microRNA information: hsa-miR-297
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-297 | miRbase |
| Accession: | MIMAT0004450 | miRbase |
| Precursor name: | hsa-mir-297 | miRbase |
| Precursor accession: | MI0005775 | miRbase |
| Symbol: | MIR297 | HGNC |
| RefSeq ID: | NR_030643 | GenBank |
| Sequence: | AUGUAUGUGUGCAUGUGCAUG |
Reported expression in cancers: hsa-miR-297
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-297 | colorectal cancer | downregulation | "miR 297 modulates multidrug resistance in human co ......" | 22676135 | |
| hsa-miR-297 | gastric cancer | upregulation | "MicroRNA microarray was applied to assess the miRN ......" | 24054006 | Microarray |
| hsa-miR-297 | lung cancer | upregulation | "However the functions and mechanisms of miR-297 in ......" | 27554041 | qPCR |
Reported cancer pathway affected by hsa-miR-297
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-297 | NA | NA | "NA ......" | NA | NA |
| hsa-miR-297 | " ......" |
Reported cancer prognosis affected by hsa-miR-297
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-297 | colorectal cancer | drug resistance | "miR 297 modulates multidrug resistance in human co ......" | 22676135 | |
| hsa-miR-297 | glioblastoma | poor survival | "This work features PCR quantification of miRs and ......" | 24158111 | Luciferase |
| hsa-miR-297 | lung cancer | cell migration | "miR 297 acts as an oncogene by targeting GPC5 in l ......" | 27554041 | Colony formation; Western blot; Luciferase |
Reported gene related to hsa-miR-297
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-297 | lung cancer | GPC5 | "miR 297 acts as an oncogene by targeting GPC5 in l ......" | 27554041 |
| hsa-miR-297 | glioblastoma | HNRNPL | "In addition hypoxia and its mediator hnRNPL upregu ......" | 24158111 |
| hsa-miR-297 | glioblastoma | PARP1 | "This work features PCR quantification of miRs and ......" | 24158111 |