microRNA information: hsa-miR-296-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-296-3p | miRbase |
| Accession: | MIMAT0004679 | miRbase |
| Precursor name: | hsa-mir-296 | miRbase |
| Precursor accession: | MI0000747 | miRbase |
| Symbol: | MIR296 | HGNC |
| RefSeq ID: | NR_029844 | GenBank |
| Sequence: | GAGGGUUGGGUGGAGGCUCUCC |
Reported expression in cancers: hsa-miR-296-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-296-3p | esophageal cancer | deregulation | "The prognostic and chemotherapeutic value of miR 2 ......" | 20485139 | Northern blot; qPCR; Microarray |
| hsa-miR-296-3p | lung cancer | deregulation | "Therefore we conduct to systematically identify mi ......" | 26870998 | Microarray |
| hsa-miR-296-3p | thyroid cancer | downregulation | "Of these miR-296 and miR-139 were down-regulated a ......" | 19926710 |
Reported cancer pathway affected by hsa-miR-296-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-296-3p | esophageal cancer | Apoptosis pathway | "The prognostic and chemotherapeutic value of miR 2 ......" | 20485139 |
Reported cancer prognosis affected by hsa-miR-296-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-296-3p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-296-3p | esophageal cancer | poor survival | "The prognostic and chemotherapeutic value of miR 2 ......" | 20485139 | |
| hsa-miR-296-3p | glioblastoma | drug resistance | "MiR 296 3p regulates cell growth and multi drug re ......" | 22999387 | Western blot; Luciferase |
| hsa-miR-296-3p | prostate cancer | staging | "Regulation of HMGA1 expression by microRNA 296 aff ......" | 21138859 | |
| hsa-miR-296-3p | prostate cancer | malignant trasformation; drug resistance; metastasis | "Here we find that the expression level of miR-296- ......" | 24263102 | |
| hsa-miR-296-3p | thyroid cancer | differentiation | "Investigation showed that parathyroid tumours were ......" | 25577262 |
Reported gene related to hsa-miR-296-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-296-3p | esophageal cancer | AKR1B1 | "Downregulation of miR-296 could confer sensitivity ......" | 20485139 |
| hsa-miR-296-3p | esophageal cancer | BAX | "Downregulation of miR-296 could significantly decr ......" | 20485139 |
| hsa-miR-296-3p | esophageal cancer | BCL2 | "Downregulation of miR-296 could significantly decr ......" | 20485139 |
| hsa-miR-296-3p | esophageal cancer | CCND1 | "Downregulation of miR-296 might inhibit growth of ......" | 20485139 |
| hsa-miR-296-3p | thyroid cancer | HGF | "Finally miR-296 and miR-222 levels negatively corr ......" | 19926710 |
| hsa-miR-296-3p | prostate cancer | HMGA1 | "Regulation of HMGA1 expression by microRNA 296 aff ......" | 21138859 |
| hsa-miR-296-3p | prostate cancer | ICA1 | "Here we find that the expression level of miR-296- ......" | 24263102 |
| hsa-miR-296-3p | prostate cancer | ICAM1 | "We demonstrate that miR-296-3p directly targets an ......" | 24263102 |
| hsa-miR-296-3p | glioblastoma | KCNH1 | "In order to investigate the possible role of miRNA ......" | 22999387 |
| hsa-miR-296-3p | glioblastoma | NF2 | "Through microRNA microarray analysis we found that ......" | 26923924 |
| hsa-miR-296-3p | esophageal cancer | PCNA | "Downregulation of miR-296 might inhibit growth of ......" | 20485139 |
| hsa-miR-296-3p | lung squamous cell cancer | PLK1 | "miR 296 5p suppresses cell viability by directly t ......" | 26549165 |
| hsa-miR-296-3p | ovarian cancer | S100A4 | "Then by an integrated informatics analysis and luc ......" | 27186401 |
| hsa-miR-296-3p | glioblastoma | SOX2 | "Epigenetic modulation of a miR 296 5p:HMGA1 axis r ......" | 26898758 |
| hsa-miR-296-3p | thyroid cancer | TXK | "Finally miR-296 and miR-222 levels negatively corr ......" | 19926710 |
Expression profile in cancer corhorts:
