microRNA information: hsa-miR-29a-3p

SectionIDlink
Mature name: hsa-miR-29a-3pmiRbase
Accession: MIMAT0000086miRbase
Precursor name: hsa-mir-29a miRbase
Precursor accession: MI0000087miRbase
Symbol: MIR29AHGNC
RefSeq ID: NR_029503GenBank
Sequence: UAGCACCAUCUGAAAUCGGUUA



Reported expression in cancers: hsa-miR-29a-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-29a-3p

acute myeloid leukemiadownregulation"miR 29a and miR 142 3p downregulation and diagnost ......"21678057Microarray; Northern blot; qPCR
hsa-miR-29a-3p

acute myeloid leukemiadownregulation"MicroRNA 29a and microRNA 142 3p are regulators of ......"22493297
hsa-miR-29a-3p

acute myeloid leukemiadownregulation"Prognostic value of miR 29a expression in pediatri ......"22981932qPCR
hsa-miR-29a-3p

acute myeloid leukemiadownregulation"The role mechanism and potentially therapeutic app ......"24076586
hsa-miR-29a-3p

breast cancerupregulation"Among methods for profiling levels of miRNAs next- ......"22387599RNA-Seq; qPCR; Northern blot
hsa-miR-29a-3p

breast cancerupregulation"Then five up-regulated miRNAs miR-100 miR-29a miR- ......"23994196
hsa-miR-29a-3p

breast cancerupregulation"MiR 29a promotes cell proliferation and EMT in bre ......"27555295
hsa-miR-29a-3p

breast cancerupregulation"The aim of this study was to investigate the role ......"27746365qPCR
hsa-miR-29a-3p

colon cancerupregulation"Tumor microRNA 29a expression and the risk of recu ......"22426940Microarray; qPCR
hsa-miR-29a-3p

colorectal cancerdownregulation"Two microRNAs miR-29a and miR-29c were disclosed a ......"22348113
hsa-miR-29a-3p

colorectal cancerupregulation"Quantitative reverse-transcription PCR was used to ......"23267864Reverse transcription PCR
hsa-miR-29a-3p

colorectal cancerupregulation"To assess the serum expression of 3 microRNA marke ......"25736690
hsa-miR-29a-3p

colorectal cancerdownregulation"Fecal miR 29a and miR 224 as the noninvasive bioma ......"26756616
hsa-miR-29a-3p

esophageal cancerdownregulation"MicroRNA miR-29a has been associated with carcinog ......"25435940
hsa-miR-29a-3p

gastric cancerdownregulation"Reduced miR 29a 3p expression is linked to the cel ......"25889078qPCR
hsa-miR-29a-3p

glioblastomaderegulation"A number of changes in the levels of microRNAs wer ......"24155920
hsa-miR-29a-3p

kidney renal cell cancerderegulation"This study aims to profile dysregulated microRNA m ......"25938468Microarray
hsa-miR-29a-3p

liver cancerdownregulation"Effects of microRNA 29 on apoptosis tumorigenicity ......"20041405Microarray; Northern blot; Reverse transcription PCR
hsa-miR-29a-3p

liver cancerdownregulation"Modulation of miR 29 expression by α fetoprotein ......"24798303Microarray
hsa-miR-29a-3p

lung cancerdownregulation"Recent studies of microRNA miRNA expression signat ......"27488440
hsa-miR-29a-3p

lung squamous cell cancerderegulation"Locked nucleic acids miRNA microarray expression p ......"20508945Microarray
hsa-miR-29a-3p

lung squamous cell cancerderegulation"Furthermore miR-29 overexpression downregulated β ......"23939044
hsa-miR-29a-3p

lymphomadownregulation"Notably expression levels of miR-29 family are ass ......"20086245
hsa-miR-29a-3p

ovarian cancerderegulation"The authors used quantitative polymerase chain rea ......"25556270qPCR
hsa-miR-29a-3p

prostate cancerupregulation"Epigenetic deregulation of miR 29a and miR 1256 by ......"22805767
hsa-miR-29a-3p

sarcomaupregulation"Furthermore the upregulated miRNAs included miR-9/ ......"23133552



Reported cancer pathway affected by hsa-miR-29a-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-29a-3p

acute myeloid leukemiacell cycle pathway"microRNA 29a induces aberrant self renewal capacit ......"20212066
hsa-miR-29a-3p

acute myeloid leukemiaApoptosis pathway"The role mechanism and potentially therapeutic app ......"24076586
hsa-miR-29a-3p

breast cancerApoptosis pathway"MiR 222 and miR 29a contribute to the drug resista ......"23994196
hsa-miR-29a-3p

breast cancerApoptosis pathway"Knockdown of microRNA 29a Changes the Expression o ......"26802653
hsa-miR-29a-3p

breast cancerApoptosis pathway"MicroRNA 29a contributes to drug resistance of bre ......"27523474Western blot
hsa-miR-29a-3p

colorectal cancerApoptosis pathway"Recent studies have suggested that microRNA-29 miR ......"25472644
hsa-miR-29a-3p

esophageal cancerNotch signaling pathway"miR 29a activates Hes1 by targeting Nfia in esopha ......"25435940
hsa-miR-29a-3p

gastric cancercell cycle pathway"MiR 29a inhibits cell proliferation and induces ce ......"21998710
hsa-miR-29a-3p

glioblastomaApoptosis pathway"Using this in vitro system a microarray-based high ......"24155920
hsa-miR-29a-3p

liver cancerApoptosis pathway"Effects of microRNA 29 on apoptosis tumorigenicity ......"20041405
hsa-miR-29a-3p

lung squamous cell cancerWnt signaling pathway; Apoptosis pathway"Suppression of Wnt signaling by the miR 29 family ......"23939044Western blot
hsa-miR-29a-3p

lymphomaApoptosis pathway"MiR 29a down regulation in ALK positive anaplastic ......"21471522
hsa-miR-29a-3p

pancreatic cancerEpithelial mesenchymal transition pathway"MicroRNA 29a Promotes Pancreatic Cancer Growth by ......"26356262Western blot; Cell migration assay; MTT assay
hsa-miR-29a-3p

retinoblastomacell cycle pathway"To investigate differential expression of microRNA ......"21941147
hsa-miR-29a-3p

sarcomacell cycle pathway"In addition to CCND2 miR-29 also targets E2F7 anot ......"22330340



Reported cancer prognosis affected by hsa-miR-29a-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-29a-3p

acute myeloid leukemiadrug resistance"Together the data support a tumor suppressor role ......"19850741
hsa-miR-29a-3p

acute myeloid leukemiaprogression; differentiation"microRNA 29a induces aberrant self renewal capacit ......"20212066
hsa-miR-29a-3p

acute myeloid leukemiadifferentiation"MicroRNA 29a and microRNA 142 3p are regulators of ......"22493297
hsa-miR-29a-3p

acute myeloid leukemiapoor survival; staging; worse prognosis"Prognostic value of miR 29a expression in pediatri ......"22981932
hsa-miR-29a-3p

acute myeloid leukemiadifferentiation"The role mechanism and potentially therapeutic app ......"24076586
hsa-miR-29a-3p

acute myeloid leukemiadrug resistance"microRNA-29 miR-29 family of non-coding small RNAs ......"26862847
hsa-miR-29a-3p

breast cancerdrug resistance"Expression levels of miR-210 miR-21 miR-29a and mi ......"22370716
hsa-miR-29a-3p

breast cancerdifferentiation; drug resistance"Progestin suppression of miR 29 potentiates dediff ......"22751119
hsa-miR-29a-3p

breast cancerdrug resistance"MiR 222 and miR 29a contribute to the drug resista ......"23994196
hsa-miR-29a-3p

breast cancertumorigenesis"The inhibitory role of Mir 29 in growth of breast ......"24289849
hsa-miR-29a-3p

breast cancerdrug resistance"MTT-cytotoxic miRNA microarray Real-time quantitat ......"25562151Western blot; Luciferase
hsa-miR-29a-3p

breast cancerprogression"ADAM12 L is a direct target of the miR 29 and miR ......"25886595Western blot; Luciferase
hsa-miR-29a-3p

breast cancercell migration"MicroRNA 29a inhibits cell migration and invasion ......"25955714
hsa-miR-29a-3p

breast cancermetastasis"In a cross-platform analysis of a validation cohor ......"26821018
hsa-miR-29a-3p

breast cancerdrug resistance"MicroRNA 29a contributes to drug resistance of bre ......"27523474Western blot
hsa-miR-29a-3p

breast cancermetastasis; poor survival"MiR 29a promotes cell proliferation and EMT in bre ......"27555295Luciferase
hsa-miR-29a-3p

breast cancerworse prognosis; drug resistance"The aim of this study was to investigate the role ......"27746365
hsa-miR-29a-3p

cervical and endocervical cancerprogression"The oncogenic proteins E6 E7 and E5 expressed by H ......"23189617
hsa-miR-29a-3p

cervical and endocervical cancerstaging; progression"An initial screening of miRNA expression was perfo ......"26171195
hsa-miR-29a-3p

colon cancerstaging; recurrence; poor survival"Tumor microRNA 29a expression and the risk of recu ......"22426940
hsa-miR-29a-3p

colorectal cancerstaging"We found that plasma miR-29a and miR-92a have sign ......"19876917
hsa-miR-29a-3p

colorectal cancerrecurrence"Two microRNAs miR-29a and miR-29c were disclosed a ......"22348113
hsa-miR-29a-3p

colorectal cancerstaging"Circulating miR 17 3p miR 29a miR 92a and miR 135b ......"23568010
hsa-miR-29a-3p

colorectal cancerstaging"microRNA expression profile in stage III colorecta ......"23673725
hsa-miR-29a-3p

colorectal cancermetastasis; worse prognosis"MicroRNA 29a promotes colorectal cancer metastasis ......"24281002Western blot; Luciferase
hsa-miR-29a-3p

colorectal cancerdifferentiation"Recent studies have suggested that microRNA-29 miR ......"25472644
hsa-miR-29a-3p

colorectal cancermalignant trasformation"To assess the serum expression of 3 microRNA marke ......"25736690
hsa-miR-29a-3p

colorectal cancerprogression"Downloading from GEO Gene Expression Omnibus datab ......"25755742
hsa-miR-29a-3p

endometrial cancermalignant trasformation"Expression profiling of normal and malignant endom ......"20028871
hsa-miR-29a-3p

esophageal cancertumorigenesis"miR 29a activates Hes1 by targeting Nfia in esopha ......"25435940
hsa-miR-29a-3p

gastric cancermetastasis"The de-regulation of the miR-29 family and DNA met ......"25874772Transwell assay; Luciferase
hsa-miR-29a-3p

gastric cancercell migration; tumorigenesis; metastasis"Reduced miR 29a 3p expression is linked to the cel ......"25889078Wound Healing Assay; Western blot; Transwell assay
hsa-miR-29a-3p

gastric cancercell migration"MicroRNA 29a inhibits cell migration and invasion ......"25997819Western blot; Luciferase
hsa-miR-29a-3p

gastric cancerworse prognosis"Hsa miR 21 and Hsa miR 29 in Tissue as Potential D ......"26509997
hsa-miR-29a-3p

gastric cancerdrug resistance"The expressions of the other two members of miR-29 ......"26564501
hsa-miR-29a-3p

gastric cancermetastasis"hTERT mediates gastric cancer metastasis partially ......"26903137
hsa-miR-29a-3p

glioblastomadifferentiation"Using this in vitro system a microarray-based high ......"24155920
hsa-miR-29a-3p

glioblastomapoor survival"Feedback Loop Regulation of SCAP/SREBP 1 by miR 29 ......"27477273
hsa-miR-29a-3p

kidney renal cell cancerstaging"This study aims to profile dysregulated microRNA m ......"25938468
hsa-miR-29a-3p

liver cancerworse prognosis; malignant trasformation; tumorigenesis; poor survival"Effects of microRNA 29 on apoptosis tumorigenicity ......"20041405
hsa-miR-29a-3p

liver cancermalignant trasformation"microRNA 29 can regulate expression of the long no ......"21625215
hsa-miR-29a-3p

liver cancerrecurrence"MicroRNA 29a 5p is a novel predictor for early rec ......"23285022
hsa-miR-29a-3p

liver cancerworse prognosis"Modulation of miR 29 expression by α fetoprotein ......"24798303
hsa-miR-29a-3p

liver cancermetastasis; progression; tumorigenesis"Negative feedback of miR 29 family TET1 involves i ......"25367851
hsa-miR-29a-3p

liver cancermetastasis; progression; tumorigenesis"Erratum to: Negative feedback of miR 29 family TET ......"25616722
hsa-miR-29a-3p

liver cancerworse prognosis; progression; poor survival"To establish serum microRNA profiles as prognostic ......"27317768
hsa-miR-29a-3p

lung cancerworse prognosis"MicroRNA 29 family reverts aberrant methylation in ......"17890317
hsa-miR-29a-3p

lung cancerdrug resistance; poor survival"MicroRNA 29a regulates the benzoapyrene dihydrodio ......"23877787
hsa-miR-29a-3p

lung cancerstaging"Regulation of LOXL2 and SERPINH1 by antitumor micr ......"27488440Luciferase
hsa-miR-29a-3p

lung squamous cell cancermetastasis; progression; poor survival"The dual role of the microRNA-29 miR-29 family in ......"24909176
hsa-miR-29a-3p

lung squamous cell cancercell migration"Tumor suppressive microRNA 29 family inhibits canc ......"26676674Luciferase
hsa-miR-29a-3p

lung squamous cell cancerdrug resistance"Circulating miR 29a and miR 150 correlate with del ......"27117590
hsa-miR-29a-3p

lymphomaworse prognosis; poor survival"microRNA expression profile and identification of ......"20086245
hsa-miR-29a-3p

lymphomapoor survival; tumorigenesis"MiR 29a down regulation in ALK positive anaplastic ......"21471522
hsa-miR-29a-3p

lymphomatumorigenesis"Expression of MCL 1 and microRNA 29a in extranodal ......"23484699
hsa-miR-29a-3p

melanomastaging; metastasis"We hypothesized that the expression level of miR-2 ......"21081840
hsa-miR-29a-3p

ovarian cancerdrug resistance"Downregulation of miR 29 contributes to cisplatin ......"23904094
hsa-miR-29a-3p

pancreatic cancerdrug resistance"MicroRNA 29a induces resistance to gemcitabine thr ......"23900458
hsa-miR-29a-3p

pancreatic cancercell migration"Micro RNAs miR 29a and miR 330 5p function as tumo ......"26036346
hsa-miR-29a-3p

pancreatic cancerprogression; tumorigenesis; metastasis"MicroRNA 29a Promotes Pancreatic Cancer Growth by ......"26356262Western blot; Cell migration assay; MTT assay
hsa-miR-29a-3p

pancreatic cancerdrug resistance"In particular modulations of let-7 miR-29a miR-17- ......"27539232
hsa-miR-29a-3p

pancreatic cancercell migration"Novel role of miR 29a in pancreatic cancer autopha ......"27626694
hsa-miR-29a-3p

prostate cancerprogression"Epigenetic deregulation of miR 29a and miR 1256 by ......"22805767Western blot
hsa-miR-29a-3p

prostate cancermetastasis"Herein we aimed to investigate the functional sign ......"24820027Luciferase
hsa-miR-29a-3p

sarcomadifferentiation"NF kappaB YY1 miR 29 regulatory circuitry in skele ......"18977326
hsa-miR-29a-3p

sarcomaprogression"The microRNA 29 plays a central role in osteosarco ......"23113351
hsa-miR-29a-3p

sarcomadifferentiation; tumorigenesis"miR 29 acts as a decoy in sarcomas to protect the ......"23901138
hsa-miR-29a-3p

sarcomaprogression; differentiation"Therefore in this review we focus on the regulatio ......"24831881
hsa-miR-29a-3p

sarcomaprogression; worse prognosis; metastasis; recurrence"Prognostic value of the microRNA 29 family in pati ......"25015394



Reported gene related to hsa-miR-29a-3p

miRNAcancergenereportingPUBMED
hsa-miR-29a-3p

bladder cancerDNMT3A"Mechanistically ATDC exerted its oncogenic effects ......"26471361
hsa-miR-29a-3p

gastric cancerDNMT3A"The de-regulation of the miR-29 family and DNA met ......"25874772
hsa-miR-29a-3p

liver cancerDNMT3A"Consistent with miR-29's role in targeting DNA met ......"24798303
hsa-miR-29a-3p

lung cancerDNMT3A"Among the reported down-regulated miRNAs in lung c ......"17890317
hsa-miR-29a-3p

lung squamous cell cancerDNMT3A"The miR-29 family miR-29a -29b and -29c which nega ......"23939044
hsa-miR-29a-3p

lymphomaDNMT3A"DNMT3A and 3B genes can be regulated post-transcri ......"25746661
hsa-miR-29a-3p

ovarian cancerDNMT3A"The miR-29 family and predicted target genes were ......"22479643
hsa-miR-29a-3p

glioblastomaMCL1"Finally miR-29a and miR-29b targeted MCL1 mRNA in ......"24155920
hsa-miR-29a-3p

liver cancerMCL1"Subsequent investigation characterized two antiapo ......"20041405
hsa-miR-29a-3p

lymphomaMCL1"MiR 29a down regulation in ALK positive anaplastic ......"21471522
hsa-miR-29a-3p

lymphomaMCL1"Expression of MCL 1 and microRNA 29a in extranodal ......"23484699
hsa-miR-29a-3p

prostate cancerMCL1"The identification of laminin gamma 1 LAMC1 and my ......"26052614
hsa-miR-29a-3p

acute myeloid leukemiaCDK6"In addition a target of miR-29a cyclin-dependent k ......"22493297
hsa-miR-29a-3p

lymphomaCDK6"microRNA expression profile and identification of ......"20086245
hsa-miR-29a-3p

melanomaCDK6"The IFN-γ-induced G1-arrest of melanoma cells inv ......"23245396
hsa-miR-29a-3p

liver cancerDNMT3B"TGF-β increased DNMT3B and DNMT1 and decreased mi ......"23789939
hsa-miR-29a-3p

lung squamous cell cancerDNMT3B"The miR-29 family miR-29a -29b and -29c which nega ......"23939044
hsa-miR-29a-3p

ovarian cancerDNMT3B"The miR-29 family and predicted target genes were ......"22479643
hsa-miR-29a-3p

breast cancerKLF4"Progestin suppression of miR 29 potentiates dediff ......"22751119
hsa-miR-29a-3p

colorectal cancerKLF4"KLF4 was identified as a direct target gene of miR ......"24281002
hsa-miR-29a-3p

colorectal cancerKLF4"Finally a transfection assay was performed to vali ......"22703586
hsa-miR-29a-3p

bladder cancerPTEN"Mechanistically ATDC exerted its oncogenic effects ......"26471361
hsa-miR-29a-3p

breast cancerPTEN"The most importance is that we identify two miRNAs ......"23994196
hsa-miR-29a-3p

breast cancerPTEN"RT-qPCR and Western blot results showed that downr ......"27523474
hsa-miR-29a-3p

breast cancerTET1"Furthermore data from bioinformatic analysis valid ......"27555295
hsa-miR-29a-3p

liver cancerTET1"Negative feedback of miR 29 family TET1 involves i ......"25367851
hsa-miR-29a-3p

liver cancerTET1"Erratum to: Negative feedback of miR 29 family TET ......"25616722
hsa-miR-29a-3p

gastric cancerCCND2"We further demonstrated that miR-29 family acted a ......"24130168
hsa-miR-29a-3p

sarcomaCCND2"In addition to CCND2 miR-29 also targets E2F7 anot ......"22330340
hsa-miR-29a-3p

liver cancerDNMT1"MiRNA-dependent regulation of MEG3 expression was ......"21625215
hsa-miR-29a-3p

liver cancerDNMT1"Recent studies have shown that the epigenetic regu ......"23789939
hsa-miR-29a-3p

lung cancerLOXL2"Regulation of LOXL2 and SERPINH1 by antitumor micr ......"27488440
hsa-miR-29a-3p

lung squamous cell cancerLOXL2"Tumor suppressive microRNA 29 family inhibits canc ......"26676674
hsa-miR-29a-3p

lung cancerSCLC1"Two microRNA panels yielded high diagnostic accura ......"23043084
hsa-miR-29a-3p

lung squamous cell cancerSCLC1"Because microRNAs miRNA often act as tumor regulat ......"23966614
hsa-miR-29a-3p

breast cancerSLC10A4"We demonstrate that P4 rapidly downregulates miR-2 ......"22751119
hsa-miR-29a-3p

breast cancerSLC10A4"We previously described that P4 downregulation of ......"25241899
hsa-miR-29a-3p

breast cancerADAM12"ADAM12 L is a direct target of the miR 29 and miR ......"25886595
hsa-miR-29a-3p

liver cancerAFP"Overexpression of AFP or conditioned media from AF ......"24798303
hsa-miR-29a-3p

breast cancerAKR1B1"Our previous microarray found that miR-29a may str ......"27523474
hsa-miR-29a-3p

acute myeloid leukemiaAKT2"Furthermore a feed-back loop comprising of c-Myc m ......"24076586
hsa-miR-29a-3p

lymphomaALK"MiR 29a down regulation in ALK positive anaplastic ......"21471522
hsa-miR-29a-3p

prostate cancerAR"A direct AR regulation of miR-22 miR-29a and miR-1 ......"26052614
hsa-miR-29a-3p

acute myeloid leukemiaARHGEF1"miR-29a is overexpressed in human AML and like hum ......"20212066
hsa-miR-29a-3p

cervical and endocervical cancerARHGEF15"The oncogenic proteins E6 E7 and E5 expressed by H ......"23189617
hsa-miR-29a-3p

pancreatic cancerATG9A"In addition miR-29a decreased the expression of au ......"27626694
hsa-miR-29a-3p

breast cancerATP1B1"Many progestin-responsive genes are putative targe ......"22330642
hsa-miR-29a-3p

liver cancerBCL2"Subsequent investigation characterized two antiapo ......"20041405
hsa-miR-29a-3p

ovarian cancerCASP3"When combined with cisplatin treatment knockdown o ......"23904094
hsa-miR-29a-3p

ovarian cancerCASP9"When combined with cisplatin treatment knockdown o ......"23904094
hsa-miR-29a-3p

gastric cancerCDC37"MicroRNA 29a inhibits cell migration and invasion ......"25997819
hsa-miR-29a-3p

gastric cancerCDC42"This study was designed to investigate the effect ......"20507733
hsa-miR-29a-3p

lung cancerCDC7"MicroRNA 29a regulates the benzoapyrene dihydrodio ......"23877787
hsa-miR-29a-3p

liver cancerCDH1"Recent studies have shown that the epigenetic regu ......"23789939
hsa-miR-29a-3p

lung cancerCEACAM5"MicroRNA 29a suppresses the growth migration and i ......"25171863
hsa-miR-29a-3p

lung cancerCEACAM6"Furthermore miR-29a can suppress the growth migrat ......"25171863
hsa-miR-29a-3p

prostate cancerCX3CL1"MicroRNA software predicted that miR21 targets VCL ......"27509989
hsa-miR-29a-3p

lung cancerDBF4"In silico analysis identified microRNA-29 miR-29-b ......"23877787
hsa-miR-29a-3p

breast cancerDICER1"MiR-222/221 which target ESR1 itself and miR-29a a ......"21761362
hsa-miR-29a-3p

sarcomaE2F7"In addition to CCND2 miR-29 also targets E2F7 anot ......"22330340
hsa-miR-29a-3p

glioblastomaEGFR"Feedback Loop Regulation of SCAP/SREBP 1 by miR 29 ......"27477273
hsa-miR-29a-3p

sarcomaELAVL1"miR 29 acts as a decoy in sarcomas to protect the ......"23901138
hsa-miR-29a-3p

thyroid cancerEPHA3"Second the direct interaction between one of the u ......"25153510
hsa-miR-29a-3p

breast cancerESR1"MiR-222/221 which target ESR1 itself and miR-29a a ......"21761362
hsa-miR-29a-3p

B cell lymphomaEZH2"Combined inhibition of HDAC3 and EZH2 cooperativel ......"23079660
hsa-miR-29a-3p

lung squamous cell cancerFRTS1"Evidence for the role of miR-29 in tumor malignanc ......"24909176
hsa-miR-29a-3p

acute myeloid leukemiaFUT1"We show that miR-29a is highly expressed in HSC an ......"20212066
hsa-miR-29a-3p

pancreatic cancerGEM"The aim of this study was to investigate the relat ......"23900458
hsa-miR-29a-3p

acute myeloid leukemiaGLI2"Overexpression of each miR-29 member in THP1 and N ......"24076586
hsa-miR-29a-3p

B cell lymphomaHDAC3"Combined inhibition of HDAC3 and EZH2 cooperativel ......"23079660
hsa-miR-29a-3p

esophageal cancerHES1"miR 29a activates Hes1 by targeting Nfia in esopha ......"25435940
hsa-miR-29a-3p

gastric cancerITGA9"We found that the up-regulation of hTERT in gastri ......"26903137
hsa-miR-29a-3p

gastric cancerITGB1"hTERT mediates gastric cancer metastasis partially ......"26903137
hsa-miR-29a-3p

prostate cancerLAMC1"The identification of laminin gamma 1 LAMC1 and my ......"26052614
hsa-miR-29a-3p

pancreatic cancerLOC100508689"Altogether we have identified miR-29a and miR-330- ......"26036346
hsa-miR-29a-3p

thyroid cancerLOX"Second the direct interaction between one of the u ......"25153510
hsa-miR-29a-3p

pancreatic cancerMAP1LC3B"Furthermore miR-29a blocked autophagy flux as evid ......"27626694
hsa-miR-29a-3p

liver cancerMEG3"microRNA 29 can regulate expression of the long no ......"21625215
hsa-miR-29a-3p

gastric cancerMMP2"We further demonstrated that miR-29 family acted a ......"24130168
hsa-miR-29a-3p

pancreatic cancerMMRN1"Loss of miR-29 is correlated with a significant in ......"26095125
hsa-miR-29a-3p

pancreatic cancerMUC1"Our in vitro and in vivo experiments indicate that ......"26036346
hsa-miR-29a-3p

breast cancerMYBL2"We further found that Mir-29a negatively regulated ......"24289849
hsa-miR-29a-3p

acute myeloid leukemiaMYC"Furthermore a feed-back loop comprising of c-Myc m ......"24076586
hsa-miR-29a-3p

esophageal cancerNFIA"miR 29a activates Hes1 by targeting Nfia in esopha ......"25435940
hsa-miR-29a-3p

sarcomaNFKB1"Results demonstrate that in myoblasts miR-29 is re ......"18977326
hsa-miR-29a-3p

breast cancerNMI"Luciferase reporter assays and western blot analys ......"25174825
hsa-miR-29a-3p

esophageal cancerNOTCH1"miR-29a overexpression did not affect the expressi ......"25435940
hsa-miR-29a-3p

acute myeloid leukemiaNPM1"Furthermore our data showed that deregulated expre ......"21880628
hsa-miR-29a-3p

gastric cancerPAK1"Similar to si-Cdc42 the ectopic expression of micr ......"20507733
hsa-miR-29a-3p

gastric cancerROBO1"MicroRNA 29a inhibits cell migration and invasion ......"25997819
hsa-miR-29a-3p

gastric cancerSAPCD2"MiR 29a inhibits cell proliferation and induces ce ......"21998710
hsa-miR-29a-3p

glioblastomaSCAP"Here we unraveled a link between miR-29 and the SC ......"27477273
hsa-miR-29a-3p

lung cancerSERPINH1"Regulation of LOXL2 and SERPINH1 by antitumor micr ......"27488440
hsa-miR-29a-3p

pancreatic cancerSMAD3"Furthermore the loss of miR-29 in TGF-β1 activate ......"26095125
hsa-miR-29a-3p

retinoblastomaSOX5"Loop network analysis revealed a regulatory associ ......"25232279
hsa-miR-29a-3p

liver cancerSPARC"microRNA 29a suppresses cell proliferation by targ ......"23023935
hsa-miR-29a-3p

melanomaSTAT1"Interferon γ induced activation of Signal Transdu ......"23245396
hsa-miR-29a-3p

pancreatic cancerTFEB"In addition miR-29a decreased the expression of au ......"27626694
hsa-miR-29a-3p

prostate cancerTNF"Tumor necrosis factor receptor associated factor 4 ......"24100420
hsa-miR-29a-3p

prostate cancerTOLLIP"Tumor necrosis factor receptor associated factor 4 ......"24100420
hsa-miR-29a-3p

prostate cancerTRAF4"We initially identified microRNA-29a miR‑29a as ......"24100420
hsa-miR-29a-3p

melanomaTRG"We hypothesized that the expression level of miR-2 ......"21081840
hsa-miR-29a-3p

prostate cancerTRIM68"The increased levels of miR-29a and miR-1256 by is ......"22805767
hsa-miR-29a-3p

sarcomaTUT1"Nucleotidyl transferase TUT1 inhibits lipogenesis ......"25142229
hsa-miR-29a-3p

prostate cancerVCL"MicroRNA software predicted that miR21 targets VCL ......"27509989
hsa-miR-29a-3p

gastric cancerVEGFA"miR 29a suppresses growth and invasion of gastric ......"24209632
hsa-miR-29a-3p

lung squamous cell cancerWIF1"Suppression of Wnt signaling by the miR 29 family ......"23939044
hsa-miR-29a-3p

pancreatic cancerWNT3A"We also examined the effect of miR-29a on the Wnt/ ......"23900458
hsa-miR-29a-3p

sarcomaYY1"Results demonstrate that in myoblasts miR-29 is re ......"18977326
hsa-miR-29a-3p

pancreatic cancerZFP36"MicroRNA 29a Promotes Pancreatic Cancer Growth by ......"26356262



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-29a-3p
BCL7A
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.158; TCGA BRCA -0.102; TCGA ESCA -0.327; TCGA HNSC -0.096; TCGA KIRP -0.134; TCGA LGG -0.156; TCGA LIHC -0.199; TCGA LUAD -0.221; TCGA LUSC -0.37; TCGA OV -0.249; TCGA SARC -0.245; TCGA STAD -0.12; TCGA UCEC -0.168
hsa-miR-29a-3p
CCDC14
12 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.253; TCGA CESC -0.146; TCGA HNSC -0.144; TCGA KIRC -0.209; TCGA KIRP -0.426; TCGA LGG -0.2; TCGA LIHC -0.308; TCGA LUAD -0.107; TCGA LUSC -0.306; TCGA SARC -0.21; TCGA STAD -0.217; TCGA UCEC -0.122
hsa-miR-29a-3p
DAG1
9 cancers: BLCA; BRCA; COAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.099; TCGA COAD -0.093; TCGA LUSC -0.079; TCGA PAAD -0.14; TCGA PRAD -0.16; TCGA SARC -0.114; TCGA STAD -0.183; TCGA UCEC -0.066
hsa-miR-29a-3p
DICER1
10 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; OV; SARC; THCA; STAD
miRNAWalker2 validate; miRTarBase; miRNATAP
TCGA BLCA -0.082; TCGA CESC -0.085; TCGA COAD -0.111; TCGA ESCA -0.115; TCGA LUAD -0.066; TCGA LUSC -0.14; TCGA OV -0.092; TCGA SARC -0.064; TCGA THCA -0.131; TCGA STAD -0.169
hsa-miR-29a-3p
DNMT3A
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.247; TCGA BRCA -0.172; TCGA CESC -0.125; TCGA ESCA -0.197; TCGA HNSC -0.113; TCGA KIRP -0.27; TCGA LGG -0.095; TCGA LIHC -0.535; TCGA LUAD -0.213; TCGA LUSC -0.408; TCGA OV -0.372; TCGA PRAD -0.302; TCGA SARC -0.187; TCGA STAD -0.277; TCGA UCEC -0.218
hsa-miR-29a-3p
DNMT3B
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.261; TCGA BRCA -0.244; TCGA CESC -0.24; TCGA ESCA -0.529; TCGA HNSC -0.38; TCGA KIRP -0.191; TCGA LGG -0.271; TCGA LIHC -0.698; TCGA LUAD -0.551; TCGA LUSC -0.791; TCGA OV -0.311; TCGA PRAD -0.211; TCGA SARC -0.141; TCGA THCA -0.24; TCGA STAD -0.381; TCGA UCEC -0.357
hsa-miR-29a-3p
MYCN
11 cancers: BLCA; CESC; COAD; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.52; TCGA CESC -0.559; TCGA COAD -0.376; TCGA LGG -0.263; TCGA LIHC -0.894; TCGA LUAD -0.442; TCGA LUSC -0.511; TCGA OV -0.401; TCGA PAAD -0.313; TCGA THCA -0.565; TCGA UCEC -0.486
hsa-miR-29a-3p
NASP
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget
TCGA BLCA -0.062; TCGA CESC -0.067; TCGA HNSC -0.091; TCGA KIRC -0.166; TCGA KIRP -0.199; TCGA LGG -0.187; TCGA LIHC -0.231; TCGA LUAD -0.156; TCGA LUSC -0.264; TCGA SARC -0.138; TCGA UCEC -0.129
hsa-miR-29a-3p
PAN2
9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.372; TCGA CESC -0.128; TCGA ESCA -0.128; TCGA KIRC -0.244; TCGA KIRP -0.318; TCGA LGG -0.152; TCGA LUSC -0.154; TCGA PRAD -0.095; TCGA STAD -0.129
hsa-miR-29a-3p
PPM1D
13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; SARC; STAD
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.133; TCGA BRCA -0.181; TCGA CESC -0.19; TCGA COAD -0.158; TCGA KIRC -0.303; TCGA KIRP -0.184; TCGA LGG -0.165; TCGA LIHC -0.113; TCGA LUAD -0.131; TCGA OV -0.18; TCGA PAAD -0.2; TCGA SARC -0.205; TCGA STAD -0.091
hsa-miR-29a-3p
UBTD2
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; OV; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.192; TCGA CESC -0.13; TCGA ESCA -0.146; TCGA HNSC -0.108; TCGA KIRP -0.103; TCGA LGG -0.18; TCGA LIHC -0.126; TCGA LUAD -0.074; TCGA OV -0.115; TCGA PAAD -0.19; TCGA SARC -0.097; TCGA STAD -0.072; TCGA UCEC -0.096
hsa-miR-29a-3p
KDM5B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.182; TCGA BRCA -0.286; TCGA CESC -0.185; TCGA COAD -0.109; TCGA ESCA -0.298; TCGA HNSC -0.222; TCGA KIRC -0.117; TCGA KIRP -0.178; TCGA LGG -0.169; TCGA LIHC -0.285; TCGA LUSC -0.422; TCGA OV -0.174; TCGA PRAD -0.221; TCGA SARC -0.172; TCGA STAD -0.225; TCGA UCEC -0.249
hsa-miR-29a-3p
KLHL25
10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; OV; SARC; UCEC
MirTarget
TCGA BLCA -0.107; TCGA BRCA -0.079; TCGA CESC -0.194; TCGA HNSC -0.059; TCGA LGG -0.283; TCGA LUAD -0.176; TCGA LUSC -0.189; TCGA OV -0.192; TCGA SARC -0.255; TCGA UCEC -0.121
hsa-miR-29a-3p
ARHGEF19
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; OV; UCEC
MirTarget
TCGA BLCA -0.325; TCGA CESC -0.148; TCGA ESCA -0.553; TCGA HNSC -0.113; TCGA KIRP -0.253; TCGA LGG -0.113; TCGA LUSC -0.558; TCGA OV -0.231; TCGA UCEC -0.303
hsa-miR-29a-3p
ELF2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.165; TCGA BRCA -0.05; TCGA CESC -0.077; TCGA COAD -0.077; TCGA ESCA -0.124; TCGA KIRC -0.126; TCGA KIRP -0.149; TCGA LGG -0.098; TCGA SARC -0.242; TCGA STAD -0.198
hsa-miR-29a-3p
GPATCH2
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.097; TCGA BRCA -0.261; TCGA CESC -0.087; TCGA ESCA -0.217; TCGA HNSC -0.157; TCGA KIRC -0.09; TCGA KIRP -0.165; TCGA LGG -0.11; TCGA LIHC -0.181; TCGA LUAD -0.087; TCGA LUSC -0.308; TCGA OV -0.1; TCGA PRAD -0.168; TCGA SARC -0.109; TCGA STAD -0.097; TCGA UCEC -0.118
hsa-miR-29a-3p
ZMYM2
10 cancers: BLCA; BRCA; CESC; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.27; TCGA BRCA -0.134; TCGA CESC -0.154; TCGA LIHC -0.099; TCGA LUSC -0.234; TCGA OV -0.131; TCGA PRAD -0.12; TCGA SARC -0.137; TCGA STAD -0.301; TCGA UCEC -0.099
hsa-miR-29a-3p
VASH2
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; OV; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.62; TCGA CESC -0.361; TCGA COAD -0.301; TCGA ESCA -0.329; TCGA KIRC -0.229; TCGA LGG -0.305; TCGA LUAD -0.378; TCGA LUSC -0.267; TCGA OV -0.352; TCGA SARC -0.252; TCGA STAD -0.264; TCGA UCEC -0.293
hsa-miR-29a-3p
IREB2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.115; TCGA BRCA -0.116; TCGA CESC -0.116; TCGA COAD -0.119; TCGA ESCA -0.135; TCGA LGG -0.064; TCGA LUAD -0.104; TCGA LUSC -0.196; TCGA OV -0.081; TCGA PAAD -0.126; TCGA PRAD -0.153; TCGA SARC -0.127; TCGA THCA -0.078; TCGA STAD -0.139
hsa-miR-29a-3p
MORF4L2
11 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA
MirTarget; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.243; TCGA HNSC -0.085; TCGA LIHC -0.057; TCGA LUAD -0.093; TCGA LUSC -0.183; TCGA OV -0.088; TCGA PAAD -0.108; TCGA PRAD -0.097; TCGA SARC -0.134; TCGA THCA -0.061
hsa-miR-29a-3p
PCGF3
13 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.312; TCGA BRCA -0.074; TCGA CESC -0.069; TCGA KIRC -0.304; TCGA KIRP -0.26; TCGA LGG -0.077; TCGA LIHC -0.179; TCGA LUSC -0.16; TCGA OV -0.095; TCGA PRAD -0.181; TCGA SARC -0.131; TCGA STAD -0.097; TCGA UCEC -0.095
hsa-miR-29a-3p
ANKRD13B
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.155; TCGA BRCA -0.177; TCGA ESCA -0.256; TCGA HNSC -0.175; TCGA KIRP -0.42; TCGA LGG -0.169; TCGA LIHC -0.309; TCGA LUAD -0.309; TCGA LUSC -0.737; TCGA OV -0.129; TCGA PRAD -0.307; TCGA SARC -0.23; TCGA STAD -0.279
hsa-miR-29a-3p
DCUN1D4
9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.107; TCGA CESC -0.095; TCGA ESCA -0.17; TCGA KIRC -0.132; TCGA KIRP -0.104; TCGA LUAD -0.086; TCGA SARC -0.222; TCGA THCA -0.136; TCGA STAD -0.241
hsa-miR-29a-3p
ZNF396
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.311; TCGA BRCA -0.139; TCGA CESC -0.23; TCGA KIRC -0.154; TCGA KIRP -0.177; TCGA SARC -0.161; TCGA THCA -0.119; TCGA STAD -0.165; TCGA UCEC -0.115
hsa-miR-29a-3p
DBT
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.156; TCGA BRCA -0.069; TCGA CESC -0.127; TCGA COAD -0.149; TCGA ESCA -0.266; TCGA LUSC -0.109; TCGA PAAD -0.171; TCGA SARC -0.134; TCGA THCA -0.237; TCGA STAD -0.224; TCGA UCEC -0.056
hsa-miR-29a-3p
NAA40
10 cancers: BLCA; CESC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.16; TCGA CESC -0.165; TCGA KIRP -0.165; TCGA LGG -0.14; TCGA LIHC -0.319; TCGA LUAD -0.164; TCGA LUSC -0.255; TCGA PRAD -0.08; TCGA THCA -0.187; TCGA UCEC -0.156
hsa-miR-29a-3p
SHPRH
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; OV; SARC; STAD
MirTarget
TCGA BLCA -0.189; TCGA CESC -0.27; TCGA COAD -0.17; TCGA ESCA -0.122; TCGA KIRC -0.205; TCGA KIRP -0.329; TCGA LUAD -0.266; TCGA LUSC -0.302; TCGA OV -0.116; TCGA SARC -0.331; TCGA STAD -0.284
hsa-miR-29a-3p
PRKRA
10 cancers: BLCA; CESC; ESCA; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.069; TCGA CESC -0.072; TCGA ESCA -0.123; TCGA HNSC -0.055; TCGA LUSC -0.192; TCGA OV -0.112; TCGA PAAD -0.081; TCGA PRAD -0.124; TCGA STAD -0.152; TCGA UCEC -0.079
hsa-miR-29a-3p
BMF
10 cancers: BLCA; BRCA; CESC; COAD; LGG; LIHC; OV; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.203; TCGA BRCA -0.18; TCGA CESC -0.343; TCGA COAD -0.231; TCGA LGG -0.317; TCGA LIHC -0.625; TCGA OV -0.442; TCGA PRAD -0.259; TCGA SARC -0.225; TCGA UCEC -0.204
hsa-miR-29a-3p
CTDSPL2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD
MirTarget
TCGA BLCA -0.088; TCGA BRCA -0.111; TCGA CESC -0.132; TCGA COAD -0.168; TCGA ESCA -0.255; TCGA KIRC -0.196; TCGA KIRP -0.168; TCGA LGG -0.138; TCGA LIHC -0.135; TCGA LUAD -0.147; TCGA LUSC -0.264; TCGA SARC -0.232; TCGA STAD -0.257
hsa-miR-29a-3p
RLF
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.114; TCGA CESC -0.143; TCGA COAD -0.083; TCGA ESCA -0.141; TCGA KIRC -0.368; TCGA KIRP -0.2; TCGA LUAD -0.078; TCGA LUSC -0.153; TCGA SARC -0.133; TCGA STAD -0.217
hsa-miR-29a-3p
RFX7
10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUSC; SARC; STAD
MirTarget
TCGA BLCA -0.143; TCGA CESC -0.103; TCGA COAD -0.1; TCGA ESCA -0.21; TCGA KIRP -0.089; TCGA LGG -0.154; TCGA LIHC -0.111; TCGA LUSC -0.191; TCGA SARC -0.127; TCGA STAD -0.153
hsa-miR-29a-3p
CCNJ
14 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.182; TCGA BRCA -0.111; TCGA CESC -0.127; TCGA COAD -0.09; TCGA KIRP -0.202; TCGA LGG -0.222; TCGA LIHC -0.28; TCGA LUAD -0.126; TCGA LUSC -0.124; TCGA OV -0.24; TCGA PRAD -0.117; TCGA THCA -0.085; TCGA STAD -0.206; TCGA UCEC -0.244
hsa-miR-29a-3p
ARVCF
11 cancers: BLCA; CESC; HNSC; KIRC; LGG; LUAD; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.427; TCGA CESC -0.252; TCGA HNSC -0.106; TCGA KIRC -0.212; TCGA LGG -0.153; TCGA LUAD -0.148; TCGA OV -0.145; TCGA PRAD -0.229; TCGA SARC -0.316; TCGA STAD -0.393; TCGA UCEC -0.23
hsa-miR-29a-3p
HELZ
9 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUSC; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.104; TCGA BRCA -0.143; TCGA KIRC -0.194; TCGA KIRP -0.251; TCGA LIHC -0.105; TCGA LUSC -0.118; TCGA SARC -0.158; TCGA THCA -0.086; TCGA STAD -0.204
hsa-miR-29a-3p
LYSMD1
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.137; TCGA CESC -0.126; TCGA ESCA -0.152; TCGA HNSC -0.13; TCGA KIRC -0.121; TCGA KIRP -0.131; TCGA LGG -0.058; TCGA LIHC -0.301; TCGA LUAD -0.089; TCGA LUSC -0.415; TCGA OV -0.154; TCGA PRAD -0.175; TCGA SARC -0.22; TCGA THCA -0.068; TCGA STAD -0.162
hsa-miR-29a-3p
ADAMTS7
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.307; TCGA BRCA -0.31; TCGA CESC -0.198; TCGA COAD -0.641; TCGA ESCA -0.288; TCGA HNSC -0.536; TCGA KIRC -0.822; TCGA KIRP -0.344; TCGA LGG -0.402; TCGA LUAD -0.239; TCGA OV -0.383; TCGA PAAD -0.408; TCGA PRAD -0.144; TCGA THCA -0.332; TCGA UCEC -0.366
hsa-miR-29a-3p
ZNF704
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.376; TCGA BRCA -0.168; TCGA CESC -0.414; TCGA COAD -0.252; TCGA KIRC -0.401; TCGA LUAD -0.211; TCGA PAAD -0.352; TCGA SARC -0.671; TCGA THCA -0.17; TCGA STAD -0.583; TCGA UCEC -0.247
hsa-miR-29a-3p
BRWD3
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LIHC; LUAD; LUSC; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.11; TCGA BRCA -0.254; TCGA CESC -0.237; TCGA COAD -0.227; TCGA KIRC -0.25; TCGA LGG -0.131; TCGA LIHC -0.127; TCGA LUAD -0.225; TCGA LUSC -0.425; TCGA SARC -0.21; TCGA UCEC -0.203
hsa-miR-29a-3p
SFPQ
10 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.061; TCGA BRCA -0.125; TCGA ESCA -0.148; TCGA LGG -0.116; TCGA LIHC -0.107; TCGA LUAD -0.103; TCGA LUSC -0.244; TCGA OV -0.075; TCGA PRAD -0.08; TCGA UCEC -0.125
hsa-miR-29a-3p
RCC2
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.13; TCGA BRCA -0.132; TCGA CESC -0.131; TCGA ESCA -0.179; TCGA HNSC -0.135; TCGA KIRC -0.095; TCGA KIRP -0.117; TCGA LGG -0.188; TCGA LIHC -0.231; TCGA LUAD -0.201; TCGA LUSC -0.403; TCGA OV -0.12; TCGA PRAD -0.236; TCGA UCEC -0.217
hsa-miR-29a-3p
KIAA0895L
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.339; TCGA CESC -0.194; TCGA ESCA -0.162; TCGA HNSC -0.176; TCGA KIRC -0.506; TCGA KIRP -0.477; TCGA LGG -0.132; TCGA LUSC -0.239; TCGA SARC -0.196; TCGA STAD -0.164; TCGA UCEC -0.143
hsa-miR-29a-3p
SETDB1
13 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.168; TCGA BRCA -0.111; TCGA CESC -0.085; TCGA KIRC -0.23; TCGA KIRP -0.107; TCGA LGG -0.175; TCGA LIHC -0.32; TCGA LUSC -0.251; TCGA OV -0.156; TCGA PRAD -0.132; TCGA SARC -0.066; TCGA STAD -0.071; TCGA UCEC -0.132
hsa-miR-29a-3p
ZNF28
9 cancers: BLCA; BRCA; KIRP; LIHC; LUAD; OV; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.12; TCGA BRCA -0.266; TCGA KIRP -0.181; TCGA LIHC -0.393; TCGA LUAD -0.185; TCGA OV -0.092; TCGA SARC -0.094; TCGA STAD -0.205; TCGA UCEC -0.2
hsa-miR-29a-3p
PPM1E
10 cancers: BLCA; BRCA; ESCA; KIRP; LIHC; LUAD; OV; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.199; TCGA BRCA -0.194; TCGA ESCA -0.321; TCGA KIRP -0.466; TCGA LIHC -0.328; TCGA LUAD -0.322; TCGA OV -0.357; TCGA SARC -0.686; TCGA THCA -0.15; TCGA STAD -0.496
hsa-miR-29a-3p
CLK2
12 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.193; TCGA CESC -0.086; TCGA HNSC -0.112; TCGA KIRC -0.18; TCGA KIRP -0.235; TCGA LGG -0.112; TCGA LIHC -0.326; TCGA LUSC -0.262; TCGA OV -0.052; TCGA PRAD -0.109; TCGA SARC -0.109; TCGA UCEC -0.066
hsa-miR-29a-3p
FREM2
9 cancers: BLCA; CESC; KIRC; LGG; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.1; TCGA CESC -1.007; TCGA KIRC -0.644; TCGA LGG -0.347; TCGA OV -1.094; TCGA SARC -0.492; TCGA THCA -0.664; TCGA STAD -0.923; TCGA UCEC -0.565
hsa-miR-29a-3p
DOT1L
11 cancers: BLCA; BRCA; CESC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.071; TCGA CESC -0.107; TCGA LGG -0.331; TCGA LIHC -0.36; TCGA LUAD -0.188; TCGA LUSC -0.089; TCGA OV -0.168; TCGA PRAD -0.239; TCGA SARC -0.134; TCGA UCEC -0.171
hsa-miR-29a-3p
SESTD1
10 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; OV; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.194; TCGA BRCA -0.073; TCGA KIRC -0.253; TCGA KIRP -0.268; TCGA LIHC -0.121; TCGA OV -0.137; TCGA PAAD -0.254; TCGA SARC -0.283; TCGA STAD -0.417; TCGA UCEC -0.178
hsa-miR-29a-3p
PHC1
11 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; OV; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.216; TCGA CESC -0.213; TCGA ESCA -0.176; TCGA KIRC -0.297; TCGA KIRP -0.242; TCGA LGG -0.184; TCGA LUAD -0.11; TCGA OV -0.182; TCGA SARC -0.238; TCGA STAD -0.082; TCGA UCEC -0.084
hsa-miR-29a-3p
TTC30B
13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.104; TCGA BRCA -0.173; TCGA CESC -0.132; TCGA ESCA -0.271; TCGA KIRC -0.166; TCGA KIRP -0.157; TCGA LUSC -0.311; TCGA OV -0.098; TCGA PAAD -0.196; TCGA PRAD -0.206; TCGA SARC -0.122; TCGA THCA -0.237; TCGA STAD -0.182
hsa-miR-29a-3p
RMND5A
11 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.084; TCGA CESC -0.163; TCGA KIRC -0.146; TCGA LUAD -0.129; TCGA LUSC -0.299; TCGA OV -0.087; TCGA PRAD -0.129; TCGA SARC -0.171; TCGA STAD -0.282; TCGA UCEC -0.095
hsa-miR-29a-3p
SPAST
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.082; TCGA CESC -0.12; TCGA ESCA -0.246; TCGA HNSC -0.09; TCGA LGG -0.076; TCGA LIHC -0.142; TCGA LUAD -0.122; TCGA LUSC -0.429; TCGA OV -0.18; TCGA PRAD -0.102; TCGA STAD -0.128; TCGA UCEC -0.099
hsa-miR-29a-3p
DCP2
11 cancers: BLCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.061; TCGA CESC -0.106; TCGA KIRC -0.115; TCGA KIRP -0.147; TCGA LGG -0.079; TCGA LIHC -0.217; TCGA LUAD -0.071; TCGA OV -0.091; TCGA PRAD -0.083; TCGA STAD -0.082; TCGA UCEC -0.071
hsa-miR-29a-3p
ZNF512B
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUSC; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.163; TCGA BRCA -0.098; TCGA COAD -0.373; TCGA ESCA -0.525; TCGA LGG -0.087; TCGA LIHC -0.314; TCGA LUSC -0.213; TCGA PRAD -0.116; TCGA SARC -0.27; TCGA THCA -0.137; TCGA STAD -0.335
hsa-miR-29a-3p
RIT1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.127; TCGA BRCA -0.066; TCGA CESC -0.112; TCGA COAD -0.088; TCGA ESCA -0.254; TCGA HNSC -0.098; TCGA KIRC -0.582; TCGA KIRP -0.219; TCGA LGG -0.141; TCGA LIHC -0.18; TCGA LUSC -0.354; TCGA OV -0.084; TCGA PRAD -0.084; TCGA SARC -0.129; TCGA STAD -0.162; TCGA UCEC -0.093
hsa-miR-29a-3p
WASF1
13 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.096; TCGA COAD -0.305; TCGA ESCA -0.519; TCGA KIRC -0.3; TCGA LIHC -0.525; TCGA LUAD -0.289; TCGA LUSC -0.859; TCGA OV -0.414; TCGA PAAD -0.301; TCGA PRAD -0.174; TCGA SARC -0.246; TCGA STAD -0.691; TCGA UCEC -0.252
hsa-miR-29a-3p
SNX4
10 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; OV; PAAD; PRAD; THCA
MirTarget; miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.151; TCGA CESC -0.113; TCGA ESCA -0.121; TCGA LUAD -0.062; TCGA LUSC -0.139; TCGA OV -0.06; TCGA PAAD -0.086; TCGA PRAD -0.118; TCGA THCA -0.198
hsa-miR-29a-3p
TAF11
16 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.073; TCGA BRCA -0.15; TCGA CESC -0.102; TCGA HNSC -0.152; TCGA KIRC -0.276; TCGA KIRP -0.168; TCGA LGG -0.116; TCGA LIHC -0.285; TCGA LUAD -0.235; TCGA LUSC -0.189; TCGA OV -0.189; TCGA PRAD -0.119; TCGA SARC -0.094; TCGA THCA -0.145; TCGA STAD -0.097; TCGA UCEC -0.137
hsa-miR-29a-3p
ATAD2B
14 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.183; TCGA BRCA -0.1; TCGA CESC -0.134; TCGA ESCA -0.175; TCGA KIRC -0.163; TCGA KIRP -0.202; TCGA LGG -0.167; TCGA LIHC -0.113; TCGA LUAD -0.138; TCGA LUSC -0.263; TCGA OV -0.144; TCGA PRAD -0.145; TCGA STAD -0.132; TCGA UCEC -0.138
hsa-miR-29a-3p
DCAF7
13 cancers: BLCA; BRCA; CESC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.132; TCGA BRCA -0.224; TCGA CESC -0.125; TCGA KIRP -0.206; TCGA LGG -0.136; TCGA LIHC -0.167; TCGA LUAD -0.062; TCGA LUSC -0.138; TCGA OV -0.147; TCGA PRAD -0.104; TCGA SARC -0.066; TCGA THCA -0.069; TCGA UCEC -0.07
hsa-miR-29a-3p
WDR26
9 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUSC; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.133; TCGA ESCA -0.12; TCGA LGG -0.077; TCGA LIHC -0.094; TCGA LUSC -0.101; TCGA PRAD -0.072; TCGA SARC -0.079; TCGA STAD -0.211
hsa-miR-29a-3p
LDOC1L
9 cancers: BLCA; CESC; COAD; LUSC; OV; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.098; TCGA CESC -0.226; TCGA COAD -0.214; TCGA LUSC -0.184; TCGA OV -0.105; TCGA PAAD -0.247; TCGA PRAD -0.193; TCGA SARC -0.153; TCGA STAD -0.234
hsa-miR-29a-3p
SLC4A7
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.098; TCGA COAD -0.232; TCGA ESCA -0.188; TCGA LGG -0.125; TCGA LUAD -0.136; TCGA LUSC -0.177; TCGA SARC -0.154; TCGA STAD -0.124; TCGA UCEC -0.144
hsa-miR-29a-3p
ELAVL1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.1; TCGA BRCA -0.101; TCGA CESC -0.065; TCGA ESCA -0.088; TCGA HNSC -0.059; TCGA LGG -0.095; TCGA LIHC -0.122; TCGA LUSC -0.181; TCGA OV -0.091; TCGA PRAD -0.073; TCGA STAD -0.068; TCGA UCEC -0.098
hsa-miR-29a-3p
TCF3
10 cancers: BLCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
mirMAP
TCGA BLCA -0.087; TCGA CESC -0.093; TCGA HNSC -0.16; TCGA LGG -0.314; TCGA LIHC -0.299; TCGA LUAD -0.108; TCGA LUSC -0.335; TCGA OV -0.166; TCGA PRAD -0.205; TCGA UCEC -0.212
hsa-miR-29a-3p
CBFA2T2
14 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.199; TCGA BRCA -0.084; TCGA CESC -0.278; TCGA ESCA -0.133; TCGA KIRP -0.227; TCGA LIHC -0.437; TCGA LUAD -0.117; TCGA LUSC -0.344; TCGA OV -0.135; TCGA PRAD -0.202; TCGA SARC -0.166; TCGA THCA -0.088; TCGA STAD -0.311; TCGA UCEC -0.128
hsa-miR-29a-3p
GOSR1
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.08; TCGA BRCA -0.121; TCGA CESC -0.068; TCGA KIRC -0.081; TCGA KIRP -0.075; TCGA LGG -0.068; TCGA LUAD -0.076; TCGA LUSC -0.147; TCGA PRAD -0.102; TCGA SARC -0.086; TCGA THCA -0.064; TCGA STAD -0.069
hsa-miR-29a-3p
TFDP2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.091; TCGA BRCA -0.06; TCGA CESC -0.108; TCGA ESCA -0.215; TCGA HNSC -0.223; TCGA LGG -0.093; TCGA LIHC -0.077; TCGA LUAD -0.154; TCGA LUSC -0.575; TCGA OV -0.119; TCGA PRAD -0.17; TCGA STAD -0.415; TCGA UCEC -0.072
hsa-miR-29a-3p
ABCC5
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD
mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.364; TCGA ESCA -0.675; TCGA HNSC -0.228; TCGA KIRP -0.165; TCGA LIHC -0.224; TCGA LUAD -0.231; TCGA LUSC -0.861; TCGA PRAD -0.154
hsa-miR-29a-3p
ONECUT2
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUSC; PAAD; THCA
mirMAP; miRNATAP
TCGA BLCA -0.545; TCGA BRCA -0.422; TCGA CESC -0.543; TCGA HNSC -0.377; TCGA KIRP -0.549; TCGA LGG -0.337; TCGA LUSC -0.893; TCGA PAAD -0.55; TCGA THCA -0.761
hsa-miR-29a-3p
STK35
10 cancers: BLCA; BRCA; CESC; KIRP; LIHC; LUSC; OV; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA BLCA -0.087; TCGA BRCA -0.153; TCGA CESC -0.101; TCGA KIRP -0.101; TCGA LIHC -0.253; TCGA LUSC -0.251; TCGA OV -0.081; TCGA PRAD -0.175; TCGA SARC -0.089; TCGA STAD -0.11
hsa-miR-29a-3p
KIF1A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.698; TCGA BRCA -0.373; TCGA CESC -0.89; TCGA COAD -0.863; TCGA ESCA -1.176; TCGA LIHC -0.417; TCGA LUAD -1.362; TCGA LUSC -1.452; TCGA OV -0.687; TCGA PRAD -0.315; TCGA SARC -1.202; TCGA THCA -1.56; TCGA STAD -1.048; TCGA UCEC -0.63
hsa-miR-29a-3p
CBX8
11 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUSC; OV; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.152; TCGA BRCA -0.21; TCGA CESC -0.098; TCGA HNSC -0.215; TCGA LGG -0.166; TCGA LUSC -0.359; TCGA OV -0.192; TCGA PRAD -0.164; TCGA SARC -0.098; TCGA THCA -0.252; TCGA UCEC -0.095
hsa-miR-29a-3p
LSM14B
12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUSC; OV; PRAD; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.17; TCGA CESC -0.128; TCGA HNSC -0.054; TCGA KIRP -0.066; TCGA LIHC -0.242; TCGA LUSC -0.256; TCGA OV -0.142; TCGA PRAD -0.148; TCGA THCA -0.05; TCGA STAD -0.182; TCGA UCEC -0.067
hsa-miR-29a-3p
RAB6B
11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.152; TCGA CESC -0.251; TCGA ESCA -0.485; TCGA HNSC -0.227; TCGA KIRP -0.235; TCGA LIHC -0.131; TCGA LUAD -0.225; TCGA LUSC -0.613; TCGA PRAD -0.303; TCGA THCA -0.325; TCGA STAD -0.43
hsa-miR-29a-3p
ADCY1
9 cancers: BLCA; BRCA; COAD; OV; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.308; TCGA BRCA -0.358; TCGA COAD -0.537; TCGA OV -0.486; TCGA PAAD -0.436; TCGA PRAD -0.405; TCGA SARC -0.32; TCGA THCA -0.542; TCGA STAD -0.317
hsa-miR-29a-3p
IRGQ
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.12; TCGA BRCA -0.083; TCGA ESCA -0.175; TCGA HNSC -0.082; TCGA KIRP -0.067; TCGA LIHC -0.242; TCGA LUSC -0.14; TCGA OV -0.135; TCGA PRAD -0.082; TCGA SARC -0.075; TCGA STAD -0.304; TCGA UCEC -0.073
hsa-miR-29a-3p
CASKIN1
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.861; TCGA BRCA -0.352; TCGA CESC -0.544; TCGA ESCA -1.082; TCGA HNSC -0.431; TCGA KIRP -0.38; TCGA LIHC -0.801; TCGA LUAD -0.439; TCGA LUSC -1.22; TCGA OV -0.273; TCGA PRAD -0.36; TCGA SARC -0.427; TCGA THCA -0.213; TCGA UCEC -0.298
hsa-miR-29a-3p
RAB3B
14 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.204; TCGA BRCA -0.459; TCGA COAD -0.45; TCGA HNSC -0.419; TCGA KIRP -0.48; TCGA LIHC -0.523; TCGA LUAD -1.101; TCGA LUSC -1.281; TCGA OV -0.694; TCGA PAAD -0.515; TCGA PRAD -0.524; TCGA SARC -0.514; TCGA STAD -0.443; TCGA UCEC -0.274
hsa-miR-29a-3p
ZFP41
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; THCA
mirMAP
TCGA BLCA -0.099; TCGA BRCA -0.085; TCGA CESC -0.094; TCGA ESCA -0.168; TCGA HNSC -0.129; TCGA LIHC -0.232; TCGA LUSC -0.193; TCGA PRAD -0.11; TCGA SARC -0.201; TCGA THCA -0.101
hsa-miR-29a-3p
TET2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; SARC; UCEC
miRNATAP
TCGA BLCA -0.195; TCGA BRCA -0.062; TCGA CESC -0.204; TCGA COAD -0.198; TCGA ESCA -0.183; TCGA KIRC -0.268; TCGA KIRP -0.162; TCGA LGG -0.131; TCGA LUSC -0.162; TCGA SARC -0.203; TCGA UCEC -0.09
hsa-miR-29a-3p
LRP6
13 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.157; TCGA CESC -0.209; TCGA COAD -0.099; TCGA KIRC -0.171; TCGA KIRP -0.126; TCGA LGG -0.142; TCGA LUSC -0.19; TCGA OV -0.175; TCGA PAAD -0.242; TCGA SARC -0.301; TCGA THCA -0.14; TCGA STAD -0.285; TCGA UCEC -0.08
hsa-miR-29a-3p
EML6
9 cancers: BLCA; CESC; HNSC; LIHC; LUSC; OV; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.29; TCGA CESC -0.315; TCGA HNSC -0.183; TCGA LIHC -0.439; TCGA LUSC -0.502; TCGA OV -0.262; TCGA PRAD -0.835; TCGA SARC -0.367; TCGA THCA -0.325
hsa-miR-29a-3p
TDG
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.167; TCGA BRCA -0.232; TCGA CESC -0.111; TCGA COAD -0.097; TCGA ESCA -0.289; TCGA HNSC -0.17; TCGA KIRC -0.099; TCGA KIRP -0.179; TCGA LGG -0.15; TCGA LIHC -0.254; TCGA LUAD -0.309; TCGA LUSC -0.369; TCGA OV -0.253; TCGA PRAD -0.268; TCGA STAD -0.102; TCGA UCEC -0.206
hsa-miR-29a-3p
NCKAP5L
9 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.149; TCGA COAD -0.185; TCGA ESCA -0.317; TCGA LGG -0.127; TCGA LIHC -0.154; TCGA LUAD -0.073; TCGA PAAD -0.136; TCGA THCA -0.187; TCGA STAD -0.237
hsa-miR-29a-3p
SH3BP5L
14 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.117; TCGA CESC -0.086; TCGA ESCA -0.101; TCGA KIRC -0.229; TCGA LIHC -0.236; TCGA LUAD -0.083; TCGA LUSC -0.244; TCGA OV -0.112; TCGA PAAD -0.143; TCGA PRAD -0.165; TCGA SARC -0.123; TCGA THCA -0.08; TCGA UCEC -0.115
hsa-miR-29a-3p
RAB15
10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; OV; PAAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.574; TCGA BRCA -0.182; TCGA CESC -0.254; TCGA HNSC -0.169; TCGA LUAD -0.181; TCGA LUSC -0.215; TCGA OV -0.281; TCGA PAAD -0.243; TCGA SARC -0.528; TCGA UCEC -0.214
hsa-miR-29a-3p
MEX3B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.147; TCGA BRCA -0.147; TCGA CESC -0.407; TCGA COAD -0.685; TCGA ESCA -0.522; TCGA HNSC -0.204; TCGA KIRC -0.269; TCGA LGG -0.348; TCGA LUAD -0.289; TCGA LUSC -0.611; TCGA OV -0.361; TCGA PAAD -0.361; TCGA PRAD -0.421; TCGA SARC -0.414; TCGA STAD -0.339; TCGA UCEC -0.176
hsa-miR-29a-3p
BRD3
14 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LIHC; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.204; TCGA CESC -0.145; TCGA ESCA -0.171; TCGA KIRP -0.153; TCGA LGG -0.156; TCGA LIHC -0.234; TCGA LUSC -0.248; TCGA OV -0.144; TCGA PAAD -0.13; TCGA PRAD -0.178; TCGA SARC -0.229; TCGA STAD -0.246; TCGA UCEC -0.073
hsa-miR-29a-3p
TRAF4
13 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.206; TCGA HNSC -0.144; TCGA KIRP -0.13; TCGA LGG -0.282; TCGA LIHC -0.09; TCGA LUAD -0.189; TCGA LUSC -0.243; TCGA OV -0.154; TCGA PRAD -0.226; TCGA SARC -0.173; TCGA THCA -0.113; TCGA UCEC -0.227
hsa-miR-29a-3p
GRIP1
11 cancers: BLCA; BRCA; ESCA; KIRP; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.383; TCGA BRCA -0.233; TCGA ESCA -0.811; TCGA KIRP -0.151; TCGA LUSC -0.688; TCGA OV -0.196; TCGA PAAD -0.263; TCGA SARC -0.822; TCGA THCA -0.31; TCGA STAD -0.411; TCGA UCEC -0.285
hsa-miR-29a-3p
NDRG4
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; THCA; STAD
miRNATAP
TCGA BLCA -0.445; TCGA CESC -0.317; TCGA COAD -0.314; TCGA ESCA -0.932; TCGA HNSC -0.57; TCGA LUAD -0.328; TCGA LUSC -0.503; TCGA OV -0.192; TCGA THCA -0.22; TCGA STAD -0.417
hsa-miR-29a-3p
KIAA0355
11 cancers: BLCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.083; TCGA CESC -0.119; TCGA COAD -0.108; TCGA KIRC -0.331; TCGA KIRP -0.089; TCGA LIHC -0.104; TCGA LUAD -0.102; TCGA PAAD -0.109; TCGA SARC -0.088; TCGA THCA -0.08; TCGA STAD -0.263
hsa-miR-29a-3p
KDM6B
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; OV; SARC; UCEC
miRNATAP
TCGA BLCA -0.168; TCGA CESC -0.097; TCGA ESCA -0.221; TCGA HNSC -0.094; TCGA KIRC -0.392; TCGA LGG -0.162; TCGA OV -0.143; TCGA SARC -0.149; TCGA UCEC -0.077
hsa-miR-29a-3p
CSRNP2
12 cancers: BLCA; BRCA; CESC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.192; TCGA CESC -0.097; TCGA KIRP -0.14; TCGA LIHC -0.118; TCGA LUAD -0.074; TCGA LUSC -0.113; TCGA OV -0.141; TCGA PAAD -0.123; TCGA SARC -0.063; TCGA STAD -0.209; TCGA UCEC -0.068
hsa-miR-29a-3p
ADAM22
11 cancers: BLCA; BRCA; CESC; COAD; LIHC; LUAD; OV; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.216; TCGA BRCA -0.186; TCGA CESC -0.362; TCGA COAD -0.501; TCGA LIHC -0.455; TCGA LUAD -0.221; TCGA OV -0.396; TCGA PAAD -0.459; TCGA SARC -1.008; TCGA THCA -0.988; TCGA STAD -0.307
hsa-miR-29a-3p
SS18L1
12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.244; TCGA BRCA -0.17; TCGA CESC -0.192; TCGA HNSC -0.086; TCGA KIRP -0.165; TCGA LUAD -0.116; TCGA LUSC -0.223; TCGA OV -0.099; TCGA PRAD -0.235; TCGA SARC -0.145; TCGA STAD -0.299; TCGA UCEC -0.103
hsa-miR-29a-3p
TRIM9
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.279; TCGA CESC -0.338; TCGA COAD -0.563; TCGA ESCA -0.627; TCGA HNSC -0.404; TCGA KIRC -0.883; TCGA LGG -0.152; TCGA LUAD -0.556; TCGA LUSC -0.766; TCGA OV -0.524; TCGA SARC -0.509; TCGA THCA -0.212; TCGA STAD -0.361
hsa-miR-29a-3p
SIKE1
13 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.058; TCGA CESC -0.113; TCGA ESCA -0.204; TCGA KIRC -0.071; TCGA LGG -0.079; TCGA LUAD -0.11; TCGA LUSC -0.13; TCGA OV -0.14; TCGA PRAD -0.119; TCGA SARC -0.142; TCGA THCA -0.2; TCGA STAD -0.223; TCGA UCEC -0.082
hsa-miR-29a-3p
TRIM37
15 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.063; TCGA BRCA -0.316; TCGA CESC -0.153; TCGA ESCA -0.15; TCGA KIRP -0.15; TCGA LIHC -0.163; TCGA LUAD -0.086; TCGA LUSC -0.252; TCGA OV -0.154; TCGA PAAD -0.21; TCGA PRAD -0.207; TCGA SARC -0.15; TCGA THCA -0.114; TCGA STAD -0.221; TCGA UCEC -0.104
hsa-miR-29a-3p
UBTF
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; SARC; UCEC
miRNATAP
TCGA BLCA -0.096; TCGA BRCA -0.097; TCGA CESC -0.064; TCGA ESCA -0.158; TCGA HNSC -0.059; TCGA LGG -0.065; TCGA LIHC -0.058; TCGA LUAD -0.053; TCGA LUSC -0.161; TCGA SARC -0.065; TCGA UCEC -0.068
hsa-miR-29a-3p
DCAF5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.07; TCGA CESC -0.081; TCGA COAD -0.104; TCGA ESCA -0.161; TCGA KIRC -0.068; TCGA KIRP -0.13; TCGA LGG -0.054; TCGA LUAD -0.055; TCGA OV -0.096; TCGA PRAD -0.125; TCGA STAD -0.138; TCGA UCEC -0.055
hsa-miR-29a-3p
BTBD7
14 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.15; TCGA BRCA -0.079; TCGA CESC -0.122; TCGA COAD -0.115; TCGA KIRC -0.151; TCGA KIRP -0.234; TCGA LGG -0.077; TCGA LIHC -0.089; TCGA LUSC -0.11; TCGA PAAD -0.121; TCGA SARC -0.176; TCGA THCA -0.086; TCGA STAD -0.162; TCGA UCEC -0.052
hsa-miR-29a-3p
SLC16A14
9 cancers: BLCA; BRCA; ESCA; KIRC; LUSC; OV; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.252; TCGA BRCA -0.221; TCGA ESCA -0.412; TCGA KIRC -0.298; TCGA LUSC -0.356; TCGA OV -0.366; TCGA PRAD -0.17; TCGA SARC -0.268; TCGA STAD -0.231
hsa-miR-29a-3p
CBX2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.253; TCGA BRCA -0.31; TCGA CESC -0.239; TCGA ESCA -0.692; TCGA HNSC -0.379; TCGA LGG -0.51; TCGA LIHC -0.315; TCGA LUAD -0.395; TCGA LUSC -0.972; TCGA OV -0.576; TCGA PRAD -0.366; TCGA SARC -0.441; TCGA UCEC -0.467
hsa-miR-29a-3p
APPBP2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.127; TCGA BRCA -0.245; TCGA CESC -0.166; TCGA COAD -0.085; TCGA ESCA -0.157; TCGA LUAD -0.059; TCGA LUSC -0.074; TCGA OV -0.087; TCGA PAAD -0.172; TCGA SARC -0.09; TCGA THCA -0.065; TCGA STAD -0.198
hsa-miR-29a-3p
GSTA4
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.176; TCGA CESC -0.253; TCGA ESCA -0.594; TCGA HNSC -0.276; TCGA KIRC -0.381; TCGA KIRP -0.19; TCGA LGG -0.113; TCGA LIHC -0.447; TCGA LUSC -0.357; TCGA OV -0.232; TCGA SARC -0.224; TCGA STAD -0.232; TCGA UCEC -0.201
hsa-miR-29a-3p
FAM136A
11 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.091; TCGA BRCA -0.07; TCGA HNSC -0.119; TCGA LGG -0.088; TCGA LIHC -0.274; TCGA LUAD -0.136; TCGA LUSC -0.281; TCGA OV -0.081; TCGA PRAD -0.193; TCGA THCA -0.059; TCGA UCEC -0.142
hsa-miR-29a-3p
FRAS1
10 cancers: BLCA; CESC; COAD; KIRP; LIHC; LUAD; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.281; TCGA CESC -0.503; TCGA COAD -0.607; TCGA KIRP -0.371; TCGA LIHC -0.542; TCGA LUAD -0.433; TCGA OV -0.391; TCGA PRAD -0.214; TCGA STAD -0.478; TCGA UCEC -0.592
hsa-miR-29a-3p
TNRC18
10 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.072; TCGA BRCA -0.157; TCGA HNSC -0.095; TCGA LGG -0.161; TCGA LIHC -0.193; TCGA LUSC -0.16; TCGA PRAD -0.084; TCGA SARC -0.227; TCGA STAD -0.208; TCGA UCEC -0.074
hsa-miR-29a-3p
KIAA1549
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.275; TCGA BRCA -0.148; TCGA CESC -0.605; TCGA HNSC -0.184; TCGA KIRC -0.246; TCGA LGG -0.187; TCGA LUAD -0.199; TCGA LUSC -0.571; TCGA OV -0.36; TCGA PAAD -0.285; TCGA PRAD -0.226; TCGA SARC -0.24; TCGA THCA -0.179; TCGA STAD -0.211; TCGA UCEC -0.24
hsa-miR-29a-3p
KCTD3
14 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.082; TCGA BRCA -0.201; TCGA CESC -0.104; TCGA KIRC -0.311; TCGA KIRP -0.109; TCGA LGG -0.139; TCGA LIHC -0.129; TCGA LUAD -0.192; TCGA LUSC -0.257; TCGA PAAD -0.159; TCGA SARC -0.202; TCGA THCA -0.13; TCGA STAD -0.156; TCGA UCEC -0.086
hsa-miR-29a-3p
SMARCC1
11 cancers: BLCA; BRCA; CESC; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.163; TCGA BRCA -0.172; TCGA CESC -0.137; TCGA LGG -0.183; TCGA LIHC -0.217; TCGA LUSC -0.216; TCGA OV -0.088; TCGA PRAD -0.127; TCGA SARC -0.238; TCGA STAD -0.129; TCGA UCEC -0.2
hsa-miR-29a-3p
INA
10 cancers: BLCA; COAD; ESCA; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.964; TCGA COAD -1.066; TCGA ESCA -0.675; TCGA LUAD -0.847; TCGA LUSC -1.176; TCGA OV -0.709; TCGA PRAD -0.446; TCGA SARC -0.342; TCGA STAD -0.704; TCGA UCEC -0.687
hsa-miR-29a-3p
NKIRAS2
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.108; TCGA CESC -0.073; TCGA ESCA -0.197; TCGA HNSC -0.099; TCGA KIRC -0.187; TCGA KIRP -0.229; TCGA LGG -0.29; TCGA LIHC -0.209; TCGA LUAD -0.19; TCGA LUSC -0.294; TCGA OV -0.218; TCGA SARC -0.161; TCGA THCA -0.179; TCGA STAD -0.101; TCGA UCEC -0.12
hsa-miR-29a-3p
ZNF362
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.182; TCGA CESC -0.116; TCGA COAD -0.121; TCGA ESCA -0.251; TCGA KIRC -0.174; TCGA LGG -0.063; TCGA LIHC -0.083; TCGA LUSC -0.132; TCGA OV -0.106; TCGA PAAD -0.151; TCGA STAD -0.204; TCGA UCEC -0.06
hsa-miR-29a-3p
MARK3
9 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUSC; THCA; UCEC
miRNATAP
TCGA BLCA -0.073; TCGA BRCA -0.063; TCGA HNSC -0.208; TCGA KIRP -0.097; TCGA LGG -0.087; TCGA LIHC -0.063; TCGA LUSC -0.097; TCGA THCA -0.124; TCGA UCEC -0.067
hsa-miR-29a-3p
HNRNPUL1
10 cancers: BLCA; BRCA; KIRC; LGG; LIHC; LUSC; OV; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.081; TCGA BRCA -0.067; TCGA KIRC -0.061; TCGA LGG -0.06; TCGA LIHC -0.164; TCGA LUSC -0.169; TCGA OV -0.091; TCGA PRAD -0.097; TCGA SARC -0.064; TCGA UCEC -0.065
hsa-miR-29a-3p
GPAM
9 cancers: BLCA; CESC; KIRP; OV; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.25; TCGA CESC -0.11; TCGA KIRP -0.133; TCGA OV -0.198; TCGA PRAD -0.149; TCGA SARC -0.106; TCGA THCA -0.618; TCGA STAD -0.271; TCGA UCEC -0.139
hsa-miR-29a-3p
C5orf24
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; PAAD; SARC; STAD
miRNATAP
TCGA BLCA -0.104; TCGA BRCA -0.12; TCGA CESC -0.147; TCGA COAD -0.092; TCGA ESCA -0.196; TCGA KIRC -0.118; TCGA PAAD -0.192; TCGA SARC -0.279; TCGA STAD -0.267
hsa-miR-29a-3p
HMGCR
10 cancers: BLCA; BRCA; CESC; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.101; TCGA BRCA -0.227; TCGA CESC -0.191; TCGA LIHC -0.241; TCGA LUAD -0.116; TCGA LUSC -0.101; TCGA OV -0.152; TCGA PRAD -0.163; TCGA THCA -0.25; TCGA UCEC -0.263
hsa-miR-29a-3p
PHLDB3
9 cancers: BLCA; BRCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; STAD
miRNATAP
TCGA BLCA -0.278; TCGA BRCA -0.119; TCGA KIRC -0.3; TCGA LGG -0.066; TCGA LIHC -0.171; TCGA LUAD -0.231; TCGA LUSC -0.418; TCGA OV -0.098; TCGA STAD -0.15
hsa-miR-29a-3p
GSK3B
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.088; TCGA BRCA -0.204; TCGA ESCA -0.238; TCGA HNSC -0.086; TCGA KIRP -0.15; TCGA LGG -0.051; TCGA LUAD -0.116; TCGA LUSC -0.248; TCGA OV -0.069; TCGA PAAD -0.105; TCGA PRAD -0.15; TCGA SARC -0.108; TCGA STAD -0.144; TCGA UCEC -0.068
hsa-miR-29a-3p
SBF2
9 cancers: BLCA; CESC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA BLCA -0.129; TCGA CESC -0.111; TCGA KIRP -0.115; TCGA LGG -0.061; TCGA LUAD -0.258; TCGA LUSC -0.18; TCGA PAAD -0.225; TCGA SARC -0.142; TCGA STAD -0.282
hsa-miR-29a-3p
TTC14
9 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LUSC; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.158; TCGA ESCA -0.198; TCGA HNSC -0.098; TCGA KIRP -0.388; TCGA LGG -0.1; TCGA LUSC -0.306; TCGA PRAD -0.107; TCGA SARC -0.139; TCGA STAD -0.263
hsa-miR-29a-3p
CBX1
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.155; TCGA BRCA -0.202; TCGA CESC -0.135; TCGA ESCA -0.412; TCGA HNSC -0.097; TCGA KIRP -0.209; TCGA LGG -0.067; TCGA LIHC -0.317; TCGA LUAD -0.208; TCGA LUSC -0.443; TCGA OV -0.245; TCGA PAAD -0.19; TCGA PRAD -0.205; TCGA SARC -0.159; TCGA STAD -0.287; TCGA UCEC -0.135
hsa-miR-29a-3p
SENP1
12 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD
miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.169; TCGA CESC -0.069; TCGA ESCA -0.207; TCGA KIRP -0.092; TCGA LGG -0.144; TCGA LIHC -0.194; TCGA LUAD -0.188; TCGA LUSC -0.286; TCGA OV -0.113; TCGA SARC -0.099; TCGA STAD -0.153
hsa-miR-29a-3p
WDFY3
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.209; TCGA BRCA -0.103; TCGA CESC -0.136; TCGA COAD -0.158; TCGA ESCA -0.161; TCGA KIRC -0.226; TCGA PAAD -0.203; TCGA STAD -0.313; TCGA UCEC -0.094
hsa-miR-29a-3p
C16orf87
12 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.099; TCGA BRCA -0.119; TCGA ESCA -0.221; TCGA HNSC -0.179; TCGA LGG -0.202; TCGA LUAD -0.202; TCGA LUSC -0.214; TCGA OV -0.214; TCGA PRAD -0.234; TCGA SARC -0.098; TCGA STAD -0.136; TCGA UCEC -0.161
hsa-miR-29a-3p
UNK
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD
miRNATAP
TCGA BLCA -0.178; TCGA CESC -0.164; TCGA ESCA -0.09; TCGA HNSC -0.069; TCGA KIRC -0.143; TCGA KIRP -0.199; TCGA LGG -0.193; TCGA LIHC -0.204; TCGA LUAD -0.122; TCGA LUSC -0.191; TCGA OV -0.112; TCGA SARC -0.054; TCGA STAD -0.065
hsa-miR-29a-3p
MAZ
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.112; TCGA BRCA -0.207; TCGA ESCA -0.15; TCGA HNSC -0.167; TCGA KIRC -0.143; TCGA KIRP -0.144; TCGA LGG -0.15; TCGA LIHC -0.225; TCGA LUAD -0.115; TCGA LUSC -0.346; TCGA OV -0.115; TCGA SARC -0.09; TCGA THCA -0.128; TCGA UCEC -0.093
hsa-miR-29a-3p
C1QTNF6
11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.342; TCGA COAD -0.372; TCGA ESCA -0.362; TCGA HNSC -0.447; TCGA KIRC -0.463; TCGA KIRP -0.299; TCGA LGG -0.25; TCGA LIHC -0.425; TCGA LUAD -0.176; TCGA LUSC -0.245; TCGA PRAD -0.195
hsa-miR-29a-3p
CCT4
9 cancers: BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD
miRNAWalker2 validate
TCGA BRCA -0.072; TCGA ESCA -0.126; TCGA HNSC -0.159; TCGA LGG -0.103; TCGA LIHC -0.095; TCGA LUAD -0.067; TCGA LUSC -0.295; TCGA OV -0.075; TCGA PRAD -0.284
hsa-miR-29a-3p
CD276
15 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BRCA -0.262; TCGA COAD -0.175; TCGA ESCA -0.368; TCGA HNSC -0.337; TCGA KIRC -0.161; TCGA KIRP -0.154; TCGA LGG -0.222; TCGA LIHC -0.152; TCGA LUAD -0.122; TCGA LUSC -0.223; TCGA OV -0.175; TCGA PAAD -0.286; TCGA PRAD -0.475; TCGA STAD -0.126; TCGA UCEC -0.166
hsa-miR-29a-3p
COL4A1
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; OV; PAAD; SARC; THCA; STAD
miRNAWalker2 validate; miRTarBase; miRNATAP
TCGA BRCA -0.171; TCGA COAD -0.6; TCGA ESCA -0.338; TCGA HNSC -0.458; TCGA KIRC -0.715; TCGA LGG -0.38; TCGA LUAD -0.231; TCGA OV -0.161; TCGA PAAD -0.327; TCGA SARC -0.399; TCGA THCA -0.429; TCGA STAD -0.409
hsa-miR-29a-3p
DIABLO
9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.14; TCGA HNSC -0.11; TCGA LGG -0.121; TCGA LIHC -0.081; TCGA LUAD -0.114; TCGA LUSC -0.198; TCGA OV -0.112; TCGA PRAD -0.093; TCGA UCEC -0.052
hsa-miR-29a-3p
HNRNPM
9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.086; TCGA HNSC -0.058; TCGA LGG -0.128; TCGA LIHC -0.075; TCGA LUAD -0.083; TCGA LUSC -0.159; TCGA OV -0.066; TCGA PRAD -0.13; TCGA UCEC -0.095
hsa-miR-29a-3p
ITGA11
9 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate; miRTarBase
TCGA BRCA -0.366; TCGA COAD -1.131; TCGA ESCA -0.602; TCGA HNSC -0.567; TCGA LGG -0.132; TCGA LUAD -0.285; TCGA LUSC -0.286; TCGA PAAD -0.564; TCGA STAD -0.265
hsa-miR-29a-3p
POLD3
10 cancers: BRCA; CESC; COAD; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA BRCA -0.104; TCGA CESC -0.065; TCGA COAD -0.094; TCGA LGG -0.111; TCGA LIHC -0.266; TCGA LUAD -0.114; TCGA LUSC -0.164; TCGA PRAD -0.078; TCGA SARC -0.172; TCGA UCEC -0.063
hsa-miR-29a-3p
PXDN
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BRCA -0.286; TCGA COAD -0.83; TCGA ESCA -0.456; TCGA HNSC -0.407; TCGA KIRC -0.474; TCGA KIRP -0.332; TCGA LGG -0.388; TCGA LUAD -0.278; TCGA PAAD -0.447; TCGA PRAD -0.525; TCGA SARC -0.125; TCGA THCA -0.285; TCGA STAD -0.273
hsa-miR-29a-3p
RAN
9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.139; TCGA HNSC -0.134; TCGA LGG -0.055; TCGA LIHC -0.143; TCGA LUAD -0.177; TCGA LUSC -0.227; TCGA OV -0.111; TCGA PRAD -0.254; TCGA UCEC -0.125
hsa-miR-29a-3p
SPARC
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; THCA; STAD
miRNAWalker2 validate; miRTarBase; miRNATAP
TCGA BRCA -0.276; TCGA COAD -0.827; TCGA ESCA -0.555; TCGA HNSC -0.452; TCGA KIRC -0.654; TCGA LUAD -0.177; TCGA PAAD -0.456; TCGA THCA -0.13; TCGA STAD -0.278
hsa-miR-29a-3p
SYNCRIP
12 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.068; TCGA CESC -0.076; TCGA ESCA -0.112; TCGA KIRC -0.114; TCGA KIRP -0.083; TCGA LGG -0.128; TCGA LIHC -0.059; TCGA LUAD -0.072; TCGA LUSC -0.227; TCGA SARC -0.052; TCGA STAD -0.077; TCGA UCEC -0.084
hsa-miR-29a-3p
TET1
16 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BRCA -0.121; TCGA CESC -0.335; TCGA COAD -0.261; TCGA ESCA -0.529; TCGA HNSC -0.234; TCGA KIRC -0.312; TCGA KIRP -0.321; TCGA LGG -0.304; TCGA LIHC -0.973; TCGA LUAD -0.303; TCGA LUSC -0.676; TCGA OV -0.431; TCGA PAAD -0.197; TCGA SARC -0.435; TCGA STAD -0.553; TCGA UCEC -0.318
hsa-miR-29a-3p
ZFP91
10 cancers: BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PRAD; SARC; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.12; TCGA CESC -0.075; TCGA COAD -0.102; TCGA ESCA -0.126; TCGA KIRP -0.092; TCGA LUAD -0.064; TCGA LUSC -0.121; TCGA PRAD -0.107; TCGA SARC -0.069; TCGA STAD -0.095
hsa-miR-29a-3p
AMMECR1L
12 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD
MirTarget; miRNATAP
TCGA BRCA -0.081; TCGA ESCA -0.085; TCGA HNSC -0.066; TCGA KIRC -0.134; TCGA KIRP -0.105; TCGA LGG -0.138; TCGA LIHC -0.1; TCGA LUAD -0.051; TCGA LUSC -0.157; TCGA OV -0.06; TCGA PRAD -0.096; TCGA STAD -0.14
hsa-miR-29a-3p
RNF152
10 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; THCA; UCEC
MirTarget
TCGA BRCA -0.09; TCGA COAD -0.543; TCGA ESCA -0.58; TCGA HNSC -0.166; TCGA LUAD -0.219; TCGA LUSC -0.43; TCGA PAAD -0.301; TCGA SARC -0.425; TCGA THCA -0.323; TCGA UCEC -0.177
hsa-miR-29a-3p
NID1
13 cancers: BRCA; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.196; TCGA COAD -0.57; TCGA HNSC -0.461; TCGA KIRC -0.658; TCGA LGG -0.376; TCGA LIHC -0.321; TCGA LUAD -0.254; TCGA LUSC -0.197; TCGA OV -0.219; TCGA PAAD -0.308; TCGA SARC -0.48; TCGA THCA -0.131; TCGA STAD -0.357
hsa-miR-29a-3p
ZNF346
13 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.073; TCGA KIRC -0.096; TCGA KIRP -0.074; TCGA LGG -0.072; TCGA LIHC -0.144; TCGA LUAD -0.073; TCGA LUSC -0.104; TCGA OV -0.086; TCGA PRAD -0.09; TCGA SARC -0.121; TCGA THCA -0.152; TCGA STAD -0.129; TCGA UCEC -0.059
hsa-miR-29a-3p
CCNA2
13 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
MirTarget
TCGA BRCA -0.451; TCGA ESCA -0.211; TCGA HNSC -0.124; TCGA KIRC -0.296; TCGA KIRP -0.338; TCGA LGG -0.485; TCGA LIHC -0.879; TCGA LUAD -0.456; TCGA LUSC -0.776; TCGA OV -0.252; TCGA PRAD -0.501; TCGA SARC -0.121; TCGA UCEC -0.329
hsa-miR-29a-3p
TUBD1
12 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD
MirTarget
TCGA BRCA -0.172; TCGA CESC -0.088; TCGA KIRC -0.274; TCGA KIRP -0.301; TCGA LGG -0.096; TCGA LIHC -0.274; TCGA LUAD -0.203; TCGA LUSC -0.285; TCGA OV -0.188; TCGA PRAD -0.163; TCGA SARC -0.196; TCGA STAD -0.169
hsa-miR-29a-3p
CILP2
11 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.338; TCGA COAD -0.435; TCGA ESCA -0.443; TCGA HNSC -0.497; TCGA LUAD -0.259; TCGA LUSC -0.452; TCGA OV -0.188; TCGA PRAD -0.26; TCGA SARC -0.353; TCGA STAD -0.534; TCGA UCEC -0.205
hsa-miR-29a-3p
ISG20L2
11 cancers: BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
MirTarget
TCGA BRCA -0.177; TCGA ESCA -0.118; TCGA HNSC -0.063; TCGA LGG -0.092; TCGA LIHC -0.195; TCGA LUAD -0.096; TCGA LUSC -0.314; TCGA OV -0.096; TCGA PRAD -0.128; TCGA SARC -0.11; TCGA UCEC -0.113
hsa-miR-29a-3p
POLE3
9 cancers: BRCA; ESCA; KIRP; LGG; LIHC; LUSC; OV; PRAD; UCEC
MirTarget
TCGA BRCA -0.114; TCGA ESCA -0.161; TCGA KIRP -0.093; TCGA LGG -0.066; TCGA LIHC -0.139; TCGA LUSC -0.316; TCGA OV -0.107; TCGA PRAD -0.202; TCGA UCEC -0.058
hsa-miR-29a-3p
MLLT11
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD
MirTarget
TCGA BRCA -0.185; TCGA CESC -0.216; TCGA COAD -0.539; TCGA ESCA -0.788; TCGA HNSC -0.284; TCGA LIHC -0.375; TCGA LUAD -0.679; TCGA LUSC -0.9; TCGA OV -0.496; TCGA PAAD -0.317; TCGA SARC -0.371; TCGA STAD -0.692
hsa-miR-29a-3p
TMEM132A
11 cancers: BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
MirTarget
TCGA BRCA -0.344; TCGA COAD -0.228; TCGA ESCA -0.416; TCGA HNSC -0.294; TCGA LIHC -0.347; TCGA LUAD -0.343; TCGA LUSC -0.613; TCGA OV -0.274; TCGA PRAD -0.762; TCGA THCA -0.357; TCGA UCEC -0.33
hsa-miR-29a-3p
CCDC117
9 cancers: BRCA; CESC; ESCA; KIRP; LGG; LIHC; LUSC; OV; SARC
MirTarget; miRNATAP
TCGA BRCA -0.211; TCGA CESC -0.14; TCGA ESCA -0.176; TCGA KIRP -0.115; TCGA LGG -0.088; TCGA LIHC -0.173; TCGA LUSC -0.234; TCGA OV -0.117; TCGA SARC -0.097
hsa-miR-29a-3p
CALU
9 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD
MirTarget
TCGA BRCA -0.179; TCGA COAD -0.273; TCGA ESCA -0.171; TCGA HNSC -0.128; TCGA LGG -0.073; TCGA LUAD -0.096; TCGA LUSC -0.129; TCGA PAAD -0.266; TCGA STAD -0.207
hsa-miR-29a-3p
JARID2
12 cancers: BRCA; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.116; TCGA ESCA -0.373; TCGA HNSC -0.092; TCGA KIRC -0.215; TCGA LGG -0.086; TCGA LIHC -0.211; TCGA LUAD -0.136; TCGA LUSC -0.306; TCGA OV -0.254; TCGA PRAD -0.115; TCGA THCA -0.062; TCGA UCEC -0.189
hsa-miR-29a-3p
ZBTB34
12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.05; TCGA CESC -0.118; TCGA HNSC -0.11; TCGA KIRC -0.142; TCGA KIRP -0.108; TCGA LIHC -0.319; TCGA LUSC -0.115; TCGA OV -0.153; TCGA PRAD -0.178; TCGA SARC -0.089; TCGA STAD -0.234; TCGA UCEC -0.06
hsa-miR-29a-3p
CDCA4
11 cancers: BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
MirTarget
TCGA BRCA -0.185; TCGA ESCA -0.326; TCGA HNSC -0.22; TCGA KIRP -0.147; TCGA LGG -0.333; TCGA LIHC -0.527; TCGA LUAD -0.295; TCGA LUSC -0.645; TCGA OV -0.158; TCGA PRAD -0.162; TCGA UCEC -0.178
hsa-miR-29a-3p
TMTC3
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.264; TCGA COAD -0.197; TCGA ESCA -0.61; TCGA HNSC -0.16; TCGA KIRC -0.229; TCGA KIRP -0.185; TCGA LUAD -0.174; TCGA LUSC -0.478; TCGA OV -0.183; TCGA PAAD -0.266; TCGA STAD -0.27; TCGA UCEC -0.073
hsa-miR-29a-3p
NAV1
10 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.269; TCGA COAD -0.396; TCGA ESCA -0.564; TCGA HNSC -0.208; TCGA LGG -0.185; TCGA LUAD -0.115; TCGA LUSC -0.424; TCGA OV -0.194; TCGA STAD -0.26; TCGA UCEC -0.216
hsa-miR-29a-3p
LANCL1
10 cancers: BRCA; CESC; ESCA; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD
MirTarget
TCGA BRCA -0.053; TCGA CESC -0.138; TCGA ESCA -0.24; TCGA LIHC -0.114; TCGA LUAD -0.082; TCGA LUSC -0.214; TCGA OV -0.072; TCGA PRAD -0.102; TCGA SARC -0.234; TCGA STAD -0.224
hsa-miR-29a-3p
NANP
11 cancers: BRCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.106; TCGA CESC -0.154; TCGA HNSC -0.062; TCGA LGG -0.115; TCGA LIHC -0.173; TCGA LUAD -0.12; TCGA LUSC -0.223; TCGA OV -0.07; TCGA THCA -0.126; TCGA STAD -0.163; TCGA UCEC -0.088
hsa-miR-29a-3p
DDX46
10 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; UCEC
MirTarget
TCGA BRCA -0.159; TCGA CESC -0.103; TCGA KIRC -0.092; TCGA KIRP -0.082; TCGA LGG -0.08; TCGA LIHC -0.121; TCGA LUSC -0.108; TCGA PRAD -0.098; TCGA SARC -0.129; TCGA UCEC -0.052
hsa-miR-29a-3p
PGM3
12 cancers: BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC
MirTarget
TCGA BRCA -0.206; TCGA CESC -0.108; TCGA HNSC -0.098; TCGA KIRC -0.198; TCGA LGG -0.128; TCGA LIHC -0.153; TCGA LUAD -0.225; TCGA LUSC -0.181; TCGA OV -0.115; TCGA PAAD -0.181; TCGA PRAD -0.208; TCGA UCEC -0.133
hsa-miR-29a-3p
TBC1D7
10 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
MirTarget
TCGA BRCA -0.195; TCGA HNSC -0.185; TCGA LGG -0.185; TCGA LIHC -0.207; TCGA LUAD -0.249; TCGA LUSC -0.342; TCGA OV -0.176; TCGA PRAD -0.231; TCGA THCA -0.082; TCGA UCEC -0.247
hsa-miR-29a-3p
SOX12
13 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.337; TCGA CESC -0.153; TCGA ESCA -0.299; TCGA HNSC -0.304; TCGA LGG -0.266; TCGA LIHC -0.533; TCGA LUSC -0.503; TCGA OV -0.111; TCGA PRAD -0.334; TCGA SARC -0.19; TCGA THCA -0.153; TCGA STAD -0.185; TCGA UCEC -0.134
hsa-miR-29a-3p
PDHX
10 cancers: BRCA; CESC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.14; TCGA CESC -0.122; TCGA LUAD -0.117; TCGA LUSC -0.241; TCGA OV -0.082; TCGA PRAD -0.127; TCGA SARC -0.069; TCGA THCA -0.061; TCGA STAD -0.072; TCGA UCEC -0.118
hsa-miR-29a-3p
COL5A2
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD
MirTarget; miRNATAP
TCGA BRCA -0.505; TCGA COAD -0.93; TCGA ESCA -0.609; TCGA HNSC -0.65; TCGA KIRC -0.588; TCGA LIHC -0.344; TCGA LUAD -0.29; TCGA LUSC -0.262; TCGA PAAD -0.61; TCGA STAD -0.377
hsa-miR-29a-3p
UBFD1
9 cancers: BRCA; CESC; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.229; TCGA CESC -0.1; TCGA ESCA -0.105; TCGA LUSC -0.205; TCGA PAAD -0.095; TCGA PRAD -0.158; TCGA SARC -0.082; TCGA STAD -0.156; TCGA UCEC -0.059
hsa-miR-29a-3p
ITGB1
11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; SARC; STAD
MirTarget; miRNATAP
TCGA BRCA -0.093; TCGA COAD -0.201; TCGA ESCA -0.137; TCGA HNSC -0.08; TCGA KIRC -0.267; TCGA KIRP -0.091; TCGA LGG -0.062; TCGA LUAD -0.11; TCGA PAAD -0.311; TCGA SARC -0.155; TCGA STAD -0.418
hsa-miR-29a-3p
SLC25A15
9 cancers: BRCA; CESC; LGG; LUAD; LUSC; OV; PRAD; THCA; UCEC
MirTarget
TCGA BRCA -0.18; TCGA CESC -0.121; TCGA LGG -0.182; TCGA LUAD -0.137; TCGA LUSC -0.32; TCGA OV -0.247; TCGA PRAD -0.325; TCGA THCA -0.895; TCGA UCEC -0.148
hsa-miR-29a-3p
ZNF518B
11 cancers: BRCA; ESCA; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.095; TCGA ESCA -0.655; TCGA LUAD -0.169; TCGA LUSC -0.299; TCGA OV -0.247; TCGA PAAD -0.255; TCGA PRAD -0.207; TCGA SARC -0.552; TCGA THCA -0.163; TCGA STAD -0.339; TCGA UCEC -0.139
hsa-miR-29a-3p
USP37
12 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.193; TCGA CESC -0.21; TCGA KIRC -0.275; TCGA KIRP -0.087; TCGA LGG -0.07; TCGA LIHC -0.293; TCGA LUAD -0.184; TCGA LUSC -0.237; TCGA OV -0.071; TCGA SARC -0.232; TCGA STAD -0.113; TCGA UCEC -0.056
hsa-miR-29a-3p
MAPRE1
12 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.16; TCGA CESC -0.056; TCGA HNSC -0.068; TCGA KIRP -0.079; TCGA LGG -0.19; TCGA LIHC -0.25; TCGA LUAD -0.089; TCGA LUSC -0.153; TCGA OV -0.113; TCGA SARC -0.07; TCGA THCA -0.122; TCGA STAD -0.152
hsa-miR-29a-3p
NUP160
14 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.117; TCGA CESC -0.12; TCGA COAD -0.137; TCGA ESCA -0.111; TCGA KIRC -0.183; TCGA KIRP -0.15; TCGA LGG -0.192; TCGA LIHC -0.162; TCGA LUAD -0.203; TCGA LUSC -0.204; TCGA OV -0.107; TCGA SARC -0.129; TCGA STAD -0.162; TCGA UCEC -0.082
hsa-miR-29a-3p
DIP2C
9 cancers: BRCA; COAD; KIRC; KIRP; OV; PAAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.08; TCGA COAD -0.47; TCGA KIRC -0.39; TCGA KIRP -0.133; TCGA OV -0.119; TCGA PAAD -0.392; TCGA SARC -0.217; TCGA THCA -0.325; TCGA STAD -0.466
hsa-miR-29a-3p
SPIN4
9 cancers: BRCA; KIRC; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.089; TCGA KIRC -0.291; TCGA LGG -0.089; TCGA LIHC -0.145; TCGA LUAD -0.265; TCGA PRAD -0.349; TCGA SARC -0.463; TCGA STAD -0.232; TCGA UCEC -0.122
hsa-miR-29a-3p
KIAA2022
9 cancers: BRCA; CESC; COAD; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.253; TCGA CESC -0.857; TCGA COAD -1.076; TCGA OV -0.493; TCGA PAAD -0.385; TCGA SARC -1.181; TCGA THCA -0.707; TCGA STAD -0.755; TCGA UCEC -0.469
hsa-miR-29a-3p
TMEM169
9 cancers: BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; PAAD; STAD
MirTarget; miRNATAP
TCGA BRCA -0.102; TCGA COAD -0.424; TCGA ESCA -0.341; TCGA KIRP -0.449; TCGA LGG -0.105; TCGA LIHC -0.164; TCGA LUAD -0.293; TCGA PAAD -0.326; TCGA STAD -0.362
hsa-miR-29a-3p
NSD1
12 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.144; TCGA CESC -0.114; TCGA COAD -0.084; TCGA ESCA -0.109; TCGA LIHC -0.156; TCGA LUSC -0.117; TCGA PAAD -0.124; TCGA PRAD -0.129; TCGA SARC -0.116; TCGA THCA -0.061; TCGA STAD -0.109; TCGA UCEC -0.058
hsa-miR-29a-3p
KCTD15
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.203; TCGA COAD -0.571; TCGA ESCA -0.726; TCGA HNSC -0.156; TCGA KIRC -0.476; TCGA LGG -0.132; TCGA LUSC -0.456; TCGA PAAD -0.229; TCGA PRAD -0.302; TCGA SARC -0.569; TCGA THCA -0.451; TCGA STAD -0.404
hsa-miR-29a-3p
CAND1
11 cancers: BRCA; CESC; ESCA; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.243; TCGA CESC -0.074; TCGA ESCA -0.182; TCGA LUAD -0.139; TCGA LUSC -0.246; TCGA OV -0.078; TCGA PAAD -0.102; TCGA PRAD -0.134; TCGA SARC -0.085; TCGA STAD -0.105; TCGA UCEC -0.057
hsa-miR-29a-3p
KCTD20
10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; PAAD; SARC; STAD
MirTarget
TCGA BRCA -0.127; TCGA CESC -0.1; TCGA COAD -0.133; TCGA ESCA -0.127; TCGA KIRC -0.27; TCGA LGG -0.107; TCGA LUAD -0.141; TCGA PAAD -0.253; TCGA SARC -0.185; TCGA STAD -0.274
hsa-miR-29a-3p
ARMC8
10 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.065; TCGA CESC -0.062; TCGA ESCA -0.196; TCGA HNSC -0.087; TCGA KIRP -0.103; TCGA LUAD -0.087; TCGA LUSC -0.188; TCGA SARC -0.063; TCGA THCA -0.084; TCGA STAD -0.15
hsa-miR-29a-3p
ATRN
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.131; TCGA CESC -0.135; TCGA COAD -0.261; TCGA ESCA -0.277; TCGA HNSC -0.083; TCGA LIHC -0.199; TCGA LUSC -0.33; TCGA OV -0.088; TCGA PAAD -0.21; TCGA PRAD -0.091; TCGA THCA -0.174; TCGA UCEC -0.091
hsa-miR-29a-3p
GRPEL2
9 cancers: BRCA; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.105; TCGA KIRC -0.108; TCGA LIHC -0.124; TCGA LUAD -0.077; TCGA LUSC -0.166; TCGA PRAD -0.158; TCGA SARC -0.108; TCGA THCA -0.104; TCGA STAD -0.132
hsa-miR-29a-3p
FBXW9
9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
MirTarget
TCGA BRCA -0.075; TCGA KIRP -0.108; TCGA LGG -0.109; TCGA LIHC -0.197; TCGA LUAD -0.116; TCGA LUSC -0.186; TCGA OV -0.155; TCGA PRAD -0.329; TCGA UCEC -0.18
hsa-miR-29a-3p
USP13
10 cancers: BRCA; CESC; COAD; ESCA; LGG; LUSC; OV; PRAD; SARC; STAD
mirMAP
TCGA BRCA -0.066; TCGA CESC -0.234; TCGA COAD -0.313; TCGA ESCA -0.355; TCGA LGG -0.068; TCGA LUSC -0.193; TCGA OV -0.152; TCGA PRAD -0.166; TCGA SARC -0.177; TCGA STAD -0.437
hsa-miR-29a-3p
MPP2
11 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.143; TCGA CESC -0.319; TCGA COAD -0.439; TCGA ESCA -0.508; TCGA LIHC -0.487; TCGA LUAD -0.434; TCGA LUSC -0.463; TCGA OV -0.558; TCGA SARC -0.713; TCGA THCA -0.189; TCGA STAD -0.706
hsa-miR-29a-3p
ARID3A
9 cancers: BRCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.241; TCGA HNSC -0.175; TCGA LIHC -1.062; TCGA LUAD -0.216; TCGA LUSC -0.194; TCGA OV -0.311; TCGA PRAD -0.182; TCGA STAD -0.183; TCGA UCEC -0.135
hsa-miR-29a-3p
FOXK2
12 cancers: BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.123; TCGA ESCA -0.205; TCGA HNSC -0.094; TCGA KIRP -0.119; TCGA LGG -0.057; TCGA LIHC -0.199; TCGA LUAD -0.072; TCGA LUSC -0.265; TCGA OV -0.104; TCGA PRAD -0.1; TCGA STAD -0.101; TCGA UCEC -0.074
hsa-miR-29a-3p
TBC1D16
9 cancers: BRCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BRCA -0.094; TCGA HNSC -0.133; TCGA LIHC -0.133; TCGA LUAD -0.121; TCGA LUSC -0.152; TCGA PAAD -0.345; TCGA PRAD -0.237; TCGA THCA -0.146; TCGA STAD -0.26
hsa-miR-29a-3p
MAP6D1
11 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.162; TCGA CESC -0.149; TCGA ESCA -0.409; TCGA HNSC -0.217; TCGA KIRP -0.139; TCGA LUAD -0.368; TCGA LUSC -0.593; TCGA OV -0.267; TCGA PRAD -0.421; TCGA STAD -0.161; TCGA UCEC -0.108
hsa-miR-29a-3p
LOX
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD
miRNATAP
TCGA BRCA -0.194; TCGA COAD -0.861; TCGA ESCA -0.403; TCGA HNSC -0.273; TCGA KIRC -0.946; TCGA LUAD -0.215; TCGA PAAD -0.443; TCGA PRAD -0.437; TCGA STAD -0.198
hsa-miR-29a-3p
COL1A1
9 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BRCA -0.506; TCGA COAD -0.92; TCGA ESCA -0.699; TCGA HNSC -0.756; TCGA LGG -0.372; TCGA LUAD -0.207; TCGA LUSC -0.288; TCGA PAAD -0.504; TCGA STAD -0.277
hsa-miR-29a-3p
MAP4K4
10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; UCEC
miRNATAP
TCGA BRCA -0.06; TCGA COAD -0.188; TCGA HNSC -0.188; TCGA KIRC -0.359; TCGA KIRP -0.149; TCGA LIHC -0.262; TCGA LUAD -0.11; TCGA OV -0.158; TCGA PRAD -0.139; TCGA UCEC -0.095
hsa-miR-29a-3p
COL4A5
11 cancers: BRCA; ESCA; HNSC; LIHC; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.2; TCGA ESCA -1.003; TCGA HNSC -0.237; TCGA LIHC -0.457; TCGA LUSC -0.473; TCGA OV -0.305; TCGA PAAD -0.435; TCGA SARC -1.328; TCGA THCA -0.446; TCGA STAD -0.607; TCGA UCEC -0.372
hsa-miR-29a-3p
ZFX
9 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA BRCA -0.133; TCGA CESC -0.085; TCGA COAD -0.105; TCGA ESCA -0.165; TCGA LIHC -0.12; TCGA LUSC -0.176; TCGA PAAD -0.166; TCGA SARC -0.205; TCGA STAD -0.251
hsa-miR-29a-3p
LSM11
12 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA BRCA -0.112; TCGA CESC -0.102; TCGA COAD -0.107; TCGA ESCA -0.118; TCGA KIRC -0.197; TCGA KIRP -0.245; TCGA LIHC -0.388; TCGA LUAD -0.13; TCGA LUSC -0.109; TCGA PAAD -0.164; TCGA SARC -0.392; TCGA STAD -0.267
hsa-miR-29a-3p
XPO5
10 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.185; TCGA HNSC -0.137; TCGA KIRP -0.156; TCGA LGG -0.183; TCGA LIHC -0.28; TCGA LUAD -0.22; TCGA LUSC -0.432; TCGA PRAD -0.199; TCGA STAD -0.151; TCGA UCEC -0.104
hsa-miR-29a-3p
CBX5
11 cancers: BRCA; CESC; ESCA; KIRP; LGG; LUSC; OV; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.18; TCGA CESC -0.131; TCGA ESCA -0.273; TCGA KIRP -0.121; TCGA LGG -0.121; TCGA LUSC -0.148; TCGA OV -0.196; TCGA SARC -0.218; TCGA THCA -0.061; TCGA STAD -0.258; TCGA UCEC -0.1
hsa-miR-29a-3p
MYBL2
11 cancers: BRCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
miRNATAP
TCGA BRCA -0.642; TCGA CESC -0.161; TCGA HNSC -0.335; TCGA LGG -0.951; TCGA LIHC -1.357; TCGA LUAD -0.638; TCGA LUSC -1.046; TCGA OV -0.432; TCGA PRAD -0.721; TCGA SARC -0.192; TCGA UCEC -0.591
hsa-miR-29a-3p
KIF26B
9 cancers: BRCA; COAD; ESCA; HNSC; LUSC; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.415; TCGA COAD -0.721; TCGA ESCA -0.308; TCGA HNSC -0.552; TCGA LUSC -0.448; TCGA SARC -0.406; TCGA THCA -0.233; TCGA STAD -0.264; TCGA UCEC -0.297
hsa-miR-29a-3p
PSME4
11 cancers: BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.085; TCGA ESCA -0.133; TCGA HNSC -0.071; TCGA LGG -0.088; TCGA LIHC -0.062; TCGA LUAD -0.141; TCGA LUSC -0.296; TCGA PRAD -0.155; TCGA THCA -0.066; TCGA STAD -0.11; TCGA UCEC -0.129
hsa-miR-29a-3p
E2F7
13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; UCEC
miRNATAP
TCGA BRCA -0.575; TCGA CESC -0.282; TCGA ESCA -0.419; TCGA HNSC -0.202; TCGA KIRC -0.39; TCGA KIRP -0.263; TCGA LGG -0.458; TCGA LIHC -0.845; TCGA LUAD -0.508; TCGA LUSC -1.138; TCGA OV -0.351; TCGA SARC -0.396; TCGA UCEC -0.513
hsa-miR-29a-3p
ERC1
9 cancers: BRCA; CESC; COAD; ESCA; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.088; TCGA CESC -0.088; TCGA COAD -0.2; TCGA ESCA -0.211; TCGA PAAD -0.177; TCGA SARC -0.18; TCGA THCA -0.096; TCGA STAD -0.19; TCGA UCEC -0.071
hsa-miR-29a-3p
PRKG1
9 cancers: BRCA; COAD; ESCA; KIRC; OV; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BRCA -0.402; TCGA COAD -0.836; TCGA ESCA -0.534; TCGA KIRC -0.352; TCGA OV -0.188; TCGA PAAD -0.628; TCGA SARC -0.55; TCGA THCA -0.688; TCGA STAD -0.581
hsa-miR-29a-3p
AMMECR1
9 cancers: BRCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PRAD; UCEC
miRNATAP
TCGA BRCA -0.139; TCGA HNSC -0.111; TCGA KIRP -0.173; TCGA LGG -0.135; TCGA LUAD -0.085; TCGA LUSC -0.333; TCGA OV -0.147; TCGA PRAD -0.221; TCGA UCEC -0.174
hsa-miR-29a-3p
MFAP2
11 cancers: BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC
miRNATAP
TCGA BRCA -0.332; TCGA COAD -0.707; TCGA ESCA -0.77; TCGA HNSC -0.67; TCGA LGG -0.544; TCGA LIHC -0.517; TCGA LUAD -0.37; TCGA LUSC -0.435; TCGA OV -0.509; TCGA STAD -0.401; TCGA UCEC -0.346
hsa-miR-29a-3p
USP42
9 cancers: BRCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.073; TCGA LGG -0.112; TCGA LIHC -0.076; TCGA LUAD -0.102; TCGA LUSC -0.233; TCGA OV -0.099; TCGA PRAD -0.08; TCGA STAD -0.079; TCGA UCEC -0.072
hsa-miR-29a-3p
KDELC1
18 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.143; TCGA CESC -0.166; TCGA COAD -0.427; TCGA ESCA -0.467; TCGA HNSC -0.326; TCGA KIRC -0.46; TCGA KIRP -0.52; TCGA LGG -0.3; TCGA LIHC -0.436; TCGA LUAD -0.374; TCGA LUSC -0.315; TCGA OV -0.329; TCGA PAAD -0.35; TCGA PRAD -0.159; TCGA SARC -0.231; TCGA THCA -0.096; TCGA STAD -0.358; TCGA UCEC -0.146
hsa-miR-29a-3p
N4BP2
10 cancers: BRCA; CESC; COAD; KIRP; LGG; LUAD; LUSC; OV; SARC; STAD
miRNATAP
TCGA BRCA -0.282; TCGA CESC -0.251; TCGA COAD -0.395; TCGA KIRP -0.249; TCGA LGG -0.155; TCGA LUAD -0.246; TCGA LUSC -0.186; TCGA OV -0.224; TCGA SARC -0.351; TCGA STAD -0.177
hsa-miR-29a-3p
PRKAB2
11 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; STAD
miRNATAP
TCGA BRCA -0.063; TCGA COAD -0.175; TCGA ESCA -0.199; TCGA HNSC -0.14; TCGA KIRP -0.137; TCGA LIHC -0.277; TCGA LUAD -0.198; TCGA LUSC -0.307; TCGA OV -0.144; TCGA SARC -0.24; TCGA STAD -0.405
hsa-miR-29a-3p
SERPINH1
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC
miRNATAP
TCGA BRCA -0.179; TCGA COAD -0.341; TCGA ESCA -0.302; TCGA HNSC -0.416; TCGA KIRC -0.243; TCGA KIRP -0.131; TCGA LGG -0.253; TCGA LIHC -0.436; TCGA LUAD -0.109; TCGA LUSC -0.187; TCGA OV -0.184; TCGA STAD -0.153; TCGA UCEC -0.099
hsa-miR-29a-3p
DCAF12
9 cancers: BRCA; CESC; LGG; LIHC; LUSC; OV; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.127; TCGA CESC -0.103; TCGA LGG -0.153; TCGA LIHC -0.084; TCGA LUSC -0.201; TCGA OV -0.062; TCGA PRAD -0.083; TCGA THCA -0.107; TCGA UCEC -0.125
hsa-miR-29a-3p
DIP2B
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.167; TCGA CESC -0.115; TCGA ESCA -0.258; TCGA HNSC -0.138; TCGA KIRC -0.215; TCGA LUAD -0.176; TCGA LUSC -0.418; TCGA PRAD -0.232; TCGA THCA -0.103; TCGA STAD -0.121; TCGA UCEC -0.058
hsa-miR-29a-3p
DYNLT1
9 cancers: BRCA; KIRP; LGG; LIHC; LUSC; OV; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.182; TCGA KIRP -0.106; TCGA LGG -0.267; TCGA LIHC -0.086; TCGA LUSC -0.072; TCGA OV -0.112; TCGA PRAD -0.135; TCGA THCA -0.199; TCGA UCEC -0.134
hsa-miR-29a-3p
ZNF641
10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; SARC; THCA; STAD
miRNATAP
TCGA BRCA -0.127; TCGA CESC -0.125; TCGA COAD -0.237; TCGA ESCA -0.163; TCGA KIRC -0.202; TCGA LUAD -0.162; TCGA LUSC -0.089; TCGA SARC -0.341; TCGA THCA -0.149; TCGA STAD -0.175
hsa-miR-29a-3p
VPS25
11 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.168; TCGA HNSC -0.073; TCGA KIRP -0.153; TCGA LGG -0.15; TCGA LIHC -0.139; TCGA LUAD -0.168; TCGA LUSC -0.207; TCGA OV -0.193; TCGA PRAD -0.096; TCGA THCA -0.083; TCGA UCEC -0.087
hsa-miR-29a-3p
SPNS1
10 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
miRNATAP
TCGA BRCA -0.137; TCGA HNSC -0.167; TCGA KIRP -0.103; TCGA LGG -0.196; TCGA LIHC -0.166; TCGA LUAD -0.132; TCGA LUSC -0.069; TCGA OV -0.134; TCGA PRAD -0.144; TCGA UCEC -0.083
hsa-miR-29a-3p
DNAJB11
10 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.094; TCGA HNSC -0.204; TCGA LGG -0.121; TCGA LIHC -0.248; TCGA LUAD -0.156; TCGA LUSC -0.405; TCGA OV -0.113; TCGA PRAD -0.155; TCGA THCA -0.198; TCGA UCEC -0.092
hsa-miR-29a-3p
SPSB4
9 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUAD; OV; SARC; UCEC
miRNATAP
TCGA BRCA -0.237; TCGA CESC -0.547; TCGA ESCA -1.176; TCGA HNSC -0.56; TCGA LGG -0.425; TCGA LUAD -0.419; TCGA OV -1.052; TCGA SARC -0.522; TCGA UCEC -0.303
hsa-miR-29a-3p
NRBP1
9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD
miRNATAP
TCGA BRCA -0.12; TCGA KIRP -0.095; TCGA LGG -0.069; TCGA LIHC -0.151; TCGA LUAD -0.137; TCGA LUSC -0.151; TCGA OV -0.096; TCGA PAAD -0.098; TCGA PRAD -0.081
hsa-miR-29a-3p
PDGFRB
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; OV; PAAD; THCA; STAD
miRNATAP
TCGA BRCA -0.173; TCGA COAD -0.749; TCGA ESCA -0.294; TCGA HNSC -0.253; TCGA KIRC -0.452; TCGA LIHC -0.178; TCGA OV -0.139; TCGA PAAD -0.345; TCGA THCA -0.339; TCGA STAD -0.322
hsa-miR-29a-3p
FUS
9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC
RAID
TCGA BRCA -0.092; TCGA KIRP -0.08; TCGA LGG -0.111; TCGA LIHC -0.185; TCGA LUAD -0.055; TCGA LUSC -0.195; TCGA OV -0.065; TCGA PRAD -0.171; TCGA UCEC -0.099
hsa-miR-29a-3p
FAM168B
10 cancers: CESC; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.097; TCGA ESCA -0.167; TCGA HNSC -0.061; TCGA LIHC -0.189; TCGA LUSC -0.195; TCGA OV -0.107; TCGA PAAD -0.113; TCGA PRAD -0.121; TCGA SARC -0.201; TCGA STAD -0.309
hsa-miR-29a-3p
ZBTB5
14 cancers: CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.111; TCGA ESCA -0.132; TCGA KIRC -0.139; TCGA KIRP -0.185; TCGA LGG -0.189; TCGA LIHC -0.243; TCGA LUAD -0.089; TCGA LUSC -0.279; TCGA OV -0.092; TCGA PRAD -0.134; TCGA SARC -0.218; TCGA THCA -0.064; TCGA STAD -0.118; TCGA UCEC -0.109
hsa-miR-29a-3p
ABCB6
9 cancers: CESC; ESCA; HNSC; KIRC; LGG; LUSC; OV; PRAD; THCA
MirTarget
TCGA CESC -0.148; TCGA ESCA -0.37; TCGA HNSC -0.122; TCGA KIRC -0.532; TCGA LGG -0.083; TCGA LUSC -0.505; TCGA OV -0.127; TCGA PRAD -0.275; TCGA THCA -0.283
hsa-miR-29a-3p
REV3L
10 cancers: CESC; COAD; KIRC; KIRP; LGG; OV; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.179; TCGA COAD -0.184; TCGA KIRC -0.217; TCGA KIRP -0.224; TCGA LGG -0.205; TCGA OV -0.105; TCGA PAAD -0.229; TCGA SARC -0.215; TCGA STAD -0.315; TCGA UCEC -0.109
hsa-miR-29a-3p
HDAC4
9 cancers: CESC; ESCA; LGG; LIHC; LUSC; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA CESC -0.116; TCGA ESCA -0.254; TCGA LGG -0.088; TCGA LIHC -0.243; TCGA LUSC -0.15; TCGA PRAD -0.166; TCGA SARC -0.141; TCGA THCA -0.175; TCGA STAD -0.407
hsa-miR-29a-3p
COMMD2
15 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.124; TCGA ESCA -0.332; TCGA HNSC -0.117; TCGA KIRC -0.14; TCGA KIRP -0.206; TCGA LGG -0.177; TCGA LIHC -0.239; TCGA LUAD -0.186; TCGA LUSC -0.248; TCGA OV -0.168; TCGA PAAD -0.077; TCGA PRAD -0.068; TCGA SARC -0.064; TCGA STAD -0.123; TCGA UCEC -0.06
hsa-miR-29a-3p
COL2A1
11 cancers: CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA CESC -0.62; TCGA ESCA -0.821; TCGA HNSC -0.72; TCGA LGG -0.32; TCGA LIHC -1.869; TCGA LUAD -0.954; TCGA LUSC -0.853; TCGA OV -1.027; TCGA PRAD -1.868; TCGA SARC -0.695; TCGA UCEC -0.529
hsa-miR-29a-3p
EML4
9 cancers: CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.107; TCGA KIRC -0.145; TCGA KIRP -0.133; TCGA LGG -0.161; TCGA LIHC -0.082; TCGA LUAD -0.141; TCGA LUSC -0.109; TCGA PRAD -0.197; TCGA UCEC -0.054
hsa-miR-29a-3p
SCML2
10 cancers: CESC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA CESC -0.2; TCGA LGG -0.279; TCGA LIHC -0.642; TCGA LUAD -0.512; TCGA LUSC -0.769; TCGA OV -0.252; TCGA PRAD -0.123; TCGA SARC -0.425; TCGA THCA -0.275; TCGA STAD -0.458
hsa-miR-29a-3p
CAMK2B
9 cancers: CESC; ESCA; KIRP; LUAD; LUSC; OV; SARC; STAD; UCEC
mirMAP
TCGA CESC -0.458; TCGA ESCA -0.76; TCGA KIRP -0.436; TCGA LUAD -0.567; TCGA LUSC -0.647; TCGA OV -0.382; TCGA SARC -0.375; TCGA STAD -0.414; TCGA UCEC -0.429
hsa-miR-29a-3p
PLEKHG4B
9 cancers: CESC; ESCA; HNSC; LIHC; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA CESC -0.435; TCGA ESCA -1.32; TCGA HNSC -0.522; TCGA LIHC -0.309; TCGA LUSC -0.665; TCGA SARC -0.33; TCGA THCA -0.325; TCGA STAD -0.543; TCGA UCEC -0.334
hsa-miR-29a-3p
ADAMTS18
10 cancers: CESC; COAD; KIRC; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC
miRNATAP
TCGA CESC -0.538; TCGA COAD -0.936; TCGA KIRC -0.649; TCGA LIHC -0.372; TCGA LUAD -0.444; TCGA LUSC -0.525; TCGA OV -0.54; TCGA SARC -0.349; TCGA STAD -0.415; TCGA UCEC -0.33
hsa-miR-29a-3p
PCYT1B
10 cancers: CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; SARC; STAD
miRNATAP
TCGA CESC -0.337; TCGA COAD -0.863; TCGA ESCA -1.283; TCGA HNSC -0.406; TCGA KIRC -0.336; TCGA LUSC -0.58; TCGA OV -0.413; TCGA PAAD -0.369; TCGA SARC -1.124; TCGA STAD -1.14
hsa-miR-29a-3p
ELOVL4
10 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD
miRNATAP
TCGA CESC -0.36; TCGA COAD -0.852; TCGA ESCA -0.751; TCGA HNSC -0.297; TCGA LIHC -0.436; TCGA LUAD -0.679; TCGA LUSC -0.899; TCGA OV -0.511; TCGA PAAD -0.426; TCGA STAD -0.605
hsa-miR-29a-3p
COL4A2
11 cancers: COAD; ESCA; HNSC; KIRC; LGG; LUAD; OV; PAAD; SARC; THCA; STAD
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA COAD -0.574; TCGA ESCA -0.316; TCGA HNSC -0.398; TCGA KIRC -0.522; TCGA LGG -0.281; TCGA LUAD -0.239; TCGA OV -0.213; TCGA PAAD -0.33; TCGA SARC -0.419; TCGA THCA -0.409; TCGA STAD -0.412
hsa-miR-29a-3p
MORF4L1
9 cancers: COAD; ESCA; HNSC; KIRP; LIHC; OV; PAAD; PRAD; STAD
MirTarget
TCGA COAD -0.174; TCGA ESCA -0.147; TCGA HNSC -0.054; TCGA KIRP -0.07; TCGA LIHC -0.052; TCGA OV -0.084; TCGA PAAD -0.153; TCGA PRAD -0.069; TCGA STAD -0.136
hsa-miR-29a-3p
ROBO1
10 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUAD; OV; PAAD; SARC; STAD
MirTarget
TCGA COAD -0.567; TCGA ESCA -0.32; TCGA KIRC -0.296; TCGA LGG -0.155; TCGA LIHC -0.498; TCGA LUAD -0.207; TCGA OV -0.157; TCGA PAAD -0.355; TCGA SARC -0.194; TCGA STAD -0.336
hsa-miR-29a-3p
CRISPLD1
10 cancers: COAD; ESCA; KIRP; LGG; LUSC; OV; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -1.067; TCGA ESCA -0.792; TCGA KIRP -0.273; TCGA LGG -0.283; TCGA LUSC -0.387; TCGA OV -0.494; TCGA PAAD -0.56; TCGA SARC -0.602; TCGA STAD -0.778; TCGA UCEC -0.301
hsa-miR-29a-3p
BLMH
16 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.138; TCGA ESCA -0.262; TCGA HNSC -0.12; TCGA KIRC -0.224; TCGA KIRP -0.179; TCGA LGG -0.178; TCGA LIHC -0.379; TCGA LUAD -0.323; TCGA LUSC -0.413; TCGA OV -0.207; TCGA PAAD -0.127; TCGA PRAD -0.089; TCGA SARC -0.067; TCGA THCA -0.173; TCGA STAD -0.169; TCGA UCEC -0.126
hsa-miR-29a-3p
LAMC1
14 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA COAD -0.379; TCGA ESCA -0.288; TCGA HNSC -0.182; TCGA KIRC -0.287; TCGA KIRP -0.212; TCGA LGG -0.138; TCGA LIHC -0.294; TCGA LUAD -0.132; TCGA LUSC -0.207; TCGA OV -0.148; TCGA PAAD -0.268; TCGA PRAD -0.319; TCGA SARC -0.149; TCGA STAD -0.541
hsa-miR-29a-3p
GPX7
14 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.519; TCGA ESCA -0.438; TCGA HNSC -0.21; TCGA KIRC -0.248; TCGA KIRP -0.417; TCGA LGG -0.209; TCGA LIHC -0.611; TCGA LUAD -0.244; TCGA LUSC -0.201; TCGA OV -0.384; TCGA PAAD -0.322; TCGA THCA -0.105; TCGA STAD -0.199; TCGA UCEC -0.187
hsa-miR-29a-3p
AGPAT4
10 cancers: COAD; HNSC; KIRP; LIHC; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.623; TCGA HNSC -0.274; TCGA KIRP -0.219; TCGA LIHC -0.398; TCGA OV -0.244; TCGA PAAD -0.258; TCGA SARC -0.202; TCGA THCA -0.407; TCGA STAD -0.384; TCGA UCEC -0.14
hsa-miR-29a-3p
SH3RF3
9 cancers: COAD; ESCA; KIRC; LGG; LUAD; PAAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA COAD -0.531; TCGA ESCA -0.32; TCGA KIRC -0.36; TCGA LGG -0.092; TCGA LUAD -0.162; TCGA PAAD -0.309; TCGA PRAD -0.349; TCGA THCA -0.287; TCGA STAD -0.365
hsa-miR-29a-3p
KIAA1614
11 cancers: COAD; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD
mirMAP
TCGA COAD -0.417; TCGA ESCA -0.566; TCGA KIRC -0.317; TCGA LIHC -0.406; TCGA LUAD -0.205; TCGA LUSC -0.141; TCGA OV -0.147; TCGA PAAD -0.33; TCGA SARC -0.277; TCGA THCA -0.492; TCGA STAD -0.384
hsa-miR-29a-3p
SCHIP1
9 cancers: COAD; ESCA; KIRC; KIRP; LUAD; LUSC; OV; PAAD; SARC
miRNATAP
TCGA COAD -0.625; TCGA ESCA -0.673; TCGA KIRC -0.217; TCGA KIRP -0.444; TCGA LUAD -0.11; TCGA LUSC -0.159; TCGA OV -0.249; TCGA PAAD -0.212; TCGA SARC -0.408
hsa-miR-29a-3p
ZNF532
12 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA COAD -0.575; TCGA ESCA -0.436; TCGA HNSC -0.079; TCGA KIRC -0.421; TCGA KIRP -0.186; TCGA LGG -0.073; TCGA LIHC -0.178; TCGA LUAD -0.091; TCGA LUSC -0.259; TCGA PAAD -0.286; TCGA SARC -0.266; TCGA STAD -0.494
hsa-miR-29a-3p
CNTN5
9 cancers: ESCA; HNSC; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA ESCA -0.955; TCGA HNSC -0.488; TCGA LUSC -0.702; TCGA OV -0.468; TCGA PAAD -0.562; TCGA SARC -0.45; TCGA THCA -1.034; TCGA STAD -0.651; TCGA UCEC -0.28
hsa-miR-29a-3p
MEST
10 cancers: HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.195; TCGA KIRP -0.317; TCGA LGG -0.262; TCGA LIHC -0.317; TCGA LUAD -0.282; TCGA LUSC -0.402; TCGA OV -0.474; TCGA SARC -0.302; TCGA THCA -0.139; TCGA UCEC -0.248
hsa-miR-29a-3p
SLC16A1
9 cancers: HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA
MirTarget; miRNATAP
TCGA HNSC -0.245; TCGA KIRC -0.692; TCGA LGG -0.063; TCGA LUAD -0.483; TCGA LUSC -0.545; TCGA OV -0.216; TCGA PRAD -0.241; TCGA SARC -0.194; TCGA THCA -0.115
hsa-miR-29a-3p
TAF5
9 cancers: KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
miRNATAP
TCGA KIRC -0.143; TCGA LGG -0.13; TCGA LIHC -0.258; TCGA LUAD -0.132; TCGA LUSC -0.248; TCGA OV -0.149; TCGA PRAD -0.087; TCGA SARC -0.076; TCGA UCEC -0.099





Enriched cancer pathways of putative targets