA HNSC -0.19; TCGA KIRC -0.252; TCGA LUAD -0.309; TCGA LUSC -0.481; TCGA SARC -0.192 |
hsa-miR-27b-5p | FSTL1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; SARC; THCA | mirMAP | TCGA BLCA -0.192; TCGA CESC -0.359; TCGA COAD -0.328; TCGA ESCA -0.284; TCGA HNSC -0.476; TCGA KIRC -0.221; TCGA LUSC -0.322; TCGA SARC -0.305; TCGA THCA -0.188 |
hsa-miR-27b-5p | TSPAN13 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; OV; PRAD; UCEC | MirTarget | TCGA BRCA -0.17; TCGA CESC -0.439; TCGA ESCA -0.191; TCGA HNSC -0.115; TCGA KIRC -0.143; TCGA LGG -0.097; TCGA LIHC -0.249; TCGA LUSC -0.228; TCGA OV -0.247; TCGA PRAD -0.383; TCGA UCEC -0.277 |
hsa-miR-27b-5p | GLCCI1 | 9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; OV; STAD | MirTarget; miRNATAP | TCGA BRCA -0.092; TCGA CESC -0.117; TCGA ESCA -0.272; TCGA KIRC -0.228; TCGA LGG -0.424; TCGA LUAD -0.178; TCGA LUSC -0.325; TCGA OV -0.168; TCGA STAD -0.252 |
hsa-miR-27b-5p | MGAT4A | 10 cancers: BRCA; CESC; ESCA; HNSC; LUSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.144; TCGA CESC -0.43; TCGA ESCA -0.584; TCGA HNSC -0.16; TCGA LUSC -0.487; TCGA PRAD -0.243; TCGA SARC -0.141; TCGA THCA -0.077; TCGA STAD -0.252; TCGA UCEC -0.253 |
hsa-miR-27b-5p | GFRA1 | 9 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUSC; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.318; TCGA COAD -0.483; TCGA ESCA -0.637; TCGA HNSC -0.476; TCGA LGG -0.938; TCGA LUSC -0.357; TCGA SARC -0.399; TCGA THCA -0.831; TCGA STAD -0.73 |
hsa-miR-27b-5p | STC1 | 9 cancers: BRCA; CESC; COAD; HNSC; LUAD; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.155; TCGA CESC -0.575; TCGA COAD -0.318; TCGA HNSC -0.24; TCGA LUAD -0.202; TCGA LUSC -0.173; TCGA SARC -0.332; TCGA STAD -0.186; TCGA UCEC -0.424 |
hsa-miR-27b-5p | PGM3 | 10 cancers: CESC; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA CESC -0.243; TCGA HNSC -0.192; TCGA KIRC -0.162; TCGA KIRP -0.16; TCGA LGG -0.159; TCGA PAAD -0.197; TCGA PRAD -0.276; TCGA SARC -0.084; TCGA THCA -0.088; TCGA UCEC -0.13 |
hsa-miR-27b-5p | SEC63 | 10 cancers: CESC; ESCA; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC | MirTarget | TCGA CESC -0.138; TCGA ESCA -0.156; TCGA HNSC -0.123; TCGA KIRP -0.072; TCGA LGG -0.103; TCGA LUAD -0.083; TCGA OV -0.083; TCGA PAAD -0.174; TCGA PRAD -0.159; TCGA SARC -0.108 |
hsa-miR-27b-5p | LHFPL2 | 9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD | mirMAP | TCGA CESC -0.132; TCGA ESCA -0.184; TCGA HNSC -0.252; TCGA KIRC -0.672; TCGA KIRP -0.226; TCGA LUAD -0.154; TCGA LUSC -0.309; TCGA SARC -0.107; TCGA STAD -0.165 |
Enriched cancer pathways of putative targets