microRNA information: hsa-miR-296-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-296-5p | miRbase |
| Accession: | MIMAT0000690 | miRbase |
| Precursor name: | hsa-mir-296 | miRbase |
| Precursor accession: | MI0000747 | miRbase |
| Symbol: | MIR296 | HGNC |
| RefSeq ID: | NR_029844 | GenBank |
| Sequence: | AGGGCCCCCCCUCAAUCCUGU |
Reported expression in cancers: hsa-miR-296-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-296-5p | esophageal cancer | deregulation | "The prognostic and chemotherapeutic value of miR 2 ......" | 20485139 | Northern blot; qPCR; Microarray |
| hsa-miR-296-5p | gastric cancer | upregulation | "Identified miRNAs were further validated in the tr ......" | 27756776 | qPCR |
| hsa-miR-296-5p | liver cancer | downregulation | "The following miRNAs were downregulated in the tum ......" | 23205106 | |
| hsa-miR-296-5p | thyroid cancer | downregulation | "Of these miR-296 and miR-139 were down-regulated a ......" | 19926710 |
Reported cancer pathway affected by hsa-miR-296-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-296-5p | esophageal cancer | Apoptosis pathway | "The prognostic and chemotherapeutic value of miR 2 ......" | 20485139 | |
| hsa-miR-296-5p | gastric cancer | cell cycle pathway | "MicroRNA 296 5p increases proliferation in gastric ......" | 23353818 |
Reported cancer prognosis affected by hsa-miR-296-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-296-5p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-296-5p | breast cancer | differentiation; progression; motility; poor survival; metastasis | "miR 296/Scribble axis is deregulated in human brea ......" | 24527800 | |
| hsa-miR-296-5p | esophageal cancer | poor survival | "The prognostic and chemotherapeutic value of miR 2 ......" | 20485139 | |
| hsa-miR-296-5p | gastric cancer | poor survival | "Using quantitative reverse transcription polymeras ......" | 27756776 | |
| hsa-miR-296-5p | glioblastoma | drug resistance | "MiR 296 3p regulates cell growth and multi drug re ......" | 22999387 | |
| hsa-miR-296-5p | glioblastoma | drug resistance | "Epigenetic modulation of a miR 296 5p:HMGA1 axis r ......" | 26898758 | |
| hsa-miR-296-5p | lung squamous cell cancer | progression | "miR 296 5p suppresses cell viability by directly t ......" | 26549165 | Western blot; Luciferase |
| hsa-miR-296-5p | prostate cancer | staging | "Regulation of HMGA1 expression by microRNA 296 aff ......" | 21138859 | |
| hsa-miR-296-5p | prostate cancer | worse prognosis | "MicroRNA 296 5p miR 296 5p functions as a tumor su ......" | 24915000 | Luciferase |
| hsa-miR-296-5p | thyroid cancer | differentiation | "Investigation showed that parathyroid tumours were ......" | 25577262 |
Reported gene related to hsa-miR-296-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-296-5p | esophageal cancer | AKR1B1 | "Downregulation of miR-296 could confer sensitivity ......" | 20485139 |
| hsa-miR-296-5p | esophageal cancer | BAX | "Downregulation of miR-296 could significantly decr ......" | 20485139 |
| hsa-miR-296-5p | esophageal cancer | BCL2 | "Downregulation of miR-296 could significantly decr ......" | 20485139 |
| hsa-miR-296-5p | esophageal cancer | CCND1 | "Downregulation of miR-296 might inhibit growth of ......" | 20485139 |
| hsa-miR-296-5p | gastric cancer | CDX1 | "In addition the detection of miR-296-5p and expres ......" | 23353818 |
| hsa-miR-296-5p | thyroid cancer | HGF | "Finally miR-296 and miR-222 levels negatively corr ......" | 19926710 |
| hsa-miR-296-5p | prostate cancer | HMGA1 | "Regulation of HMGA1 expression by microRNA 296 aff ......" | 21138859 |
| hsa-miR-296-5p | esophageal cancer | PCNA | "Downregulation of miR-296 might inhibit growth of ......" | 20485139 |
| hsa-miR-296-5p | prostate cancer | PIN1 | "A bioinformatics analysis revealed that miR-296-5p ......" | 24915000 |
| hsa-miR-296-5p | lung squamous cell cancer | PLK1 | "miR 296 5p suppresses cell viability by directly t ......" | 26549165 |
| hsa-miR-296-5p | ovarian cancer | S100A4 | "Then by an integrated informatics analysis and luc ......" | 27186401 |
| hsa-miR-296-5p | glioblastoma | SOX2 | "Epigenetic modulation of a miR 296 5p:HMGA1 axis r ......" | 26898758 |
| hsa-miR-296-5p | glioblastoma | TWIST1 | "These results show for the first time that miR-296 ......" | 26898758 |
| hsa-miR-296-5p | thyroid cancer | TXK | "Finally miR-296 and miR-222 levels negatively corr ......" | 19926710 |
Expression profile in cancer corhorts:
