microRNA information: hsa-miR-299-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-299-3p | miRbase |
| Accession: | MIMAT0000687 | miRbase |
| Precursor name: | hsa-mir-299 | miRbase |
| Precursor accession: | MI0000744 | miRbase |
| Symbol: | MIR299 | HGNC |
| RefSeq ID: | NR_029841 | GenBank |
| Sequence: | UAUGUGGGAUGGUAAACCGCUU |
Reported expression in cancers: hsa-miR-299-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-299-3p | glioblastoma | upregulation | "Long non coding RNA taurine upregulated 1 enhances ......" | 27345398 | |
| hsa-miR-299-3p | kidney renal cell cancer | deregulation | "This study aims to profile dysregulated microRNA m ......" | 25938468 | Microarray |
Reported cancer pathway affected by hsa-miR-299-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-299-3p | lung cancer | Apoptosis pathway | "MicroRNA 299 3p promotes the sensibility of lung c ......" | 26617714 | Luciferase; MTT assay |
| hsa-miR-299-3p | prostate cancer | Apoptosis pathway | "MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......" | 24166498 |
Reported cancer prognosis affected by hsa-miR-299-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-299-3p | kidney renal cell cancer | staging | "This study aims to profile dysregulated microRNA m ......" | 25938468 | |
| hsa-miR-299-3p | lung cancer | drug resistance | "MicroRNA 299 3p promotes the sensibility of lung c ......" | 26617714 | Luciferase; MTT assay |
Reported gene related to hsa-miR-299-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-299-3p | lung cancer | ABCB1 | "The expression level of miR-299-3p was dysregulate ......" | 26617714 |
| hsa-miR-299-3p | lung cancer | ABCE1 | "MicroRNA 299 3p promotes the sensibility of lung c ......" | 26617714 |
| hsa-miR-299-3p | breast cancer | SPP1 | "Our studies further show that increased OPN levels ......" | 19538464 |
| hsa-miR-299-3p | glioblastoma | TUG1 | "Besides knockdown of TUG1 significantly increased ......" | 27345398 |
| hsa-miR-299-3p | glioblastoma | VEGFA | "Moreover knockdown of TUG1 reduced the expression ......" | 27345398 |