microRNA information: hsa-miR-29c-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-29c-3p | miRbase |
Accession: | MIMAT0000681 | miRbase |
Precursor name: | hsa-mir-29c | miRbase |
Precursor accession: | MI0000735 | miRbase |
Symbol: | MIR29C | HGNC |
RefSeq ID: | NR_029832 | GenBank |
Sequence: | UAGCACCAUUUGAAAUCGGUUA |
Reported expression in cancers: hsa-miR-29c-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-29c-3p | B cell lymphoma | downregulation | "We measured the levels of miRNAs miR-15a miR-16-1 ......" | 21987025 | Reverse transcription PCR; qPCR |
hsa-miR-29c-3p | acute myeloid leukemia | upregulation | "Clinical response to azacitidine therapy depends o ......" | 26862847 | |
hsa-miR-29c-3p | bladder cancer | deregulation | "In other recruited 17 patients with BUC who were d ......" | 22886973 | Reverse transcription PCR; Microarray |
hsa-miR-29c-3p | breast cancer | downregulation | "Significantly reduced expression of miR-29c distin ......" | 24297604 | |
hsa-miR-29c-3p | breast cancer | downregulation | "Molecular Subtype Specific Expression of MicroRNA ......" | 26539832 | |
hsa-miR-29c-3p | breast cancer | downregulation | "Moreover we discovered a new prognostic signature ......" | 26878388 | |
hsa-miR-29c-3p | colorectal cancer | downregulation | "Two microRNAs miR-29a and miR-29c were disclosed a ......" | 22348113 | |
hsa-miR-29c-3p | esophageal cancer | downregulation | "Predictive Value of Serum miR 10b miR 29c and miR ......" | 26554762 | qPCR |
hsa-miR-29c-3p | gastric cancer | downregulation | "miRNA microarray analysis revealed that miR-29c wa ......" | 23001726 | Microarray |
hsa-miR-29c-3p | gastric cancer | downregulation | "Previously using miRNA microarray we have found th ......" | 23442884 | Microarray |
hsa-miR-29c-3p | gastric cancer | downregulation | "Recently miR-29c has been reported to be down-regu ......" | 25661340 | |
hsa-miR-29c-3p | head and neck cancer | downregulation | "Expression profiles of miR 29c miR 200b and miR 37 ......" | 27440205 | qPCR |
hsa-miR-29c-3p | liver cancer | downregulation | "Recent studies have revealed that microRNA-29c miR ......" | 21763284 | |
hsa-miR-29c-3p | liver cancer | downregulation | "In addition miR-29c expression was downregulated i ......" | 23728341 | |
hsa-miR-29c-3p | lung cancer | upregulation | "Expression of miR 29c miR 93 and miR 429 as potent ......" | 24523873 | qPCR; Microarray |
hsa-miR-29c-3p | lung squamous cell cancer | deregulation | "Locked nucleic acids miRNA microarray expression p ......" | 20508945 | Microarray |
hsa-miR-29c-3p | melanoma | downregulation | "Downregulation of microRNA 29c is associated with ......" | 21081840 | |
hsa-miR-29c-3p | pancreatic cancer | downregulation | "Reduction of miR 29c enhances pancreatic cancer ce ......" | 25605017 | |
hsa-miR-29c-3p | pancreatic cancer | upregulation | "miR 29c suppresses pancreatic cancer liver metasta ......" | 25863127 | |
hsa-miR-29c-3p | pancreatic cancer | upregulation | "We identified hsa-miR-21 hsa-miR-23a hsa-miR-23b a ......" | 26121640 | |
hsa-miR-29c-3p | pancreatic cancer | downregulation | "MiR-29c is frequently dysregulated in many cancers ......" | 26766915 | qPCR |
hsa-miR-29c-3p | thyroid cancer | deregulation | "Deregulated miRNAs were confirmed by quantitative ......" | 24127332 | qPCR; in situ hybridization |
Reported cancer pathway affected by hsa-miR-29c-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-29c-3p | bladder cancer | cell cycle pathway; Apoptosis pathway | "Effect of miR 29b 1* and miR 29c knockdown on cell ......" | 24265332 | MTT assay |
hsa-miR-29c-3p | bladder cancer | cell cycle pathway; Apoptosis pathway | "Down regulation of miR 29c in human bladder cancer ......" | 24952510 | |
hsa-miR-29c-3p | bladder cancer | cell cycle pathway | "The purpose of this study was to investigate the e ......" | 26396669 | Colony formation; MTT assay; Transwell assay; Luciferase; Western blot |
hsa-miR-29c-3p | esophageal cancer | cell cycle pathway | "miR 29c induces cell cycle arrest in esophageal sq ......" | 21551130 | |
hsa-miR-29c-3p | gastric cancer | Apoptosis pathway | "The tumor suppressor microRNA 29c is downregulated ......" | 23001726 | |
hsa-miR-29c-3p | gastric cancer | Apoptosis pathway | "MiR 29c is downregulated in gastric carcinomas and ......" | 23442884 | Colony formation |
hsa-miR-29c-3p | gastric cancer | cell cycle pathway; Apoptosis pathway | "Relationship between the expression level of miR 2 ......" | 24054006 | Flow cytometry; MTT assay; Western blot; Luciferase |
hsa-miR-29c-3p | liver cancer | Apoptosis pathway | "miR 29c targets TNFAIP3 inhibits cell proliferatio ......" | 21763284 | |
hsa-miR-29c-3p | liver cancer | Apoptosis pathway | "A suppressive role of ionizing radiation responsiv ......" | 25888625 | Luciferase |
hsa-miR-29c-3p | lymphoma | cell cycle pathway; Apoptosis pathway | "MicroRNA profiles were correlated with correspondi ......" | 21960592 | |
hsa-miR-29c-3p | retinoblastoma | cell cycle pathway | "To investigate differential expression of microRNA ......" | 21941147 |
Reported cancer prognosis affected by hsa-miR-29c-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-29c-3p | acute myeloid leukemia | drug resistance | "Clinical response to azacitidine therapy depends o ......" | 26862847 | |
hsa-miR-29c-3p | bladder cancer | staging; motility | "Down regulation of miR 29c in human bladder cancer ......" | 24952510 | |
hsa-miR-29c-3p | breast cancer | poor survival | "To investigate the global expression profile of mi ......" | 18812439 | |
hsa-miR-29c-3p | breast cancer | poor survival | "Identifying microRNAs regulating B7 H3 in breast c ......" | 24577056 | Luciferase |
hsa-miR-29c-3p | breast cancer | poor survival | "Moreover we discovered a new prognostic signature ......" | 26878388 | |
hsa-miR-29c-3p | colorectal cancer | recurrence | "Two microRNAs miR-29a and miR-29c were disclosed a ......" | 22348113 | |
hsa-miR-29c-3p | colorectal cancer | recurrence | "The functional significance of microRNA 29c in pat ......" | 23840538 | |
hsa-miR-29c-3p | colorectal cancer | metastasis; progression; poor survival; cell migration | "MiR 29c mediates epithelial to mesenchymal transit ......" | 25193986 | |
hsa-miR-29c-3p | esophageal cancer | metastasis; differentiation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
hsa-miR-29c-3p | gastric cancer | staging; progression | "The tumor suppressor microRNA 29c is downregulated ......" | 23001726 | |
hsa-miR-29c-3p | gastric cancer | staging | "MiR 29c is downregulated in gastric carcinomas and ......" | 23442884 | Colony formation |
hsa-miR-29c-3p | gastric cancer | tumorigenesis; staging; metastasis; tumor size; differentiation | "Relationship between the expression level of miR 2 ......" | 24054006 | Flow cytometry; MTT assay; Western blot; Luciferase |
hsa-miR-29c-3p | gastric cancer | progression | "Among them miR-29c had the most reduced percentage ......" | 24130168 | |
hsa-miR-29c-3p | gastric cancer | recurrence | "In particular patients with gastric cancer who exp ......" | 25634213 | |
hsa-miR-29c-3p | gastric cancer | progression | "A miR 29c binding site genetic variant in the 3' u ......" | 25661340 | |
hsa-miR-29c-3p | gastric cancer | staging; metastasis | "Evaluation of miR 29c miR 124 miR 135a and miR 148 ......" | 26885198 | |
hsa-miR-29c-3p | glioblastoma | drug resistance | "c Myc miR 29c REV3L signalling pathway drives the ......" | 26450587 | |
hsa-miR-29c-3p | head and neck cancer | poor survival; progression; worse prognosis | "Expression profiles of miR 29c miR 200b and miR 37 ......" | 27440205 | |
hsa-miR-29c-3p | liver cancer | tumorigenesis; progression | "miR 29c targets TNFAIP3 inhibits cell proliferatio ......" | 21763284 | |
hsa-miR-29c-3p | liver cancer | progression | "We conclude that miR-29c may play an important rol ......" | 23582783 | |
hsa-miR-29c-3p | liver cancer | worse prognosis; tumorigenesis | "MicroRNA 29c functions as a tumor suppressor by di ......" | 23728341 | |
hsa-miR-29c-3p | lung cancer | metastasis | "Our pilot study using miRNA arrays found that miRN ......" | 23936390 | Luciferase; Western blot |
hsa-miR-29c-3p | lung cancer | staging; worse prognosis | "Expression of miR 29c miR 93 and miR 429 as potent ......" | 24523873 | |
hsa-miR-29c-3p | lung squamous cell cancer | poor survival | "Using a linear combination of the miR CT values wi ......" | 24007627 | |
hsa-miR-29c-3p | lymphoma | differentiation | "MicroRNA profiles were correlated with correspondi ......" | 21960592 | |
hsa-miR-29c-3p | melanoma | staging; metastasis; poor survival; progression | "Downregulation of microRNA 29c is associated with ......" | 21081840 | |
hsa-miR-29c-3p | pancreatic cancer | cell migration; staging | "Reduction of miR 29c enhances pancreatic cancer ce ......" | 25605017 | |
hsa-miR-29c-3p | pancreatic cancer | metastasis; poor survival; cell migration | "miR 29c suppresses pancreatic cancer liver metasta ......" | 25863127 | |
hsa-miR-29c-3p | sarcoma | worse prognosis | "We examined expression levels of miR-29a miR-29b a ......" | 25015394 |
Reported gene related to hsa-miR-29c-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-29c-3p | gastric cancer | MCL1 | "Quantitative real-time PCR Western blot and lucife ......" | 24054006 |
hsa-miR-29c-3p | gastric cancer | MCL1 | "In addition expression of the oncogene Mcl-1 a tar ......" | 23001726 |
hsa-miR-29c-3p | lung cancer | MMP2 | "Furthermore the dual-luciferase reporter assay dem ......" | 23936390 |
hsa-miR-29c-3p | pancreatic cancer | MMP2 | "miR-29c suppresses cell migration and invasion by ......" | 25863127 |
hsa-miR-29c-3p | breast cancer | CD276 | "Identifying microRNAs regulating B7 H3 in breast c ......" | 24577056 |
hsa-miR-29c-3p | breast cancer | CD80 | "Identifying microRNAs regulating B7 H3 in breast c ......" | 24577056 |
hsa-miR-29c-3p | bladder cancer | CDK6 | "Furthermore through qPCR and Western blot assays c ......" | 26396669 |
hsa-miR-29c-3p | liver cancer | CDKN1A | "We conclude that miR-29c may play an important rol ......" | 23582783 |
hsa-miR-29c-3p | melanoma | DNMT3A | "Overall an increase in miR-29c expression inversel ......" | 21081840 |
hsa-miR-29c-3p | melanoma | DNMT3B | "Overall an increase in miR-29c expression inversel ......" | 21081840 |
hsa-miR-29c-3p | colorectal cancer | GNA13 | "MiR 29c mediates epithelial to mesenchymal transit ......" | 25193986 |
hsa-miR-29c-3p | liver cancer | INSR | "Here we show that low-dose ionizing radiation IR i ......" | 25888625 |
hsa-miR-29c-3p | lung cancer | ITGA9 | "Furthermore the dual-luciferase reporter assay dem ......" | 23936390 |
hsa-miR-29c-3p | pancreatic cancer | ITGB1 | "MiR 29c inhibits cell growth invasion and migratio ......" | 26766915 |
hsa-miR-29c-3p | gastric cancer | LAMTOR3 | "A miR 29c binding site genetic variant in the 3' u ......" | 25661340 |
hsa-miR-29c-3p | lung cancer | MMRN1 | "The gain-of-function studies that raised miR-29c e ......" | 23936390 |
hsa-miR-29c-3p | glioblastoma | MYC | "Here using recurrent temozolomide-refractory gliob ......" | 26450587 |
hsa-miR-29c-3p | esophageal cancer | PCNA | "miR 29c induces cell cycle arrest in esophageal sq ......" | 21551130 |
hsa-miR-29c-3p | colorectal cancer | PCS | "A series of in vivo and in vitro assays were carri ......" | 25193986 |
hsa-miR-29c-3p | gastric cancer | PPIC | "RCC2 and PPIC were actually upregulated in gastric ......" | 23442884 |
hsa-miR-29c-3p | liver cancer | PPM1D | "A suppressive role of ionizing radiation responsiv ......" | 25888625 |
hsa-miR-29c-3p | gastric cancer | PTGS2 | "Selective COX-2 inhibitors may have clinical promi ......" | 23001726 |
hsa-miR-29c-3p | colorectal cancer | PTP4A2 | "MiR 29c mediates epithelial to mesenchymal transit ......" | 25193986 |
hsa-miR-29c-3p | gastric cancer | RCC2 | "MiR 29c is downregulated in gastric carcinomas and ......" | 23442884 |
hsa-miR-29c-3p | liver cancer | SIRT1 | "MicroRNA 29c functions as a tumor suppressor by di ......" | 23728341 |
hsa-miR-29c-3p | melanoma | SPEN | "Hypermethylation status of TRGs and non-coding MIN ......" | 21081840 |
hsa-miR-29c-3p | liver cancer | TNFAIP3 | "miR 29c targets TNFAIP3 inhibits cell proliferatio ......" | 21763284 |
hsa-miR-29c-3p | liver cancer | TP53 | "The biological effects of miR-29c may be mediated ......" | 25888625 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-29c-3p | ADO | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; LUSC; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.062; TCGA BRCA -0.077; TCGA COAD -0.067; TCGA ESCA -0.139; TCGA KIRP -0.063; TCGA LIHC -0.062; TCGA LUSC -0.077; TCGA PRAD -0.067; TCGA SARC -0.078; TCGA STAD -0.207 |
hsa-miR-29c-3p | BACE1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.295; TCGA BRCA -0.144; TCGA CESC -0.08; TCGA HNSC -0.06; TCGA KIRC -0.135; TCGA LUAD -0.085; TCGA PRAD -0.074; TCGA SARC -0.171; TCGA THCA -0.094; TCGA STAD -0.152 |
hsa-miR-29c-3p | BFAR | 11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; PAAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.08; TCGA BRCA -0.061; TCGA HNSC -0.09; TCGA KIRC -0.129; TCGA KIRP -0.145; TCGA LGG -0.065; TCGA LIHC -0.062; TCGA OV -0.056; TCGA PAAD -0.132; TCGA SARC -0.053; TCGA THCA -0.054 |
hsa-miR-29c-3p | CDC23 | 10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUSC; OV; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.083; TCGA BRCA -0.068; TCGA COAD -0.08; TCGA ESCA -0.139; TCGA LGG -0.095; TCGA LIHC -0.137; TCGA LUSC -0.087; TCGA OV -0.052; TCGA SARC -0.068; TCGA STAD -0.14 |
hsa-miR-29c-3p | CDK6 | 11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC; STAD | miRNAWalker2 validate; miRTarBase; miRNATAP; RAID | TCGA BLCA -0.581; TCGA BRCA -0.391; TCGA HNSC -0.263; TCGA KIRC -0.205; TCGA KIRP -0.13; TCGA LGG -0.208; TCGA LUSC -0.214; TCGA OV -0.235; TCGA PAAD -0.24; TCGA SARC -0.466; TCGA STAD -0.265 |
hsa-miR-29c-3p | COL15A1 | 9 cancers: BLCA; BRCA; KIRC; LIHC; LUAD; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.24; TCGA BRCA -0.09; TCGA KIRC -0.418; TCGA LIHC -0.364; TCGA LUAD -0.132; TCGA PAAD -0.406; TCGA PRAD -0.259; TCGA THCA -0.114; TCGA STAD -0.175 |
hsa-miR-29c-3p | COL1A1 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.606; TCGA BRCA -0.308; TCGA CESC -0.245; TCGA ESCA -0.673; TCGA HNSC -0.615; TCGA KIRC -0.738; TCGA LGG -0.327; TCGA LUAD -0.149; TCGA LUSC -0.259; TCGA PAAD -1.019; TCGA PRAD -0.426; TCGA SARC -0.697; TCGA THCA -0.512; TCGA STAD -0.671; TCGA UCEC -0.2 |
hsa-miR-29c-3p | COL1A2 | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.553; TCGA BRCA -0.367; TCGA CESC -0.254; TCGA ESCA -0.533; TCGA HNSC -0.501; TCGA KIRC -0.59; TCGA LGG -0.158; TCGA LUAD -0.124; TCGA PAAD -0.971; TCGA PRAD -0.381; TCGA SARC -0.492; TCGA THCA -0.331; TCGA STAD -0.526; TCGA UCEC -0.152 |
hsa-miR-29c-3p | COL3A1 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.542; TCGA BRCA -0.388; TCGA CESC -0.214; TCGA ESCA -0.465; TCGA HNSC -0.48; TCGA KIRC -0.645; TCGA LGG -0.471; TCGA LUSC -0.187; TCGA PAAD -1.002; TCGA PRAD -0.45; TCGA SARC -0.526; TCGA THCA -0.441; TCGA STAD -0.481 |
hsa-miR-29c-3p | COL4A1 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.274; TCGA BRCA -0.188; TCGA CESC -0.338; TCGA ESCA -0.359; TCGA HNSC -0.393; TCGA KIRC -0.478; TCGA LGG -0.339; TCGA LIHC -0.174; TCGA LUAD -0.183; TCGA OV -0.094; TCGA PAAD -0.427; TCGA PRAD -0.366; TCGA THCA -0.265; TCGA STAD -0.467; TCGA UCEC -0.164 |
hsa-miR-29c-3p | COL4A2 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.268; TCGA BRCA -0.148; TCGA CESC -0.317; TCGA ESCA -0.281; TCGA HNSC -0.36; TCGA KIRC -0.356; TCGA LGG -0.254; TCGA LIHC -0.148; TCGA LUAD -0.189; TCGA OV -0.097; TCGA PAAD -0.425; TCGA PRAD -0.365; TCGA THCA -0.23; TCGA STAD -0.321; TCGA UCEC -0.164 |
hsa-miR-29c-3p | COL7A1 | 10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.334; TCGA BRCA -0.15; TCGA ESCA -0.804; TCGA HNSC -0.404; TCGA LGG -0.197; TCGA LIHC -0.506; TCGA LUSC -0.89; TCGA PAAD -1.071; TCGA STAD -0.633; TCGA UCEC -0.218 |
hsa-miR-29c-3p | DDX21 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.203; TCGA BRCA -0.277; TCGA CESC -0.131; TCGA COAD -0.121; TCGA ESCA -0.173; TCGA LGG -0.093; TCGA LUAD -0.12; TCGA LUSC -0.102; TCGA SARC -0.25; TCGA STAD -0.263; TCGA UCEC -0.125 |
hsa-miR-29c-3p | GAPDH | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.144; TCGA BRCA -0.171; TCGA CESC -0.085; TCGA COAD -0.109; TCGA ESCA -0.322; TCGA HNSC -0.116; TCGA KIRC -0.224; TCGA KIRP -0.169; TCGA LIHC -0.114; TCGA LUAD -0.119; TCGA LUSC -0.383; TCGA PAAD -0.244; TCGA THCA -0.107; TCGA UCEC -0.143 |
hsa-miR-29c-3p | HDGF | 10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; SARC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.116; TCGA BRCA -0.11; TCGA ESCA -0.181; TCGA HNSC -0.077; TCGA LGG -0.101; TCGA LIHC -0.075; TCGA LUSC -0.198; TCGA PAAD -0.142; TCGA PRAD -0.054; TCGA SARC -0.08 |
hsa-miR-29c-3p | KCTD15 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUSC; OV; PAAD; PRAD | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.311; TCGA BRCA -0.183; TCGA ESCA -0.205; TCGA HNSC -0.099; TCGA KIRC -0.368; TCGA LGG -0.14; TCGA LUSC -0.275; TCGA OV -0.143; TCGA PAAD -0.142; TCGA PRAD -0.166 |
hsa-miR-29c-3p | KIAA1549 | 11 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUSC; OV; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.185; TCGA BRCA -0.183; TCGA CESC -0.481; TCGA KIRP -0.101; TCGA LGG -0.19; TCGA LUSC -0.243; TCGA OV -0.297; TCGA SARC -0.476; TCGA THCA -0.169; TCGA STAD -0.238; TCGA UCEC -0.278 |
hsa-miR-29c-3p | LAMC1 | 18 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.258; TCGA BRCA -0.293; TCGA CESC -0.15; TCGA ESCA -0.122; TCGA HNSC -0.172; TCGA KIRC -0.334; TCGA KIRP -0.195; TCGA LGG -0.11; TCGA LIHC -0.248; TCGA LUAD -0.096; TCGA LUSC -0.161; TCGA OV -0.063; TCGA PAAD -0.427; TCGA PRAD -0.341; TCGA SARC -0.092; TCGA THCA -0.215; TCGA STAD -0.255; TCGA UCEC -0.156 |
hsa-miR-29c-3p | MTHFD2 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.415; TCGA BRCA -0.232; TCGA COAD -0.176; TCGA ESCA -0.144; TCGA HNSC -0.083; TCGA LGG -0.298; TCGA LUAD -0.138; TCGA LUSC -0.283; TCGA THCA -0.134; TCGA STAD -0.208 |
hsa-miR-29c-3p | NKIRAS2 | 14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.068; TCGA BRCA -0.052; TCGA ESCA -0.126; TCGA HNSC -0.058; TCGA KIRC -0.156; TCGA KIRP -0.274; TCGA LGG -0.252; TCGA LIHC -0.155; TCGA LUAD -0.108; TCGA LUSC -0.157; TCGA OV -0.083; TCGA PAAD -0.153; TCGA STAD -0.097; TCGA UCEC -0.132 |
hsa-miR-29c-3p | OIP5 | 17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.336; TCGA BRCA -0.278; TCGA COAD -0.151; TCGA ESCA -0.503; TCGA HNSC -0.082; TCGA KIRC -0.414; TCGA KIRP -0.237; TCGA LGG -0.392; TCGA LIHC -0.959; TCGA LUAD -0.292; TCGA LUSC -0.566; TCGA OV -0.095; TCGA PAAD -0.372; TCGA PRAD -0.486; TCGA SARC -0.14; TCGA STAD -0.261; TCGA UCEC -0.357 |
hsa-miR-29c-3p | PPM1D | 11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; OV; SARC; STAD | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.117; TCGA BRCA -0.101; TCGA CESC -0.063; TCGA KIRC -0.15; TCGA KIRP -0.144; TCGA LGG -0.142; TCGA LIHC -0.068; TCGA LUAD -0.071; TCGA OV -0.055; TCGA SARC -0.098; TCGA STAD -0.073 |
hsa-miR-29c-3p | PPP1R14C | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.792; TCGA BRCA -0.777; TCGA ESCA -0.878; TCGA HNSC -0.336; TCGA KIRP -0.787; TCGA LIHC -0.41; TCGA PAAD -0.256; TCGA THCA -0.198; TCGA STAD -0.364; TCGA UCEC -0.297 |
hsa-miR-29c-3p | PRKAB2 | 9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; STAD | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.106; TCGA BRCA -0.157; TCGA CESC -0.099; TCGA HNSC -0.114; TCGA LIHC -0.112; TCGA LUAD -0.077; TCGA LUSC -0.198; TCGA OV -0.105; TCGA STAD -0.143 |
hsa-miR-29c-3p | PSMA2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.083; TCGA BRCA -0.062; TCGA COAD -0.12; TCGA ESCA -0.1; TCGA HNSC -0.092; TCGA KIRP -0.08; TCGA LGG -0.084; TCGA LUAD -0.056; TCGA LUSC -0.135; TCGA PRAD -0.086; TCGA UCEC -0.053 |
hsa-miR-29c-3p | SPARC | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.364; TCGA BRCA -0.237; TCGA CESC -0.199; TCGA ESCA -0.387; TCGA HNSC -0.374; TCGA KIRC -0.408; TCGA LUAD -0.095; TCGA OV -0.152; TCGA PAAD -0.662; TCGA PRAD -0.301; TCGA SARC -0.377; TCGA THCA -0.305; TCGA STAD -0.407 |
hsa-miR-29c-3p | SPIN4 | 12 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.314; TCGA BRCA -0.212; TCGA COAD -0.14; TCGA KIRC -0.209; TCGA LGG -0.092; TCGA LIHC -0.211; TCGA LUAD -0.158; TCGA OV -0.11; TCGA PAAD -0.23; TCGA PRAD -0.244; TCGA STAD -0.373; TCGA UCEC -0.084 |
hsa-miR-29c-3p | TIPRL | 9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUSC; OV; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.076; TCGA BRCA -0.119; TCGA COAD -0.056; TCGA ESCA -0.14; TCGA LIHC -0.055; TCGA LUSC -0.147; TCGA OV -0.072; TCGA PRAD -0.123; TCGA STAD -0.136 |
hsa-miR-29c-3p | TMTC3 | 15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.086; TCGA BRCA -0.154; TCGA COAD -0.109; TCGA ESCA -0.335; TCGA HNSC -0.075; TCGA KIRC -0.196; TCGA LUAD -0.114; TCGA LUSC -0.267; TCGA OV -0.099; TCGA PAAD -0.256; TCGA PRAD -0.098; TCGA SARC -0.121; TCGA THCA -0.089; TCGA STAD -0.208; TCGA UCEC -0.055 |
hsa-miR-29c-3p | UBTD2 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.13; TCGA BRCA -0.104; TCGA CESC -0.138; TCGA ESCA -0.097; TCGA HNSC -0.079; TCGA KIRC -0.094; TCGA LGG -0.149; TCGA LIHC -0.105; TCGA OV -0.115; TCGA PAAD -0.148; TCGA PRAD -0.121; TCGA SARC -0.26; TCGA THCA -0.07; TCGA STAD -0.068; TCGA UCEC -0.075 |
hsa-miR-29c-3p | NID1 | 14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.42; TCGA BRCA -0.288; TCGA CESC -0.315; TCGA HNSC -0.327; TCGA KIRC -0.42; TCGA LGG -0.303; TCGA LIHC -0.194; TCGA LUAD -0.152; TCGA LUSC -0.131; TCGA OV -0.16; TCGA PAAD -0.419; TCGA PRAD -0.227; TCGA SARC -0.141; TCGA THCA -0.368 |
hsa-miR-29c-3p | HAPLN3 | 9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.414; TCGA BRCA -0.27; TCGA ESCA -0.152; TCGA KIRC -0.299; TCGA LGG -0.176; TCGA PAAD -0.421; TCGA PRAD -0.27; TCGA STAD -0.162; TCGA UCEC -0.151 |
hsa-miR-29c-3p | ROBO1 | 9 cancers: BLCA; BRCA; KIRC; LGG; LIHC; PAAD; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.22; TCGA BRCA -0.25; TCGA KIRC -0.351; TCGA LGG -0.15; TCGA LIHC -0.612; TCGA PAAD -0.326; TCGA PRAD -0.207; TCGA SARC -0.316; TCGA UCEC -0.224 |
hsa-miR-29c-3p | COL5A3 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.579; TCGA BRCA -0.249; TCGA ESCA -0.554; TCGA HNSC -0.48; TCGA KIRC -0.636; TCGA LUAD -0.156; TCGA LUSC -0.169; TCGA PAAD -0.681; TCGA SARC -0.377; TCGA THCA -0.228; TCGA STAD -0.429 |
hsa-miR-29c-3p | CCNA2 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.341; TCGA BRCA -0.435; TCGA CESC -0.077; TCGA COAD -0.168; TCGA ESCA -0.437; TCGA HNSC -0.115; TCGA KIRC -0.362; TCGA KIRP -0.345; TCGA LGG -0.397; TCGA LIHC -0.923; TCGA LUAD -0.299; TCGA LUSC -0.541; TCGA OV -0.091; TCGA PAAD -0.275; TCGA PRAD -0.361; TCGA SARC -0.26; TCGA STAD -0.264; TCGA UCEC -0.272 |
hsa-miR-29c-3p | FAM168B | 9 cancers: BLCA; BRCA; CESC; LIHC; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.163; TCGA BRCA -0.109; TCGA CESC -0.121; TCGA LIHC -0.178; TCGA LUSC -0.108; TCGA OV -0.074; TCGA PRAD -0.122; TCGA STAD -0.16; TCGA UCEC -0.084 |
hsa-miR-29c-3p | TUBD1 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD | MirTarget | TCGA BLCA -0.114; TCGA BRCA -0.115; TCGA COAD -0.132; TCGA ESCA -0.08; TCGA KIRP -0.15; TCGA LGG -0.08; TCGA LIHC -0.247; TCGA LUAD -0.104; TCGA LUSC -0.093; TCGA OV -0.089; TCGA PRAD -0.058; TCGA STAD -0.136 |
hsa-miR-29c-3p | CRISPLD1 | 12 cancers: BLCA; BRCA; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.425; TCGA BRCA -0.285; TCGA KIRC -0.255; TCGA LGG -0.227; TCGA LUAD -0.182; TCGA LUSC -0.15; TCGA OV -0.452; TCGA PAAD -0.339; TCGA PRAD -0.485; TCGA SARC -0.443; TCGA STAD -0.332; TCGA UCEC -0.35 |
hsa-miR-29c-3p | KCTD5 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.075; TCGA BRCA -0.102; TCGA ESCA -0.136; TCGA HNSC -0.067; TCGA KIRC -0.071; TCGA LGG -0.168; TCGA LUAD -0.07; TCGA LUSC -0.128; TCGA PAAD -0.092; TCGA SARC -0.109; TCGA UCEC -0.067 |
hsa-miR-29c-3p | ISG20L2 | 12 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.094; TCGA BRCA -0.122; TCGA ESCA -0.138; TCGA LGG -0.094; TCGA LIHC -0.136; TCGA LUAD -0.058; TCGA LUSC -0.183; TCGA OV -0.058; TCGA PRAD -0.107; TCGA SARC -0.151; TCGA STAD -0.12; TCGA UCEC -0.079 |
hsa-miR-29c-3p | MFAP3 | 9 cancers: BLCA; CESC; KIRC; LGG; OV; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.077; TCGA CESC -0.096; TCGA KIRC -0.153; TCGA LGG -0.054; TCGA OV -0.064; TCGA PAAD -0.091; TCGA SARC -0.142; TCGA THCA -0.053; TCGA STAD -0.086 |
hsa-miR-29c-3p | COL6A3 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.475; TCGA BRCA -0.288; TCGA ESCA -0.4; TCGA HNSC -0.367; TCGA KIRC -0.689; TCGA PAAD -0.926; TCGA PRAD -0.248; TCGA SARC -0.358; TCGA THCA -0.247; TCGA STAD -0.442 |
hsa-miR-29c-3p | IL1RAP | 12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.317; TCGA BRCA -0.287; TCGA ESCA -0.39; TCGA HNSC -0.093; TCGA KIRC -0.382; TCGA LGG -0.101; TCGA LUAD -0.169; TCGA LUSC -0.211; TCGA PAAD -0.557; TCGA SARC -0.116; TCGA THCA -0.486; TCGA STAD -0.245 |
hsa-miR-29c-3p | POLE3 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.171; TCGA BRCA -0.095; TCGA COAD -0.131; TCGA ESCA -0.218; TCGA KIRP -0.099; TCGA LGG -0.051; TCGA LIHC -0.145; TCGA LUSC -0.206; TCGA OV -0.074; TCGA PRAD -0.125; TCGA STAD -0.131; TCGA UCEC -0.057 |
hsa-miR-29c-3p | NKRF | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.056; TCGA BRCA -0.143; TCGA COAD -0.136; TCGA ESCA -0.12; TCGA KIRC -0.056; TCGA LUAD -0.054; TCGA LUSC -0.171; TCGA SARC -0.061; TCGA STAD -0.271 |
hsa-miR-29c-3p | MLLT11 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.442; TCGA BRCA -0.238; TCGA CESC -0.223; TCGA ESCA -0.481; TCGA HNSC -0.227; TCGA LUAD -0.271; TCGA LUSC -0.558; TCGA OV -0.295; TCGA PAAD -0.365; TCGA SARC -0.198; TCGA THCA -0.124; TCGA STAD -0.296; TCGA UCEC -0.244 |
hsa-miR-29c-3p | TMEM132A | 16 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.274; TCGA BRCA -0.191; TCGA ESCA -0.326; TCGA HNSC -0.244; TCGA KIRC -0.373; TCGA KIRP -0.474; TCGA LIHC -0.542; TCGA LUAD -0.232; TCGA LUSC -0.449; TCGA OV -0.153; TCGA PAAD -0.408; TCGA PRAD -0.467; TCGA SARC -0.427; TCGA THCA -0.264; TCGA STAD -0.224; TCGA UCEC -0.331 |
hsa-miR-29c-3p | ZBTB5 | 12 cancers: BLCA; BRCA; CESC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.058; TCGA BRCA -0.144; TCGA CESC -0.06; TCGA KIRP -0.14; TCGA LGG -0.165; TCGA LIHC -0.167; TCGA LUSC -0.081; TCGA OV -0.056; TCGA PRAD -0.107; TCGA SARC -0.067; TCGA STAD -0.082; TCGA UCEC -0.072 |
hsa-miR-29c-3p | PARG | 12 cancers: BLCA; BRCA; CESC; ESCA; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.105; TCGA BRCA -0.127; TCGA CESC -0.059; TCGA ESCA -0.078; TCGA LIHC -0.152; TCGA LUAD -0.054; TCGA LUSC -0.078; TCGA PRAD -0.212; TCGA SARC -0.103; TCGA THCA -0.079; TCGA STAD -0.157; TCGA UCEC -0.117 |
hsa-miR-29c-3p | CALU | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.342; TCGA BRCA -0.382; TCGA CESC -0.106; TCGA COAD -0.113; TCGA ESCA -0.219; TCGA HNSC -0.17; TCGA KIRC -0.33; TCGA KIRP -0.186; TCGA LGG -0.078; TCGA LIHC -0.13; TCGA LUAD -0.151; TCGA LUSC -0.182; TCGA OV -0.072; TCGA PAAD -0.547; TCGA PRAD -0.079; TCGA SARC -0.174; TCGA THCA -0.163; TCGA STAD -0.235 |
hsa-miR-29c-3p | MORF4L2 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.084; TCGA COAD -0.146; TCGA ESCA -0.1; TCGA HNSC -0.084; TCGA LUAD -0.053; TCGA LUSC -0.157; TCGA OV -0.068; TCGA PAAD -0.144; TCGA STAD -0.135 |
hsa-miR-29c-3p | PPIC | 9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; PAAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.146; TCGA BRCA -0.176; TCGA ESCA -0.102; TCGA HNSC -0.076; TCGA KIRP -0.209; TCGA LIHC -0.138; TCGA PAAD -0.414; TCGA SARC -0.148; TCGA UCEC -0.085 |
hsa-miR-29c-3p | JARID2 | 12 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.074; TCGA BRCA -0.062; TCGA ESCA -0.175; TCGA HNSC -0.066; TCGA LGG -0.086; TCGA LIHC -0.187; TCGA LUAD -0.06; TCGA LUSC -0.191; TCGA OV -0.11; TCGA PAAD -0.088; TCGA SARC -0.151; TCGA UCEC -0.134 |
hsa-miR-29c-3p | GCSH | 9 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.245; TCGA BRCA -0.173; TCGA CESC -0.193; TCGA ESCA -0.253; TCGA LUAD -0.166; TCGA LUSC -0.489; TCGA PAAD -0.361; TCGA STAD -0.108; TCGA UCEC -0.317 |
hsa-miR-29c-3p | ANKRD13B | 16 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.213; TCGA BRCA -0.169; TCGA ESCA -0.381; TCGA HNSC -0.093; TCGA KIRC -0.339; TCGA KIRP -0.831; TCGA LGG -0.171; TCGA LIHC -0.427; TCGA LUAD -0.212; TCGA LUSC -0.35; TCGA OV -0.102; TCGA PRAD -0.244; TCGA SARC -0.108; TCGA THCA -0.162; TCGA STAD -0.491; TCGA UCEC -0.151 |
hsa-miR-29c-3p | CDCA4 | 18 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.303; TCGA BRCA -0.192; TCGA COAD -0.186; TCGA ESCA -0.466; TCGA HNSC -0.196; TCGA KIRC -0.241; TCGA KIRP -0.15; TCGA LGG -0.268; TCGA LIHC -0.467; TCGA LUAD -0.205; TCGA LUSC -0.456; TCGA OV -0.141; TCGA PAAD -0.257; TCGA PRAD -0.156; TCGA SARC -0.247; TCGA THCA -0.133; TCGA STAD -0.25; TCGA UCEC -0.197 |
hsa-miR-29c-3p | PRKRA | 10 cancers: BLCA; BRCA; COAD; ESCA; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.081; TCGA BRCA -0.052; TCGA COAD -0.121; TCGA ESCA -0.077; TCGA LUSC -0.119; TCGA OV -0.079; TCGA PAAD -0.113; TCGA PRAD -0.056; TCGA STAD -0.085; TCGA UCEC -0.074 |
hsa-miR-29c-3p | BLMH | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.154; TCGA BRCA -0.06; TCGA CESC -0.088; TCGA COAD -0.118; TCGA ESCA -0.151; TCGA KIRC -0.078; TCGA KIRP -0.224; TCGA LGG -0.154; TCGA LIHC -0.368; TCGA LUAD -0.109; TCGA LUSC -0.138; TCGA OV -0.109; TCGA PRAD -0.155; TCGA SARC -0.098; TCGA STAD -0.183; TCGA UCEC -0.154 |
hsa-miR-29c-3p | NAV1 | 14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.31; TCGA BRCA -0.077; TCGA ESCA -0.302; TCGA HNSC -0.17; TCGA KIRC -0.31; TCGA LGG -0.118; TCGA LUAD -0.092; TCGA LUSC -0.215; TCGA OV -0.125; TCGA PAAD -0.209; TCGA SARC -0.275; TCGA THCA -0.167; TCGA STAD -0.145; TCGA UCEC -0.188 |
hsa-miR-29c-3p | COL11A1 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.786; TCGA BRCA -0.777; TCGA CESC -0.777; TCGA ESCA -1.636; TCGA HNSC -0.888; TCGA KIRC -0.919; TCGA LIHC -0.294; TCGA LUAD -0.371; TCGA LUSC -0.779; TCGA PAAD -1.804; TCGA PRAD -0.434; TCGA SARC -0.762; TCGA THCA -1.069; TCGA STAD -1.661; TCGA UCEC -0.417 |
hsa-miR-29c-3p | TUBB2A | 11 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.567; TCGA BRCA -0.126; TCGA CESC -0.171; TCGA HNSC -0.199; TCGA LIHC -0.201; TCGA LUAD -0.17; TCGA LUSC -0.251; TCGA OV -0.313; TCGA SARC -0.23; TCGA THCA -0.176; TCGA UCEC -0.359 |
hsa-miR-29c-3p | CTDSPL2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.1; TCGA BRCA -0.09; TCGA CESC -0.074; TCGA COAD -0.097; TCGA ESCA -0.135; TCGA KIRC -0.165; TCGA LGG -0.112; TCGA LIHC -0.124; TCGA LUAD -0.064; TCGA LUSC -0.102; TCGA PAAD -0.092; TCGA PRAD -0.083; TCGA SARC -0.092; TCGA STAD -0.197 |
hsa-miR-29c-3p | NANP | 10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUSC; OV; SARC; STAD | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.133; TCGA COAD -0.117; TCGA ESCA -0.095; TCGA LGG -0.064; TCGA LIHC -0.116; TCGA LUSC -0.146; TCGA OV -0.086; TCGA SARC -0.145; TCGA STAD -0.262 |
hsa-miR-29c-3p | CAV2 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.356; TCGA BRCA -0.166; TCGA ESCA -0.289; TCGA HNSC -0.227; TCGA KIRC -0.328; TCGA KIRP -0.412; TCGA PAAD -0.344; TCGA PRAD -0.182; TCGA THCA -0.167; TCGA STAD -0.149 |
hsa-miR-29c-3p | PGM3 | 14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.115; TCGA BRCA -0.185; TCGA CESC -0.152; TCGA HNSC -0.097; TCGA KIRC -0.135; TCGA LGG -0.107; TCGA LUAD -0.118; TCGA LUSC -0.148; TCGA OV -0.057; TCGA PAAD -0.134; TCGA SARC -0.309; TCGA THCA -0.072; TCGA STAD -0.084; TCGA UCEC -0.067 |
hsa-miR-29c-3p | TBC1D7 | 11 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; THCA; UCEC | MirTarget | TCGA BLCA -0.075; TCGA BRCA -0.22; TCGA ESCA -0.154; TCGA HNSC -0.1; TCGA LGG -0.096; TCGA LIHC -0.174; TCGA LUAD -0.126; TCGA LUSC -0.227; TCGA OV -0.094; TCGA THCA -0.14; TCGA UCEC -0.212 |
hsa-miR-29c-3p | PTHLH | 9 cancers: BLCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC | MirTarget | TCGA BLCA -1.004; TCGA ESCA -0.663; TCGA HNSC -0.728; TCGA KIRC -0.86; TCGA LIHC -0.549; TCGA LUAD -0.173; TCGA LUSC -0.972; TCGA PAAD -0.687; TCGA SARC -0.32 |
hsa-miR-29c-3p | EIF4E2 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; OV; PAAD; UCEC | MirTarget | TCGA BLCA -0.085; TCGA BRCA -0.053; TCGA COAD -0.051; TCGA ESCA -0.056; TCGA HNSC -0.075; TCGA LIHC -0.09; TCGA OV -0.08; TCGA PAAD -0.075; TCGA UCEC -0.071 |
hsa-miR-29c-3p | SOX12 | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.169; TCGA CESC -0.152; TCGA ESCA -0.246; TCGA HNSC -0.183; TCGA KIRP -0.135; TCGA LGG -0.256; TCGA LIHC -0.519; TCGA LUSC -0.316; TCGA SARC -0.106; TCGA STAD -0.252; TCGA UCEC -0.169 |
hsa-miR-29c-3p | FOXN2 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; STAD | MirTarget | TCGA BLCA -0.067; TCGA BRCA -0.152; TCGA COAD -0.115; TCGA ESCA -0.146; TCGA HNSC -0.055; TCGA KIRC -0.171; TCGA LGG -0.085; TCGA LUAD -0.057; TCGA PRAD -0.131; TCGA STAD -0.166 |
hsa-miR-29c-3p | CHSY1 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; OV; PAAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.162; TCGA BRCA -0.138; TCGA CESC -0.105; TCGA ESCA -0.105; TCGA HNSC -0.084; TCGA KIRC -0.21; TCGA OV -0.098; TCGA PAAD -0.331; TCGA SARC -0.273; TCGA STAD -0.203; TCGA UCEC -0.093 |
hsa-miR-29c-3p | COL5A2 | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.609; TCGA BRCA -0.4; TCGA CESC -0.169; TCGA ESCA -0.525; TCGA HNSC -0.55; TCGA KIRC -0.691; TCGA LIHC -0.363; TCGA LUAD -0.129; TCGA LUSC -0.227; TCGA PAAD -0.948; TCGA PRAD -0.358; TCGA SARC -0.492; TCGA THCA -0.356; TCGA STAD -0.54 |
hsa-miR-29c-3p | NOTCH2 | 10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.239; TCGA BRCA -0.207; TCGA KIRC -0.194; TCGA KIRP -0.193; TCGA LGG -0.085; TCGA LUAD -0.064; TCGA PAAD -0.281; TCGA SARC -0.15; TCGA THCA -0.149; TCGA STAD -0.148 |
hsa-miR-29c-3p | SH3PXD2A | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.197; TCGA ESCA -0.113; TCGA HNSC -0.056; TCGA KIRC -0.272; TCGA LIHC -0.205; TCGA PAAD -0.391; TCGA PRAD -0.309; TCGA SARC -0.294; TCGA THCA -0.122; TCGA STAD -0.219 |
hsa-miR-29c-3p | TMEM65 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.349; TCGA BRCA -0.318; TCGA CESC -0.096; TCGA COAD -0.122; TCGA ESCA -0.254; TCGA HNSC -0.102; TCGA KIRC -0.146; TCGA LIHC -0.303; TCGA LUAD -0.159; TCGA LUSC -0.173; TCGA PRAD -0.132; TCGA SARC -0.274; TCGA STAD -0.21; TCGA UCEC -0.09 |
hsa-miR-29c-3p | ADAMTS7 | 17 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.137; TCGA BRCA -0.301; TCGA CESC -0.353; TCGA ESCA -0.188; TCGA HNSC -0.373; TCGA KIRC -0.324; TCGA KIRP -0.37; TCGA LGG -0.27; TCGA LIHC -0.137; TCGA LUAD -0.169; TCGA OV -0.232; TCGA PAAD -0.718; TCGA PRAD -0.288; TCGA SARC -0.293; TCGA THCA -0.237; TCGA STAD -0.251; TCGA UCEC -0.53 |
hsa-miR-29c-3p | GPX7 | 11 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; OV; PAAD; PRAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.239; TCGA BRCA -0.322; TCGA KIRC -0.236; TCGA KIRP -0.205; TCGA LGG -0.177; TCGA LIHC -0.362; TCGA OV -0.29; TCGA PAAD -0.293; TCGA PRAD -0.196; TCGA SARC -0.37; TCGA UCEC -0.241 |
hsa-miR-29c-3p | SLC7A6 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; PRAD; STAD | MirTarget | TCGA BLCA -0.07; TCGA BRCA -0.07; TCGA CESC -0.077; TCGA ESCA -0.082; TCGA HNSC -0.085; TCGA KIRP -0.143; TCGA LGG -0.079; TCGA LIHC -0.131; TCGA PRAD -0.062; TCGA STAD -0.198 |
hsa-miR-29c-3p | SFPQ | 11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.053; TCGA BRCA -0.098; TCGA COAD -0.074; TCGA ESCA -0.161; TCGA LGG -0.122; TCGA LIHC -0.12; TCGA LUAD -0.052; TCGA LUSC -0.148; TCGA SARC -0.115; TCGA STAD -0.14; TCGA UCEC -0.111 |
hsa-miR-29c-3p | ADAMTS2 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.651; TCGA BRCA -0.393; TCGA ESCA -0.385; TCGA HNSC -0.325; TCGA KIRC -0.423; TCGA LUAD -0.121; TCGA PAAD -0.579; TCGA PRAD -0.393; TCGA SARC -0.525; TCGA THCA -0.282; TCGA STAD -0.577 |
hsa-miR-29c-3p | JOSD1 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC | MirTarget; miRNATAP | TCGA BLCA -0.07; TCGA BRCA -0.154; TCGA ESCA -0.133; TCGA HNSC -0.076; TCGA KIRC -0.125; TCGA LIHC -0.056; TCGA LUAD -0.081; TCGA LUSC -0.06; TCGA PAAD -0.16; TCGA SARC -0.051 |
hsa-miR-29c-3p | HDAC4 | 11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LIHC; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.203; TCGA BRCA -0.07; TCGA CESC -0.116; TCGA ESCA -0.131; TCGA LGG -0.09; TCGA LIHC -0.226; TCGA LUSC -0.086; TCGA OV -0.085; TCGA PRAD -0.164; TCGA STAD -0.176; TCGA UCEC -0.107 |
hsa-miR-29c-3p | SMS | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD | MirTarget | TCGA BLCA -0.217; TCGA BRCA -0.116; TCGA CESC -0.082; TCGA ESCA -0.206; TCGA HNSC -0.177; TCGA LIHC -0.103; TCGA LUAD -0.078; TCGA LUSC -0.229; TCGA PAAD -0.175; TCGA STAD -0.188 |
hsa-miR-29c-3p | NASP | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.143; TCGA BRCA -0.162; TCGA COAD -0.085; TCGA ESCA -0.153; TCGA KIRP -0.18; TCGA LGG -0.174; TCGA LIHC -0.232; TCGA LUAD -0.089; TCGA LUSC -0.172; TCGA STAD -0.182; TCGA UCEC -0.094 |
hsa-miR-29c-3p | ITGB1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.214; TCGA BRCA -0.247; TCGA CESC -0.181; TCGA COAD -0.075; TCGA ESCA -0.178; TCGA HNSC -0.184; TCGA KIRC -0.251; TCGA KIRP -0.072; TCGA LUAD -0.106; TCGA PAAD -0.457; TCGA PRAD -0.143; TCGA THCA -0.175; TCGA STAD -0.306; TCGA UCEC -0.074 |
hsa-miR-29c-3p | SLC25A15 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.149; TCGA BRCA -0.074; TCGA CESC -0.183; TCGA COAD -0.122; TCGA ESCA -0.175; TCGA LGG -0.146; TCGA LUAD -0.063; TCGA LUSC -0.181; TCGA OV -0.149; TCGA PRAD -0.14; TCGA SARC -0.286; TCGA UCEC -0.165 |
hsa-miR-29c-3p | COMMD2 | 15 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.192; TCGA BRCA -0.203; TCGA COAD -0.099; TCGA ESCA -0.169; TCGA KIRC -0.132; TCGA KIRP -0.192; TCGA LGG -0.121; TCGA LIHC -0.214; TCGA LUAD -0.08; TCGA LUSC -0.094; TCGA OV -0.106; TCGA PAAD -0.157; TCGA PRAD -0.141; TCGA SARC -0.083; TCGA STAD -0.129 |
hsa-miR-29c-3p | USP37 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; STAD | MirTarget; miRNATAP | TCGA BLCA -0.133; TCGA BRCA -0.074; TCGA COAD -0.139; TCGA ESCA -0.093; TCGA KIRC -0.135; TCGA LGG -0.058; TCGA LIHC -0.237; TCGA LUAD -0.067; TCGA LUSC -0.1; TCGA OV -0.062; TCGA STAD -0.193 |
hsa-miR-29c-3p | DSC2 | 11 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.749; TCGA BRCA -0.555; TCGA ESCA -0.297; TCGA LIHC -0.306; TCGA LUAD -0.192; TCGA LUSC -0.321; TCGA PAAD -0.303; TCGA PRAD -0.258; TCGA SARC -0.149; TCGA THCA -0.429; TCGA UCEC -0.369 |
hsa-miR-29c-3p | MAPRE1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD | MirTarget | TCGA BLCA -0.066; TCGA BRCA -0.13; TCGA CESC -0.053; TCGA COAD -0.1; TCGA ESCA -0.145; TCGA HNSC -0.068; TCGA KIRC -0.056; TCGA LGG -0.138; TCGA LIHC -0.24; TCGA LUAD -0.067; TCGA LUSC -0.117; TCGA OV -0.084; TCGA PRAD -0.062; TCGA STAD -0.172 |
hsa-miR-29c-3p | NUP160 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.179; TCGA BRCA -0.239; TCGA CESC -0.113; TCGA COAD -0.132; TCGA ESCA -0.146; TCGA KIRC -0.165; TCGA KIRP -0.112; TCGA LGG -0.175; TCGA LIHC -0.143; TCGA LUAD -0.096; TCGA LUSC -0.097; TCGA OV -0.086; TCGA PAAD -0.102; TCGA PRAD -0.155; TCGA SARC -0.161; TCGA STAD -0.215; TCGA UCEC -0.106 |
hsa-miR-29c-3p | MAFG | 9 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.168; TCGA BRCA -0.052; TCGA ESCA -0.149; TCGA LIHC -0.19; TCGA LUAD -0.111; TCGA LUSC -0.166; TCGA PAAD -0.108; TCGA PRAD -0.142; TCGA STAD -0.154 |
hsa-miR-29c-3p | ADAMTS6 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; PAAD; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.508; TCGA BRCA -0.185; TCGA CESC -0.221; TCGA HNSC -0.348; TCGA KIRC -0.367; TCGA LGG -0.352; TCGA LIHC -0.404; TCGA PAAD -0.477; TCGA PRAD -0.226; TCGA STAD -0.342 |
hsa-miR-29c-3p | KLHDC3 | 9 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; OV; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.077; TCGA BRCA -0.123; TCGA HNSC -0.05; TCGA LIHC -0.151; TCGA LUAD -0.083; TCGA LUSC -0.097; TCGA OV -0.118; TCGA SARC -0.121; TCGA UCEC -0.086 |
hsa-miR-29c-3p | RASAL2 | 11 cancers: BLCA; BRCA; KIRC; LIHC; LUAD; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.215; TCGA BRCA -0.232; TCGA KIRC -0.187; TCGA LIHC -0.102; TCGA LUAD -0.123; TCGA OV -0.056; TCGA PAAD -0.355; TCGA SARC -0.089; TCGA THCA -0.161; TCGA STAD -0.313; TCGA UCEC -0.074 |
hsa-miR-29c-3p | B3GNT5 | 13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | MirTarget | TCGA BLCA -0.134; TCGA BRCA -0.497; TCGA ESCA -0.361; TCGA HNSC -0.1; TCGA KIRC -0.357; TCGA KIRP -0.095; TCGA LIHC -0.198; TCGA LUAD -0.196; TCGA LUSC -0.187; TCGA OV -0.212; TCGA PAAD -0.401; TCGA PRAD -0.361; TCGA SARC -0.333 |
hsa-miR-29c-3p | WISP1 | 9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.606; TCGA BRCA -0.312; TCGA ESCA -0.526; TCGA HNSC -0.281; TCGA KIRC -0.277; TCGA PAAD -0.849; TCGA SARC -0.394; TCGA THCA -0.339; TCGA STAD -0.464 |
hsa-miR-29c-3p | LIMS1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; PAAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.205; TCGA BRCA -0.312; TCGA CESC -0.221; TCGA COAD -0.091; TCGA ESCA -0.096; TCGA KIRC -0.246; TCGA LUAD -0.093; TCGA PAAD -0.448; TCGA SARC -0.202; TCGA STAD -0.195 |
hsa-miR-29c-3p | COL2A1 | 10 cancers: BLCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.464; TCGA CESC -0.607; TCGA HNSC -0.601; TCGA LIHC -1.279; TCGA LUAD -0.466; TCGA LUSC -0.503; TCGA OV -0.771; TCGA PRAD -1.111; TCGA SARC -0.748; TCGA UCEC -0.334 |
hsa-miR-29c-3p | WASF1 | 16 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.339; TCGA BRCA -0.373; TCGA CESC -0.194; TCGA ESCA -0.306; TCGA KIRC -0.18; TCGA KIRP -0.222; TCGA LIHC -0.372; TCGA LUAD -0.263; TCGA LUSC -0.502; TCGA OV -0.216; TCGA PAAD -0.231; TCGA PRAD -0.196; TCGA SARC -0.121; TCGA THCA -0.187; TCGA STAD -0.349; TCGA UCEC -0.248 |
hsa-miR-29c-3p | GXYLT2 | 12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.775; TCGA BRCA -0.46; TCGA CESC -0.3; TCGA HNSC -0.191; TCGA KIRC -0.6; TCGA LIHC -0.34; TCGA OV -0.099; TCGA PAAD -0.649; TCGA PRAD -0.311; TCGA SARC -0.267; TCGA THCA -0.115; TCGA STAD -0.35 |
hsa-miR-29c-3p | ZFP91 | 9 cancers: BLCA; BRCA; CESC; ESCA; LUSC; PAAD; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.109; TCGA BRCA -0.121; TCGA CESC -0.055; TCGA ESCA -0.103; TCGA LUSC -0.07; TCGA PAAD -0.104; TCGA PRAD -0.088; TCGA THCA -0.095; TCGA STAD -0.103 |
hsa-miR-29c-3p | HMCN1 | 10 cancers: BLCA; BRCA; KIRC; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.384; TCGA BRCA -0.372; TCGA KIRC -0.392; TCGA LGG -0.151; TCGA PAAD -0.675; TCGA PRAD -0.443; TCGA SARC -0.694; TCGA THCA -0.198; TCGA STAD -0.217; TCGA UCEC -0.29 |
hsa-miR-29c-3p | ASAP2 | 11 cancers: BLCA; BRCA; CESC; HNSC; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.129; TCGA BRCA -0.133; TCGA CESC -0.132; TCGA HNSC -0.087; TCGA LUSC -0.099; TCGA OV -0.081; TCGA PAAD -0.339; TCGA PRAD -0.214; TCGA THCA -0.221; TCGA STAD -0.088; TCGA UCEC -0.088 |
hsa-miR-29c-3p | TAF11 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.096; TCGA BRCA -0.193; TCGA CESC -0.072; TCGA COAD -0.064; TCGA ESCA -0.074; TCGA HNSC -0.067; TCGA KIRC -0.084; TCGA KIRP -0.116; TCGA LGG -0.084; TCGA LIHC -0.207; TCGA LUAD -0.086; TCGA LUSC -0.113; TCGA OV -0.112; TCGA PAAD -0.08; TCGA PRAD -0.064; TCGA SARC -0.09; TCGA STAD -0.117; TCGA UCEC -0.1 |
hsa-miR-29c-3p | PXDN | 17 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.493; TCGA BRCA -0.389; TCGA CESC -0.356; TCGA ESCA -0.311; TCGA HNSC -0.373; TCGA KIRC -0.479; TCGA KIRP -0.608; TCGA LGG -0.311; TCGA LUAD -0.248; TCGA LUSC -0.15; TCGA OV -0.151; TCGA PAAD -0.685; TCGA PRAD -0.412; TCGA SARC -0.378; TCGA THCA -0.368; TCGA STAD -0.292; TCGA UCEC -0.22 |
hsa-miR-29c-3p | SCML2 | 10 cancers: BLCA; BRCA; COAD; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC | MirTarget; miRNATAP | TCGA BLCA -0.632; TCGA BRCA -0.306; TCGA COAD -0.259; TCGA LGG -0.218; TCGA LIHC -0.445; TCGA LUAD -0.263; TCGA LUSC -0.332; TCGA OV -0.19; TCGA PRAD -0.111; TCGA SARC -0.171 |
hsa-miR-29c-3p | RND3 | 12 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.171; TCGA BRCA -0.156; TCGA KIRC -0.316; TCGA KIRP -0.171; TCGA LGG -0.094; TCGA LUAD -0.111; TCGA LUSC -0.132; TCGA PAAD -0.352; TCGA SARC -0.224; TCGA THCA -0.24; TCGA STAD -0.188; TCGA UCEC -0.116 |
hsa-miR-29c-3p | CAND1 | 13 cancers: BLCA; BRCA; CESC; COAD; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.1; TCGA BRCA -0.165; TCGA CESC -0.084; TCGA COAD -0.058; TCGA LIHC -0.068; TCGA LUAD -0.054; TCGA LUSC -0.155; TCGA PAAD -0.115; TCGA PRAD -0.13; TCGA SARC -0.157; TCGA THCA -0.241; TCGA STAD -0.17; TCGA UCEC -0.051 |
hsa-miR-29c-3p | THBS2 | 12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.227; TCGA BRCA -0.432; TCGA ESCA -0.508; TCGA HNSC -0.383; TCGA KIRC -0.583; TCGA KIRP -0.294; TCGA LUSC -0.178; TCGA PAAD -1.005; TCGA PRAD -0.5; TCGA SARC -0.275; TCGA THCA -0.243; TCGA STAD -0.731 |
hsa-miR-29c-3p | CD276 | 18 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.202; TCGA BRCA -0.237; TCGA CESC -0.125; TCGA ESCA -0.357; TCGA HNSC -0.34; TCGA KIRC -0.249; TCGA KIRP -0.226; TCGA LGG -0.19; TCGA LIHC -0.169; TCGA LUAD -0.135; TCGA LUSC -0.207; TCGA OV -0.11; TCGA PAAD -0.482; TCGA PRAD -0.342; TCGA SARC -0.29; TCGA THCA -0.298; TCGA STAD -0.237; TCGA UCEC -0.205 |
hsa-miR-29c-3p | KCTD20 | 10 cancers: BLCA; BRCA; CESC; KIRC; LGG; LUAD; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.13; TCGA BRCA -0.242; TCGA CESC -0.103; TCGA KIRC -0.174; TCGA LGG -0.101; TCGA LUAD -0.086; TCGA PAAD -0.222; TCGA SARC -0.162; TCGA THCA -0.092; TCGA STAD -0.156 |
hsa-miR-29c-3p | TUBB2B | 9 cancers: BLCA; BRCA; CESC; LGG; LIHC; LUSC; OV; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.55; TCGA BRCA -0.193; TCGA CESC -0.273; TCGA LGG -0.099; TCGA LIHC -0.338; TCGA LUSC -0.312; TCGA OV -0.764; TCGA SARC -0.38; TCGA UCEC -0.513 |
hsa-miR-29c-3p | METAP2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.111; TCGA BRCA -0.103; TCGA CESC -0.055; TCGA COAD -0.12; TCGA ESCA -0.168; TCGA HNSC -0.059; TCGA KIRC -0.081; TCGA LGG -0.076; TCGA LIHC -0.053; TCGA LUAD -0.052; TCGA LUSC -0.084; TCGA PRAD -0.07; TCGA STAD -0.071; TCGA UCEC -0.052 |
hsa-miR-29c-3p | GLIS2 | 12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.342; TCGA BRCA -0.075; TCGA CESC -0.156; TCGA HNSC -0.144; TCGA KIRP -0.281; TCGA LGG -0.222; TCGA LIHC -0.281; TCGA LUAD -0.077; TCGA PAAD -0.363; TCGA PRAD -0.223; TCGA THCA -0.194; TCGA STAD -0.202 |
hsa-miR-29c-3p | SLC16A1 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; THCA | MirTarget; miRNATAP | TCGA BLCA -1.005; TCGA BRCA -0.446; TCGA ESCA -0.366; TCGA HNSC -0.306; TCGA KIRC -0.229; TCGA LGG -0.074; TCGA LUAD -0.196; TCGA LUSC -0.473; TCGA OV -0.113; TCGA PAAD -0.362; TCGA THCA -0.236 |
hsa-miR-29c-3p | AGPAT4 | 12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.318; TCGA BRCA -0.342; TCGA CESC -0.237; TCGA HNSC -0.32; TCGA KIRP -0.359; TCGA LIHC -0.37; TCGA OV -0.123; TCGA PAAD -0.172; TCGA PRAD -0.178; TCGA SARC -0.223; TCGA STAD -0.124; TCGA UCEC -0.162 |
hsa-miR-29c-3p | LDOC1L | 10 cancers: BLCA; BRCA; CESC; LGG; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.142; TCGA BRCA -0.067; TCGA CESC -0.225; TCGA LGG -0.052; TCGA LUSC -0.09; TCGA OV -0.067; TCGA PRAD -0.158; TCGA SARC -0.134; TCGA STAD -0.103; TCGA UCEC -0.13 |
hsa-miR-29c-3p | CREB5 | 11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.377; TCGA BRCA -0.299; TCGA HNSC -0.088; TCGA KIRC -0.223; TCGA KIRP -0.984; TCGA OV -0.114; TCGA PRAD -0.17; TCGA SARC -0.364; TCGA THCA -0.486; TCGA STAD -0.223; TCGA UCEC -0.176 |
hsa-miR-29c-3p | COL5A1 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.571; TCGA BRCA -0.349; TCGA CESC -0.256; TCGA ESCA -0.536; TCGA HNSC -0.569; TCGA KIRC -0.696; TCGA LUSC -0.212; TCGA PAAD -0.937; TCGA PRAD -0.329; TCGA SARC -0.62; TCGA THCA -0.466; TCGA STAD -0.478 |
hsa-miR-29c-3p | FBXW9 | 10 cancers: BLCA; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; UCEC | MirTarget | TCGA BLCA -0.055; TCGA ESCA -0.113; TCGA KIRP -0.222; TCGA LGG -0.078; TCGA LIHC -0.237; TCGA LUAD -0.078; TCGA LUSC -0.104; TCGA OV -0.11; TCGA SARC -0.086; TCGA UCEC -0.167 |
hsa-miR-29c-3p | PDGFB | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; PAAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.136; TCGA CESC -0.222; TCGA ESCA -0.126; TCGA HNSC -0.165; TCGA KIRC -0.156; TCGA LUAD -0.161; TCGA PAAD -0.231; TCGA THCA -0.082; TCGA STAD -0.269 |
hsa-miR-29c-3p | TET1 | 12 cancers: BLCA; BRCA; CESC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.297; TCGA BRCA -0.412; TCGA CESC -0.231; TCGA KIRC -0.448; TCGA LGG -0.242; TCGA LIHC -0.761; TCGA LUAD -0.127; TCGA LUSC -0.342; TCGA OV -0.226; TCGA PAAD -0.192; TCGA SARC -0.41; TCGA UCEC -0.305 |
hsa-miR-29c-3p | USP13 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; OV; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.355; TCGA BRCA -0.129; TCGA CESC -0.184; TCGA COAD -0.137; TCGA ESCA -0.198; TCGA KIRC -0.137; TCGA LGG -0.08; TCGA LUAD -0.078; TCGA OV -0.104; TCGA PRAD -0.091; TCGA THCA -0.083; TCGA STAD -0.305 |
hsa-miR-29c-3p | NDST1 | 10 cancers: BLCA; CESC; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.222; TCGA CESC -0.091; TCGA KIRC -0.102; TCGA LIHC -0.167; TCGA LUAD -0.07; TCGA PRAD -0.101; TCGA SARC -0.135; TCGA THCA -0.168; TCGA STAD -0.102; TCGA UCEC -0.073 |
hsa-miR-29c-3p | MAPK1 | 10 cancers: BLCA; BRCA; CESC; KIRC; LIHC; LUAD; LUSC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.087; TCGA BRCA -0.108; TCGA CESC -0.122; TCGA KIRC -0.118; TCGA LIHC -0.059; TCGA LUAD -0.074; TCGA LUSC -0.065; TCGA THCA -0.164; TCGA STAD -0.094; TCGA UCEC -0.065 |
hsa-miR-29c-3p | NCS1 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD | mirMAP | TCGA BLCA -0.326; TCGA BRCA -0.353; TCGA ESCA -0.375; TCGA HNSC -0.175; TCGA LIHC -0.158; TCGA LUAD -0.162; TCGA LUSC -0.281; TCGA PAAD -0.272; TCGA PRAD -0.275 |
hsa-miR-29c-3p | CBL | 9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUAD; THCA; STAD | mirMAP | TCGA BLCA -0.108; TCGA BRCA -0.127; TCGA CESC -0.123; TCGA ESCA -0.077; TCGA KIRC -0.151; TCGA LIHC -0.109; TCGA LUAD -0.081; TCGA THCA -0.167; TCGA STAD -0.17 |
hsa-miR-29c-3p | TFDP2 | 9 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUSC; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.063; TCGA BRCA -0.132; TCGA COAD -0.113; TCGA ESCA -0.125; TCGA LGG -0.093; TCGA LUSC -0.27; TCGA PRAD -0.082; TCGA THCA -0.058; TCGA STAD -0.144 |
hsa-miR-29c-3p | VAPB | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; OV; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.061; TCGA BRCA -0.079; TCGA CESC -0.06; TCGA ESCA -0.126; TCGA HNSC -0.066; TCGA LUSC -0.123; TCGA OV -0.071; TCGA PRAD -0.056; TCGA SARC -0.087; TCGA STAD -0.127 |
hsa-miR-29c-3p | RAB22A | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.055; TCGA BRCA -0.082; TCGA ESCA -0.12; TCGA HNSC -0.112; TCGA KIRP -0.076; TCGA LUSC -0.106; TCGA PAAD -0.084; TCGA SARC -0.143; TCGA THCA -0.08; TCGA STAD -0.156 |
hsa-miR-29c-3p | ACTN4 | 9 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.079; TCGA BRCA -0.099; TCGA ESCA -0.074; TCGA LIHC -0.125; TCGA LUAD -0.095; TCGA PAAD -0.297; TCGA PRAD -0.077; TCGA THCA -0.16; TCGA UCEC -0.056 |
hsa-miR-29c-3p | IGF1R | 9 cancers: BLCA; CESC; HNSC; LGG; LUSC; OV; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.157; TCGA CESC -0.185; TCGA HNSC -0.112; TCGA LGG -0.069; TCGA LUSC -0.192; TCGA OV -0.113; TCGA PAAD -0.172; TCGA THCA -0.109; TCGA STAD -0.221 |
hsa-miR-29c-3p | SLC16A3 | 13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.231; TCGA CESC -0.129; TCGA ESCA -0.184; TCGA HNSC -0.197; TCGA KIRC -0.397; TCGA KIRP -0.357; TCGA LIHC -0.231; TCGA LUAD -0.182; TCGA LUSC -0.105; TCGA PAAD -0.678; TCGA PRAD -0.202; TCGA THCA -0.173; TCGA STAD -0.181 |
hsa-miR-29c-3p | ABL2 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LIHC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.175; TCGA BRCA -0.116; TCGA ESCA -0.13; TCGA HNSC -0.189; TCGA KIRC -0.194; TCGA LGG -0.056; TCGA LIHC -0.1; TCGA PAAD -0.193; TCGA SARC -0.133; TCGA THCA -0.136; TCGA STAD -0.213 |
hsa-miR-29c-3p | NOL9 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.143; TCGA BRCA -0.139; TCGA CESC -0.136; TCGA ESCA -0.109; TCGA HNSC -0.066; TCGA KIRC -0.113; TCGA PRAD -0.088; TCGA SARC -0.162; TCGA THCA -0.09; TCGA STAD -0.186; TCGA UCEC -0.108 |
hsa-miR-29c-3p | DUSP7 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.228; TCGA BRCA -0.146; TCGA ESCA -0.295; TCGA HNSC -0.159; TCGA KIRC -0.165; TCGA LIHC -0.085; TCGA LUSC -0.133; TCGA PAAD -0.228; TCGA SARC -0.105; TCGA THCA -0.081; TCGA STAD -0.134 |
hsa-miR-29c-3p | FOXK1 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.133; TCGA BRCA -0.078; TCGA CESC -0.087; TCGA ESCA -0.189; TCGA HNSC -0.051; TCGA KIRC -0.102; TCGA KIRP -0.126; TCGA LGG -0.072; TCGA LIHC -0.329; TCGA LUAD -0.094; TCGA LUSC -0.161; TCGA PRAD -0.182; TCGA SARC -0.091; TCGA THCA -0.188; TCGA STAD -0.312 |
hsa-miR-29c-3p | TBC1D16 | 14 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.244; TCGA CESC -0.183; TCGA ESCA -0.098; TCGA HNSC -0.152; TCGA KIRC -0.179; TCGA LIHC -0.207; TCGA LUAD -0.145; TCGA LUSC -0.098; TCGA OV -0.106; TCGA PAAD -0.223; TCGA SARC -0.332; TCGA THCA -0.188; TCGA STAD -0.251; TCGA UCEC -0.128 |
hsa-miR-29c-3p | ATP2A2 | 11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.131; TCGA BRCA -0.134; TCGA ESCA -0.147; TCGA KIRC -0.1; TCGA KIRP -0.067; TCGA LUAD -0.061; TCGA LUSC -0.164; TCGA PAAD -0.137; TCGA PRAD -0.122; TCGA THCA -0.08; TCGA STAD -0.2 |
hsa-miR-29c-3p | NPLOC4 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.06; TCGA BRCA -0.054; TCGA ESCA -0.096; TCGA HNSC -0.067; TCGA KIRP -0.098; TCGA LIHC -0.116; TCGA LUAD -0.088; TCGA LUSC -0.114; TCGA SARC -0.055; TCGA STAD -0.091 |
hsa-miR-29c-3p | NAT8L | 9 cancers: BLCA; CESC; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.322; TCGA CESC -0.569; TCGA LIHC -0.394; TCGA LUAD -0.463; TCGA LUSC -0.471; TCGA OV -0.164; TCGA PRAD -0.617; TCGA THCA -0.362; TCGA UCEC -0.263 |
hsa-miR-29c-3p | NF2 | 11 cancers: BLCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.06; TCGA CESC -0.086; TCGA ESCA -0.108; TCGA KIRP -0.175; TCGA LIHC -0.158; TCGA LUAD -0.055; TCGA LUSC -0.1; TCGA SARC -0.096; TCGA THCA -0.153; TCGA STAD -0.112; TCGA UCEC -0.095 |
hsa-miR-29c-3p | TEAD1 | 10 cancers: BLCA; BRCA; CESC; KIRC; LGG; LUAD; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.19; TCGA BRCA -0.202; TCGA CESC -0.116; TCGA KIRC -0.11; TCGA LGG -0.122; TCGA LUAD -0.103; TCGA PAAD -0.27; TCGA PRAD -0.193; TCGA THCA -0.219; TCGA STAD -0.246 |
hsa-miR-29c-3p | C1QTNF6 | 18 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.172; TCGA BRCA -0.121; TCGA CESC -0.184; TCGA ESCA -0.479; TCGA HNSC -0.483; TCGA KIRC -0.534; TCGA KIRP -0.486; TCGA LGG -0.227; TCGA LIHC -0.366; TCGA LUAD -0.119; TCGA LUSC -0.332; TCGA OV -0.129; TCGA PAAD -0.592; TCGA PRAD -0.145; TCGA SARC -0.262; TCGA THCA -0.199; TCGA STAD -0.389; TCGA UCEC -0.205 |
hsa-miR-29c-3p | MAP4K4 | 18 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.385; TCGA BRCA -0.309; TCGA CESC -0.169; TCGA ESCA -0.202; TCGA HNSC -0.203; TCGA KIRC -0.259; TCGA KIRP -0.171; TCGA LGG -0.053; TCGA LIHC -0.199; TCGA LUAD -0.063; TCGA LUSC -0.091; TCGA OV -0.119; TCGA PAAD -0.274; TCGA PRAD -0.132; TCGA SARC -0.197; TCGA THCA -0.232; TCGA STAD -0.15; TCGA UCEC -0.156 |
hsa-miR-29c-3p | LOX | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.727; TCGA BRCA -0.501; TCGA ESCA -0.269; TCGA HNSC -0.205; TCGA KIRC -0.79; TCGA LUAD -0.134; TCGA PAAD -0.852; TCGA PRAD -0.392; TCGA SARC -0.442; TCGA THCA -0.493; TCGA STAD -0.322 |
hsa-miR-29c-3p | LRP6 | 10 cancers: BLCA; BRCA; CESC; COAD; LGG; OV; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.096; TCGA BRCA -0.209; TCGA CESC -0.165; TCGA COAD -0.117; TCGA LGG -0.111; TCGA OV -0.137; TCGA PRAD -0.086; TCGA SARC -0.129; TCGA STAD -0.207; TCGA UCEC -0.061 |
hsa-miR-29c-3p | MYBL2 | 16 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.372; TCGA BRCA -0.611; TCGA ESCA -0.472; TCGA HNSC -0.207; TCGA KIRC -0.638; TCGA KIRP -0.654; TCGA LGG -0.775; TCGA LIHC -1.342; TCGA LUAD -0.369; TCGA LUSC -0.703; TCGA OV -0.137; TCGA PAAD -0.319; TCGA PRAD -0.648; TCGA SARC -0.331; TCGA STAD -0.216; TCGA UCEC -0.488 |
hsa-miR-29c-3p | BRD3 | 12 cancers: BLCA; CESC; ESCA; KIRP; LGG; LIHC; LUSC; OV; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.085; TCGA CESC -0.1; TCGA ESCA -0.115; TCGA KIRP -0.114; TCGA LGG -0.143; TCGA LIHC -0.17; TCGA LUSC -0.11; TCGA OV -0.098; TCGA SARC -0.068; TCGA THCA -0.065; TCGA STAD -0.181; TCGA UCEC -0.142 |
hsa-miR-29c-3p | XPO5 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.167; TCGA BRCA -0.298; TCGA CESC -0.108; TCGA COAD -0.095; TCGA ESCA -0.176; TCGA HNSC -0.114; TCGA KIRP -0.23; TCGA LGG -0.169; TCGA LIHC -0.32; TCGA LUAD -0.134; TCGA LUSC -0.298; TCGA OV -0.065; TCGA SARC -0.194; TCGA THCA -0.154; TCGA STAD -0.344; TCGA UCEC -0.158 |
hsa-miR-29c-3p | SLC30A3 | 9 cancers: BLCA; ESCA; HNSC; LIHC; LUSC; OV; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.501; TCGA ESCA -0.563; TCGA HNSC -0.137; TCGA LIHC -0.423; TCGA LUSC -0.34; TCGA OV -0.445; TCGA PRAD -0.252; TCGA THCA -0.38; TCGA UCEC -0.206 |
hsa-miR-29c-3p | BCORL1 | 13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.215; TCGA CESC -0.196; TCGA ESCA -0.148; TCGA HNSC -0.096; TCGA KIRC -0.079; TCGA LIHC -0.326; TCGA LUAD -0.115; TCGA LUSC -0.151; TCGA PAAD -0.124; TCGA SARC -0.128; TCGA THCA -0.055; TCGA STAD -0.199; TCGA UCEC -0.136 |
hsa-miR-29c-3p | MEX3B | 15 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.435; TCGA BRCA -0.3; TCGA CESC -0.248; TCGA ESCA -0.253; TCGA KIRC -0.428; TCGA KIRP -0.286; TCGA LGG -0.295; TCGA LUAD -0.144; TCGA LUSC -0.318; TCGA OV -0.258; TCGA PAAD -0.475; TCGA PRAD -0.459; TCGA SARC -0.282; TCGA STAD -0.273; TCGA UCEC -0.227 |
hsa-miR-29c-3p | SYNCRIP | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.086; TCGA BRCA -0.219; TCGA CESC -0.11; TCGA COAD -0.056; TCGA ESCA -0.115; TCGA KIRC -0.06; TCGA LGG -0.113; TCGA LIHC -0.053; TCGA LUAD -0.058; TCGA LUSC -0.128; TCGA PAAD -0.094; TCGA PRAD -0.151; TCGA SARC -0.116; TCGA STAD -0.179; TCGA UCEC -0.065 |
hsa-miR-29c-3p | CBX5 | 12 cancers: BLCA; BRCA; CESC; KIRP; LGG; LIHC; LUSC; OV; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.193; TCGA BRCA -0.107; TCGA CESC -0.086; TCGA KIRP -0.162; TCGA LGG -0.111; TCGA LIHC -0.134; TCGA LUSC -0.072; TCGA OV -0.11; TCGA SARC -0.12; TCGA THCA -0.083; TCGA STAD -0.158; TCGA UCEC -0.121 |
hsa-miR-29c-3p | LSM11 | 13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.197; TCGA BRCA -0.124; TCGA CESC -0.06; TCGA COAD -0.083; TCGA KIRC -0.207; TCGA KIRP -0.191; TCGA LIHC -0.307; TCGA LUAD -0.071; TCGA LUSC -0.068; TCGA PAAD -0.149; TCGA PRAD -0.121; TCGA THCA -0.054; TCGA STAD -0.217 |
hsa-miR-29c-3p | ZNF469 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.513; TCGA BRCA -0.328; TCGA CESC -0.148; TCGA ESCA -0.528; TCGA HNSC -0.325; TCGA LUSC -0.131; TCGA PAAD -0.812; TCGA PRAD -0.26; TCGA SARC -0.563; TCGA THCA -0.365; TCGA STAD -0.426 |
hsa-miR-29c-3p | KPNA4 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.117; TCGA BRCA -0.177; TCGA COAD -0.08; TCGA ESCA -0.171; TCGA HNSC -0.052; TCGA LUAD -0.062; TCGA LUSC -0.166; TCGA OV -0.068; TCGA PAAD -0.16; TCGA PRAD -0.078; TCGA THCA -0.054; TCGA STAD -0.192 |
hsa-miR-29c-3p | ADAM12 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.541; TCGA BRCA -0.4; TCGA CESC -0.224; TCGA ESCA -0.759; TCGA HNSC -0.521; TCGA KIRC -0.769; TCGA LUAD -0.176; TCGA LUSC -0.404; TCGA PAAD -1.143; TCGA PRAD -0.259; TCGA SARC -0.85; TCGA THCA -0.413; TCGA STAD -0.613 |
hsa-miR-29c-3p | ATG9A | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.119; TCGA BRCA -0.07; TCGA CESC -0.052; TCGA ESCA -0.075; TCGA HNSC -0.089; TCGA KIRP -0.065; TCGA LIHC -0.078; TCGA LUAD -0.062; TCGA LUSC -0.08; TCGA THCA -0.092; TCGA STAD -0.115; TCGA UCEC -0.108 |
hsa-miR-29c-3p | E2F7 | 19 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.373; TCGA BRCA -0.418; TCGA CESC -0.144; TCGA COAD -0.173; TCGA ESCA -0.62; TCGA HNSC -0.118; TCGA KIRC -0.655; TCGA KIRP -0.423; TCGA LGG -0.319; TCGA LIHC -0.854; TCGA LUAD -0.247; TCGA LUSC -0.714; TCGA OV -0.127; TCGA PAAD -0.571; TCGA PRAD -0.333; TCGA SARC -0.217; TCGA THCA -0.349; TCGA STAD -0.496; TCGA UCEC -0.379 |
hsa-miR-29c-3p | ERC1 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.24; TCGA BRCA -0.202; TCGA CESC -0.127; TCGA HNSC -0.082; TCGA KIRC -0.123; TCGA LUAD -0.076; TCGA PRAD -0.083; TCGA THCA -0.111; TCGA UCEC -0.096 |
hsa-miR-29c-3p | SIKE1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.062; TCGA BRCA -0.137; TCGA CESC -0.062; TCGA COAD -0.075; TCGA ESCA -0.108; TCGA KIRC -0.061; TCGA LGG -0.077; TCGA LUAD -0.074; TCGA LUSC -0.098; TCGA OV -0.069; TCGA PAAD -0.076; TCGA PRAD -0.091; TCGA SARC -0.122; TCGA STAD -0.17; TCGA UCEC -0.074 |
hsa-miR-29c-3p | KIF26B | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.287; TCGA BRCA -0.303; TCGA CESC -0.197; TCGA ESCA -0.277; TCGA HNSC -0.402; TCGA LUSC -0.272; TCGA PAAD -0.673; TCGA PRAD -0.247; TCGA SARC -0.377; TCGA THCA -0.252; TCGA STAD -0.5; TCGA UCEC -0.421 |
hsa-miR-29c-3p | ELOVL4 | 10 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA | miRNATAP | TCGA BLCA -0.745; TCGA BRCA -0.356; TCGA CESC -0.295; TCGA HNSC -0.132; TCGA LIHC -0.306; TCGA LUAD -0.198; TCGA LUSC -0.432; TCGA OV -0.341; TCGA SARC -0.317; TCGA THCA -0.267 |
hsa-miR-29c-3p | USP42 | 11 cancers: BLCA; BRCA; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.057; TCGA BRCA -0.062; TCGA ESCA -0.09; TCGA KIRP -0.113; TCGA LGG -0.135; TCGA LIHC -0.071; TCGA LUAD -0.1; TCGA LUSC -0.128; TCGA SARC -0.157; TCGA STAD -0.135; TCGA UCEC -0.078 |
hsa-miR-29c-3p | SCHIP1 | 12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA | miRNATAP | TCGA BLCA -0.203; TCGA BRCA -0.233; TCGA ESCA -0.292; TCGA HNSC -0.089; TCGA KIRC -0.137; TCGA KIRP -0.62; TCGA LUAD -0.157; TCGA LUSC -0.089; TCGA OV -0.198; TCGA PAAD -0.238; TCGA PRAD -0.244; TCGA THCA -0.118 |
hsa-miR-29c-3p | TRIM37 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.141; TCGA BRCA -0.105; TCGA CESC -0.102; TCGA COAD -0.066; TCGA ESCA -0.159; TCGA KIRP -0.106; TCGA LIHC -0.163; TCGA LUAD -0.082; TCGA LUSC -0.11; TCGA PRAD -0.083; TCGA THCA -0.066; TCGA STAD -0.203; TCGA UCEC -0.082 |
hsa-miR-29c-3p | CAMKK2 | 9 cancers: BLCA; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.085; TCGA ESCA -0.077; TCGA KIRC -0.072; TCGA KIRP -0.169; TCGA LIHC -0.096; TCGA LUAD -0.072; TCGA PAAD -0.136; TCGA THCA -0.064; TCGA STAD -0.064 |
hsa-miR-29c-3p | CDK16 | 11 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.066; TCGA BRCA -0.141; TCGA ESCA -0.111; TCGA LIHC -0.269; TCGA LUAD -0.107; TCGA LUSC -0.193; TCGA PAAD -0.124; TCGA SARC -0.083; TCGA THCA -0.15; TCGA STAD -0.125; TCGA UCEC -0.092 |
hsa-miR-29c-3p | IMPDH1 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA | miRNATAP | TCGA BLCA -0.191; TCGA BRCA -0.065; TCGA ESCA -0.21; TCGA HNSC -0.27; TCGA KIRC -0.145; TCGA LIHC -0.165; TCGA LUAD -0.088; TCGA LUSC -0.146; TCGA PAAD -0.124; TCGA THCA -0.099 |
hsa-miR-29c-3p | NRAS | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.151; TCGA BRCA -0.211; TCGA CESC -0.109; TCGA COAD -0.065; TCGA ESCA -0.176; TCGA HNSC -0.087; TCGA KIRC -0.171; TCGA LGG -0.103; TCGA LIHC -0.195; TCGA LUAD -0.133; TCGA LUSC -0.104; TCGA OV -0.083; TCGA PAAD -0.165; TCGA SARC -0.237; TCGA THCA -0.068; TCGA STAD -0.099; TCGA UCEC -0.074 |
hsa-miR-29c-3p | MFAP2 | 16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.543; TCGA BRCA -0.426; TCGA CESC -0.294; TCGA ESCA -0.663; TCGA HNSC -0.607; TCGA KIRC -0.549; TCGA LGG -0.367; TCGA LIHC -0.679; TCGA LUAD -0.167; TCGA LUSC -0.312; TCGA OV -0.359; TCGA PAAD -0.876; TCGA PRAD -0.19; TCGA SARC -0.59; TCGA STAD -0.48; TCGA UCEC -0.575 |
hsa-miR-29c-3p | KDELC1 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.45; TCGA BRCA -0.302; TCGA CESC -0.198; TCGA COAD -0.15; TCGA ESCA -0.331; TCGA HNSC -0.271; TCGA KIRC -0.355; TCGA KIRP -0.662; TCGA LGG -0.255; TCGA LIHC -0.299; TCGA LUAD -0.176; TCGA LUSC -0.174; TCGA OV -0.207; TCGA PAAD -0.476; TCGA PRAD -0.347; TCGA SARC -0.259; TCGA STAD -0.34; TCGA UCEC -0.182 |
hsa-miR-29c-3p | OXTR | 11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.222; TCGA CESC -0.222; TCGA COAD -0.232; TCGA HNSC -0.117; TCGA KIRC -0.297; TCGA KIRP -0.638; TCGA LIHC -0.254; TCGA PAAD -0.527; TCGA PRAD -0.163; TCGA THCA -0.142; TCGA STAD -0.605 |
hsa-miR-29c-3p | ZNF532 | 13 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.326; TCGA BRCA -0.31; TCGA ESCA -0.218; TCGA KIRC -0.271; TCGA LGG -0.071; TCGA LIHC -0.208; TCGA LUAD -0.084; TCGA LUSC -0.148; TCGA PAAD -0.42; TCGA SARC -0.077; TCGA THCA -0.091; TCGA STAD -0.326; TCGA UCEC -0.096 |
hsa-miR-29c-3p | TNRC18 | 10 cancers: BLCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.051; TCGA CESC -0.126; TCGA ESCA -0.103; TCGA HNSC -0.067; TCGA LGG -0.173; TCGA LIHC -0.2; TCGA LUAD -0.065; TCGA LUSC -0.134; TCGA STAD -0.222; TCGA UCEC -0.123 |
hsa-miR-29c-3p | VCL | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.115; TCGA BRCA -0.225; TCGA CESC -0.106; TCGA HNSC -0.053; TCGA KIRC -0.193; TCGA LGG -0.066; TCGA LUAD -0.106; TCGA PAAD -0.388; TCGA PRAD -0.211; TCGA THCA -0.141; TCGA STAD -0.172 |
hsa-miR-29c-3p | SPSB4 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; OV; UCEC | miRNATAP | TCGA BLCA -0.69; TCGA BRCA -0.447; TCGA CESC -0.325; TCGA ESCA -0.35; TCGA HNSC -0.323; TCGA LGG -0.316; TCGA LUAD -0.168; TCGA OV -0.572; TCGA UCEC -0.332 |
hsa-miR-29c-3p | CBX2 | 15 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.337; TCGA BRCA -0.604; TCGA ESCA -0.581; TCGA HNSC -0.136; TCGA KIRC -0.435; TCGA LGG -0.441; TCGA LIHC -0.49; TCGA LUAD -0.246; TCGA LUSC -0.545; TCGA OV -0.363; TCGA PRAD -0.238; TCGA SARC -0.28; TCGA THCA -0.252; TCGA STAD -0.526; TCGA UCEC -0.392 |
hsa-miR-29c-3p | NCOR2 | 10 cancers: BLCA; ESCA; LGG; LIHC; LUAD; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.202; TCGA ESCA -0.071; TCGA LGG -0.145; TCGA LIHC -0.157; TCGA LUAD -0.08; TCGA PAAD -0.111; TCGA SARC -0.131; TCGA THCA -0.141; TCGA STAD -0.146; TCGA UCEC -0.087 |
hsa-miR-29c-3p | TAF5 | 10 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.134; TCGA BRCA -0.175; TCGA ESCA -0.109; TCGA LGG -0.112; TCGA LIHC -0.147; TCGA LUAD -0.081; TCGA LUSC -0.148; TCGA SARC -0.139; TCGA STAD -0.084; TCGA UCEC -0.09 |
hsa-miR-29c-3p | GMFB | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.125; TCGA BRCA -0.084; TCGA CESC -0.133; TCGA ESCA -0.13; TCGA HNSC -0.105; TCGA LUAD -0.058; TCGA PRAD -0.062; TCGA SARC -0.184; TCGA THCA -0.102; TCGA STAD -0.156 |
hsa-miR-29c-3p | GOPC | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; SARC | miRNATAP | TCGA BLCA -0.065; TCGA BRCA -0.146; TCGA CESC -0.102; TCGA COAD -0.051; TCGA ESCA -0.083; TCGA HNSC -0.062; TCGA KIRC -0.092; TCGA KIRP -0.054; TCGA LUSC -0.1; TCGA PAAD -0.156; TCGA SARC -0.137 |
hsa-miR-29c-3p | RCOR1 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.188; TCGA BRCA -0.125; TCGA CESC -0.108; TCGA ESCA -0.15; TCGA HNSC -0.092; TCGA KIRC -0.108; TCGA LGG -0.129; TCGA LUSC -0.085; TCGA PRAD -0.119; TCGA SARC -0.118; TCGA THCA -0.054; TCGA STAD -0.1; TCGA UCEC -0.08 |
hsa-miR-29c-3p | N4BP2 | 9 cancers: BLCA; BRCA; CESC; LGG; LUAD; OV; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.143; TCGA BRCA -0.155; TCGA CESC -0.223; TCGA LGG -0.156; TCGA LUAD -0.104; TCGA OV -0.118; TCGA SARC -0.342; TCGA STAD -0.122; TCGA UCEC -0.135 |
hsa-miR-29c-3p | SERPINH1 | 19 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.197; TCGA BRCA -0.358; TCGA CESC -0.182; TCGA COAD -0.083; TCGA ESCA -0.44; TCGA HNSC -0.434; TCGA KIRC -0.365; TCGA KIRP -0.229; TCGA LGG -0.199; TCGA LIHC -0.352; TCGA LUAD -0.094; TCGA LUSC -0.262; TCGA OV -0.14; TCGA PAAD -0.602; TCGA PRAD -0.245; TCGA SARC -0.363; TCGA THCA -0.174; TCGA STAD -0.363; TCGA UCEC -0.183 |
hsa-miR-29c-3p | TPM1 | 9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; THCA | miRNATAP | TCGA BLCA -0.364; TCGA BRCA -0.096; TCGA HNSC -0.178; TCGA KIRC -0.224; TCGA KIRP -0.229; TCGA LIHC -0.089; TCGA PAAD -0.455; TCGA PRAD -0.242; TCGA THCA -0.052 |
hsa-miR-29c-3p | DIP2B | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.176; TCGA BRCA -0.14; TCGA CESC -0.097; TCGA ESCA -0.222; TCGA HNSC -0.073; TCGA KIRC -0.143; TCGA KIRP -0.167; TCGA LIHC -0.093; TCGA LUAD -0.086; TCGA LUSC -0.232; TCGA PRAD -0.148; TCGA SARC -0.17; TCGA THCA -0.095; TCGA STAD -0.193; TCGA UCEC -0.099 |
hsa-miR-29c-3p | VPS25 | 12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; UCEC | miRNATAP | TCGA BLCA -0.086; TCGA COAD -0.064; TCGA HNSC -0.068; TCGA KIRC -0.061; TCGA KIRP -0.315; TCGA LGG -0.105; TCGA LIHC -0.127; TCGA LUAD -0.082; TCGA LUSC -0.152; TCGA OV -0.109; TCGA SARC -0.061; TCGA UCEC -0.052 |
hsa-miR-29c-3p | RRAS2 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC | miRNATAP | TCGA BLCA -0.246; TCGA BRCA -0.275; TCGA ESCA -0.231; TCGA HNSC -0.227; TCGA KIRP -0.124; TCGA LGG -0.106; TCGA LUAD -0.056; TCGA PAAD -0.144; TCGA PRAD -0.054; TCGA SARC -0.199 |
hsa-miR-29c-3p | ABL1 | 10 cancers: BLCA; BRCA; CESC; LGG; LIHC; OV; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.177; TCGA BRCA -0.071; TCGA CESC -0.07; TCGA LGG -0.148; TCGA LIHC -0.092; TCGA OV -0.087; TCGA PAAD -0.154; TCGA SARC -0.1; TCGA THCA -0.082; TCGA STAD -0.104 |
hsa-miR-29c-3p | SPNS1 | 12 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.059; TCGA ESCA -0.066; TCGA HNSC -0.143; TCGA KIRP -0.226; TCGA LGG -0.17; TCGA LIHC -0.17; TCGA LUAD -0.097; TCGA LUSC -0.081; TCGA OV -0.054; TCGA PAAD -0.12; TCGA SARC -0.086; TCGA UCEC -0.113 |
hsa-miR-29c-3p | MMP2 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; PAAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.26; TCGA BRCA -0.24; TCGA ESCA -0.201; TCGA HNSC -0.29; TCGA KIRC -0.223; TCGA LGG -0.262; TCGA PAAD -0.921; TCGA SARC -0.615; TCGA THCA -0.232; TCGA UCEC -0.167 |
hsa-miR-29c-3p | RALA | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.163; TCGA BRCA -0.151; TCGA CESC -0.051; TCGA COAD -0.071; TCGA ESCA -0.122; TCGA HNSC -0.05; TCGA KIRC -0.128; TCGA KIRP -0.141; TCGA LGG -0.082; TCGA LIHC -0.145; TCGA LUAD -0.102; TCGA PAAD -0.222; TCGA PRAD -0.053; TCGA SARC -0.211; TCGA THCA -0.091; TCGA UCEC -0.061 |
hsa-miR-29c-3p | SPRY4 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.102; TCGA BRCA -0.056; TCGA CESC -0.38; TCGA ESCA -0.143; TCGA HNSC -0.281; TCGA KIRC -0.368; TCGA PAAD -0.134; TCGA PRAD -0.316; TCGA SARC -0.35; TCGA THCA -0.108; TCGA STAD -0.227; TCGA UCEC -0.294 |
hsa-miR-29c-3p | NRBP1 | 14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.106; TCGA BRCA -0.136; TCGA ESCA -0.144; TCGA HNSC -0.063; TCGA KIRC -0.077; TCGA KIRP -0.13; TCGA LIHC -0.15; TCGA LUAD -0.106; TCGA LUSC -0.129; TCGA PAAD -0.154; TCGA PRAD -0.077; TCGA SARC -0.155; TCGA THCA -0.061; TCGA UCEC -0.078 |
hsa-miR-29c-3p | CSGALNACT2 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.189; TCGA BRCA -0.159; TCGA ESCA -0.126; TCGA HNSC -0.161; TCGA KIRC -0.163; TCGA LGG -0.07; TCGA PAAD -0.32; TCGA PRAD -0.087; TCGA SARC -0.129; TCGA STAD -0.161 |
hsa-miR-29c-3p | EPHB3 | 9 cancers: BLCA; BRCA; HNSC; LGG; LUSC; OV; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.404; TCGA BRCA -0.246; TCGA HNSC -0.148; TCGA LGG -0.21; TCGA LUSC -0.41; TCGA OV -0.164; TCGA SARC -0.568; TCGA THCA -0.539; TCGA UCEC -0.238 |
hsa-miR-29c-3p | SENP1 | 13 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.124; TCGA BRCA -0.128; TCGA ESCA -0.142; TCGA KIRC -0.143; TCGA LGG -0.127; TCGA LIHC -0.192; TCGA LUAD -0.097; TCGA LUSC -0.162; TCGA OV -0.069; TCGA PRAD -0.106; TCGA SARC -0.085; TCGA STAD -0.158; TCGA UCEC -0.061 |
hsa-miR-29c-3p | CBX1 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.194; TCGA BRCA -0.133; TCGA CESC -0.132; TCGA COAD -0.114; TCGA ESCA -0.259; TCGA HNSC -0.053; TCGA KIRC -0.08; TCGA KIRP -0.141; TCGA LGG -0.054; TCGA LIHC -0.298; TCGA LUAD -0.137; TCGA LUSC -0.245; TCGA OV -0.115; TCGA PAAD -0.12; TCGA PRAD -0.134; TCGA SARC -0.148; TCGA STAD -0.22; TCGA UCEC -0.131 |
hsa-miR-29c-3p | DNAJB11 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; SARC | miRNATAP | TCGA BLCA -0.132; TCGA BRCA -0.129; TCGA COAD -0.058; TCGA ESCA -0.146; TCGA HNSC -0.096; TCGA LGG -0.094; TCGA LIHC -0.162; TCGA LUSC -0.263; TCGA PAAD -0.145; TCGA SARC -0.091 |
hsa-miR-29c-3p | MAZ | 12 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.083; TCGA ESCA -0.208; TCGA HNSC -0.099; TCGA KIRP -0.209; TCGA LGG -0.139; TCGA LIHC -0.226; TCGA LUAD -0.075; TCGA LUSC -0.226; TCGA OV -0.08; TCGA SARC -0.113; TCGA STAD -0.087; TCGA UCEC -0.084 |
hsa-miR-29c-3p | BMP1 | 16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.397; TCGA BRCA -0.28; TCGA CESC -0.11; TCGA ESCA -0.325; TCGA HNSC -0.307; TCGA KIRC -0.389; TCGA KIRP -0.532; TCGA LGG -0.192; TCGA LUAD -0.103; TCGA LUSC -0.103; TCGA PAAD -0.579; TCGA PRAD -0.124; TCGA SARC -0.294; TCGA THCA -0.241; TCGA STAD -0.374; TCGA UCEC -0.139 |
hsa-miR-29c-3p | PDGFRB | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.359; TCGA BRCA -0.132; TCGA ESCA -0.207; TCGA HNSC -0.231; TCGA KIRC -0.359; TCGA LIHC -0.139; TCGA PAAD -0.491; TCGA PRAD -0.201; TCGA SARC -0.148; TCGA THCA -0.168; TCGA STAD -0.317 |
hsa-miR-29c-3p | EIF4A3 | 14 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | RAID | TCGA BLCA -0.116; TCGA BRCA -0.09; TCGA COAD -0.067; TCGA KIRC -0.084; TCGA KIRP -0.112; TCGA LGG -0.141; TCGA LIHC -0.151; TCGA LUAD -0.134; TCGA LUSC -0.168; TCGA PAAD -0.107; TCGA PRAD -0.089; TCGA SARC -0.114; TCGA STAD -0.136; TCGA UCEC -0.123 |
hsa-miR-29c-3p | FUS | 9 cancers: BLCA; COAD; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC | RAID | TCGA BLCA -0.067; TCGA COAD -0.063; TCGA LGG -0.119; TCGA LIHC -0.18; TCGA LUSC -0.127; TCGA PRAD -0.124; TCGA SARC -0.099; TCGA STAD -0.092; TCGA UCEC -0.094 |
hsa-miR-29c-3p | DCAF12 | 10 cancers: BRCA; CESC; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BRCA -0.096; TCGA CESC -0.064; TCGA LGG -0.158; TCGA LIHC -0.068; TCGA LUAD -0.056; TCGA LUSC -0.057; TCGA SARC -0.099; TCGA THCA -0.069; TCGA STAD -0.101; TCGA UCEC -0.071 |
hsa-miR-29c-3p | DNMT3A | 15 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.165; TCGA CESC -0.105; TCGA ESCA -0.101; TCGA KIRC -0.153; TCGA LGG -0.067; TCGA LIHC -0.529; TCGA LUAD -0.131; TCGA LUSC -0.231; TCGA OV -0.175; TCGA PAAD -0.104; TCGA PRAD -0.194; TCGA SARC -0.154; TCGA THCA -0.054; TCGA STAD -0.151; TCGA UCEC -0.255 |
hsa-miR-29c-3p | DNMT3B | 14 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.377; TCGA CESC -0.239; TCGA ESCA -0.544; TCGA HNSC -0.265; TCGA KIRC -0.172; TCGA KIRP -0.477; TCGA LGG -0.226; TCGA LIHC -0.562; TCGA LUAD -0.241; TCGA LUSC -0.526; TCGA PRAD -0.175; TCGA SARC -0.403; TCGA STAD -0.431; TCGA UCEC -0.286 |
hsa-miR-29c-3p | KDM5B | 15 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget | TCGA BRCA -0.173; TCGA CESC -0.136; TCGA ESCA -0.136; TCGA HNSC -0.143; TCGA KIRC -0.134; TCGA LGG -0.151; TCGA LIHC -0.121; TCGA LUSC -0.245; TCGA OV -0.081; TCGA PAAD -0.217; TCGA PRAD -0.131; TCGA SARC -0.255; TCGA THCA -0.099; TCGA STAD -0.143; TCGA UCEC -0.17 |
hsa-miR-29c-3p | TDG | 17 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BRCA -0.208; TCGA CESC -0.111; TCGA COAD -0.096; TCGA ESCA -0.205; TCGA HNSC -0.093; TCGA KIRC -0.126; TCGA KIRP -0.125; TCGA LGG -0.114; TCGA LIHC -0.202; TCGA LUAD -0.128; TCGA LUSC -0.205; TCGA OV -0.12; TCGA PAAD -0.094; TCGA PRAD -0.196; TCGA SARC -0.136; TCGA STAD -0.144; TCGA UCEC -0.152 |
hsa-miR-29c-3p | VEGFA | 13 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate; MirTarget | TCGA BRCA -0.126; TCGA CESC -0.265; TCGA COAD -0.106; TCGA HNSC -0.194; TCGA KIRC -0.285; TCGA LGG -0.163; TCGA LIHC -0.076; TCGA LUAD -0.19; TCGA LUSC -0.16; TCGA PAAD -0.181; TCGA SARC -0.123; TCGA STAD -0.219; TCGA UCEC -0.126 |
hsa-miR-29c-3p | WSB2 | 9 cancers: BRCA; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BRCA -0.108; TCGA KIRC -0.066; TCGA LIHC -0.122; TCGA LUAD -0.109; TCGA LUSC -0.109; TCGA PRAD -0.154; TCGA SARC -0.062; TCGA THCA -0.07; TCGA UCEC -0.087 |
hsa-miR-29c-3p | AMMECR1L | 15 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.099; TCGA CESC -0.072; TCGA COAD -0.062; TCGA ESCA -0.063; TCGA HNSC -0.059; TCGA KIRC -0.069; TCGA LGG -0.141; TCGA LIHC -0.073; TCGA LUAD -0.057; TCGA LUSC -0.109; TCGA PAAD -0.121; TCGA PRAD -0.052; TCGA SARC -0.118; TCGA STAD -0.155; TCGA UCEC -0.088 |
hsa-miR-29c-3p | MEST | 16 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.105; TCGA CESC -0.18; TCGA COAD -0.166; TCGA ESCA -0.327; TCGA KIRC -0.278; TCGA LGG -0.218; TCGA LIHC -0.263; TCGA LUAD -0.2; TCGA LUSC -0.319; TCGA OV -0.309; TCGA PAAD -0.127; TCGA PRAD -0.189; TCGA SARC -0.813; TCGA THCA -0.063; TCGA STAD -0.439; TCGA UCEC -0.27 |
hsa-miR-29c-3p | CILP2 | 12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.142; TCGA CESC -0.245; TCGA ESCA -0.382; TCGA HNSC -0.237; TCGA KIRC -0.4; TCGA LUSC -0.311; TCGA OV -0.141; TCGA PAAD -0.771; TCGA PRAD -0.447; TCGA SARC -0.464; TCGA STAD -0.594; TCGA UCEC -0.318 |
hsa-miR-29c-3p | ZNF761 | 11 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD | MirTarget | TCGA BRCA -0.063; TCGA COAD -0.18; TCGA KIRC -0.1; TCGA KIRP -0.088; TCGA LGG -0.073; TCGA LIHC -0.362; TCGA LUAD -0.061; TCGA LUSC -0.074; TCGA PRAD -0.722; TCGA SARC -0.067; TCGA STAD -0.206 |
hsa-miR-29c-3p | PHF14 | 10 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUSC; OV; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.081; TCGA COAD -0.085; TCGA KIRC -0.13; TCGA KIRP -0.149; TCGA LIHC -0.093; TCGA LUSC -0.117; TCGA OV -0.1; TCGA SARC -0.165; TCGA STAD -0.135; TCGA UCEC -0.08 |
hsa-miR-29c-3p | ZBTB34 | 9 cancers: BRCA; CESC; KIRC; KIRP; LIHC; OV; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.06; TCGA CESC -0.104; TCGA KIRC -0.073; TCGA KIRP -0.108; TCGA LIHC -0.245; TCGA OV -0.106; TCGA SARC -0.192; TCGA STAD -0.158; TCGA UCEC -0.067 |
hsa-miR-29c-3p | ZNF468 | 11 cancers: BRCA; COAD; KIRC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.072; TCGA COAD -0.185; TCGA KIRC -0.1; TCGA LIHC -0.374; TCGA LUAD -0.066; TCGA LUSC -0.102; TCGA OV -0.083; TCGA SARC -0.103; TCGA THCA -0.127; TCGA STAD -0.132; TCGA UCEC -0.068 |
hsa-miR-29c-3p | ABCE1 | 10 cancers: BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BRCA -0.165; TCGA CESC -0.063; TCGA COAD -0.121; TCGA ESCA -0.181; TCGA LGG -0.058; TCGA LUAD -0.088; TCGA LUSC -0.103; TCGA PRAD -0.082; TCGA SARC -0.13; TCGA STAD -0.241 |
hsa-miR-29c-3p | RLF | 11 cancers: BRCA; CESC; COAD; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.209; TCGA CESC -0.126; TCGA COAD -0.081; TCGA KIRC -0.188; TCGA LUAD -0.053; TCGA LUSC -0.085; TCGA PAAD -0.105; TCGA PRAD -0.087; TCGA SARC -0.076; TCGA STAD -0.17; TCGA UCEC -0.065 |
hsa-miR-29c-3p | CCNJ | 11 cancers: BRCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; OV; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.248; TCGA CESC -0.149; TCGA COAD -0.145; TCGA KIRC -0.098; TCGA KIRP -0.098; TCGA LGG -0.196; TCGA LUAD -0.092; TCGA OV -0.114; TCGA SARC -0.241; TCGA STAD -0.322; TCGA UCEC -0.257 |
hsa-miR-29c-3p | BRWD3 | 10 cancers: BRCA; CESC; KIRC; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.214; TCGA CESC -0.141; TCGA KIRC -0.258; TCGA LGG -0.147; TCGA LIHC -0.116; TCGA LUAD -0.084; TCGA LUSC -0.188; TCGA SARC -0.205; TCGA STAD -0.118; TCGA UCEC -0.162 |
hsa-miR-29c-3p | RCC2 | 16 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.16; TCGA CESC -0.067; TCGA ESCA -0.286; TCGA HNSC -0.071; TCGA KIRC -0.135; TCGA KIRP -0.117; TCGA LGG -0.186; TCGA LIHC -0.277; TCGA LUAD -0.095; TCGA LUSC -0.238; TCGA PAAD -0.216; TCGA PRAD -0.147; TCGA SARC -0.159; TCGA THCA -0.131; TCGA STAD -0.301; TCGA UCEC -0.196 |
hsa-miR-29c-3p | PLXNA1 | 12 cancers: BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.206; TCGA ESCA -0.356; TCGA HNSC -0.15; TCGA LIHC -0.407; TCGA LUAD -0.109; TCGA LUSC -0.188; TCGA PAAD -0.403; TCGA PRAD -0.11; TCGA SARC -0.199; TCGA THCA -0.094; TCGA STAD -0.338; TCGA UCEC -0.137 |
hsa-miR-29c-3p | ZNF28 | 10 cancers: BRCA; COAD; KIRC; LGG; LIHC; LUAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.149; TCGA COAD -0.243; TCGA KIRC -0.139; TCGA LGG -0.074; TCGA LIHC -0.325; TCGA LUAD -0.077; TCGA SARC -0.111; TCGA THCA -0.133; TCGA STAD -0.168; TCGA UCEC -0.098 |
hsa-miR-29c-3p | SPAST | 14 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.13; TCGA CESC -0.051; TCGA ESCA -0.17; TCGA KIRC -0.111; TCGA LGG -0.065; TCGA LIHC -0.112; TCGA LUAD -0.089; TCGA LUSC -0.195; TCGA OV -0.14; TCGA PRAD -0.075; TCGA SARC -0.186; TCGA THCA -0.052; TCGA STAD -0.184; TCGA UCEC -0.093 |
hsa-miR-29c-3p | EML4 | 10 cancers: BRCA; KIRP; LGG; LIHC; LUAD; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.222; TCGA KIRP -0.141; TCGA LGG -0.136; TCGA LIHC -0.138; TCGA LUAD -0.051; TCGA OV -0.055; TCGA PRAD -0.131; TCGA SARC -0.204; TCGA STAD -0.1; TCGA UCEC -0.118 |
hsa-miR-29c-3p | ATAD2B | 10 cancers: BRCA; KIRC; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.136; TCGA KIRC -0.075; TCGA LGG -0.166; TCGA LIHC -0.056; TCGA LUSC -0.106; TCGA OV -0.058; TCGA PRAD -0.113; TCGA SARC -0.132; TCGA STAD -0.103; TCGA UCEC -0.073 |
hsa-miR-29c-3p | DCAF7 | 10 cancers: BRCA; CESC; KIRP; LGG; LIHC; LUAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.113; TCGA CESC -0.091; TCGA KIRP -0.133; TCGA LGG -0.136; TCGA LIHC -0.145; TCGA LUAD -0.079; TCGA SARC -0.113; TCGA THCA -0.079; TCGA STAD -0.088; TCGA UCEC -0.105 |
hsa-miR-29c-3p | ARMC8 | 9 cancers: BRCA; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget; miRNATAP | TCGA BRCA -0.1; TCGA ESCA -0.065; TCGA KIRP -0.071; TCGA LIHC -0.052; TCGA LUAD -0.06; TCGA LUSC -0.081; TCGA PAAD -0.068; TCGA PRAD -0.069; TCGA STAD -0.06 |
hsa-miR-29c-3p | ELAVL1 | 11 cancers: BRCA; ESCA; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.073; TCGA ESCA -0.134; TCGA LGG -0.085; TCGA LIHC -0.058; TCGA LUAD -0.059; TCGA LUSC -0.097; TCGA OV -0.062; TCGA SARC -0.054; TCGA THCA -0.052; TCGA STAD -0.123; TCGA UCEC -0.083 |
hsa-miR-29c-3p | TCF3 | 15 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.117; TCGA CESC -0.076; TCGA ESCA -0.22; TCGA HNSC -0.111; TCGA KIRC -0.128; TCGA KIRP -0.213; TCGA LGG -0.313; TCGA LIHC -0.315; TCGA LUAD -0.119; TCGA LUSC -0.206; TCGA OV -0.083; TCGA PRAD -0.108; TCGA SARC -0.204; TCGA STAD -0.125; TCGA UCEC -0.249 |
hsa-miR-29c-3p | STK35 | 10 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUSC; SARC; THCA; STAD; UCEC | mirMAP; miRNATAP | TCGA BRCA -0.094; TCGA CESC -0.066; TCGA ESCA -0.101; TCGA KIRP -0.081; TCGA LIHC -0.24; TCGA LUSC -0.191; TCGA SARC -0.143; TCGA THCA -0.154; TCGA STAD -0.176; TCGA UCEC -0.116 |
hsa-miR-29c-3p | FOXK2 | 13 cancers: BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.07; TCGA ESCA -0.184; TCGA HNSC -0.078; TCGA KIRP -0.126; TCGA LGG -0.055; TCGA LIHC -0.178; TCGA LUAD -0.113; TCGA LUSC -0.154; TCGA OV -0.058; TCGA SARC -0.082; TCGA THCA -0.088; TCGA STAD -0.17; TCGA UCEC -0.074 |
hsa-miR-29c-3p | PLEKHG4B | 10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUSC; OV; PAAD; SARC; UCEC | mirMAP | TCGA BRCA -0.439; TCGA CESC -0.288; TCGA HNSC -0.336; TCGA KIRC -0.431; TCGA KIRP -0.404; TCGA LUSC -0.424; TCGA OV -0.161; TCGA PAAD -0.282; TCGA SARC -0.566; TCGA UCEC -0.244 |
hsa-miR-29c-3p | C16orf87 | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | mirMAP; miRNATAP | TCGA BRCA -0.244; TCGA CESC -0.127; TCGA COAD -0.07; TCGA ESCA -0.173; TCGA HNSC -0.149; TCGA LGG -0.173; TCGA LUAD -0.072; TCGA LUSC -0.144; TCGA OV -0.133; TCGA PAAD -0.18; TCGA PRAD -0.137; TCGA SARC -0.131; TCGA STAD -0.146 |
hsa-miR-29c-3p | RAB3B | 13 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.348; TCGA CESC -0.487; TCGA ESCA -0.337; TCGA HNSC -0.297; TCGA KIRP -0.489; TCGA LIHC -0.403; TCGA LUAD -0.324; TCGA LUSC -0.788; TCGA OV -0.422; TCGA PRAD -0.318; TCGA SARC -0.255; TCGA STAD -0.259; TCGA UCEC -0.321 |
hsa-miR-29c-3p | MAP6D1 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; STAD | mirMAP | TCGA BRCA -0.121; TCGA CESC -0.109; TCGA ESCA -0.334; TCGA HNSC -0.104; TCGA KIRC -0.195; TCGA KIRP -0.138; TCGA LUAD -0.262; TCGA LUSC -0.353; TCGA OV -0.172; TCGA PRAD -0.187; TCGA STAD -0.213 |
hsa-miR-29c-3p | SLC5A3 | 9 cancers: BRCA; CESC; ESCA; HNSC; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.315; TCGA CESC -0.139; TCGA ESCA -0.24; TCGA HNSC -0.056; TCGA LUSC -0.143; TCGA PAAD -0.264; TCGA SARC -0.111; TCGA THCA -0.122; TCGA STAD -0.283 |
hsa-miR-29c-3p | RAB15 | 9 cancers: BRCA; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.079; TCGA LIHC -0.188; TCGA LUAD -0.131; TCGA LUSC -0.189; TCGA OV -0.097; TCGA PAAD -0.15; TCGA THCA -0.254; TCGA STAD -0.199; TCGA UCEC -0.129 |
hsa-miR-29c-3p | MTSS1L | 10 cancers: BRCA; CESC; ESCA; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.185; TCGA CESC -0.128; TCGA ESCA -0.27; TCGA LGG -0.052; TCGA LUAD -0.083; TCGA LUSC -0.085; TCGA PRAD -0.197; TCGA THCA -0.188; TCGA STAD -0.266; TCGA UCEC -0.079 |
hsa-miR-29c-3p | PSME4 | 9 cancers: BRCA; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.252; TCGA ESCA -0.08; TCGA LGG -0.063; TCGA LUAD -0.078; TCGA LUSC -0.17; TCGA PAAD -0.107; TCGA PRAD -0.068; TCGA STAD -0.123; TCGA UCEC -0.104 |
hsa-miR-29c-3p | AMMECR1 | 13 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.217; TCGA ESCA -0.232; TCGA HNSC -0.09; TCGA KIRC -0.106; TCGA KIRP -0.19; TCGA LGG -0.119; TCGA LUSC -0.218; TCGA PAAD -0.105; TCGA PRAD -0.201; TCGA SARC -0.258; TCGA THCA -0.107; TCGA STAD -0.171; TCGA UCEC -0.069 |
hsa-miR-29c-3p | PPARD | 11 cancers: BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; UCEC | miRNATAP | TCGA BRCA -0.128; TCGA ESCA -0.128; TCGA HNSC -0.164; TCGA KIRP -0.111; TCGA LGG -0.05; TCGA LIHC -0.122; TCGA LUAD -0.09; TCGA LUSC -0.09; TCGA PAAD -0.244; TCGA SARC -0.085; TCGA UCEC -0.088 |
hsa-miR-29c-3p | GTPBP2 | 9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; UCEC | miRNATAP | TCGA BRCA -0.088; TCGA KIRP -0.163; TCGA LGG -0.087; TCGA LIHC -0.26; TCGA LUAD -0.083; TCGA LUSC -0.1; TCGA PAAD -0.114; TCGA SARC -0.078; TCGA UCEC -0.107 |
hsa-miR-29c-3p | COL22A1 | 9 cancers: BRCA; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; THCA; STAD | miRNATAP | TCGA BRCA -0.443; TCGA ESCA -0.377; TCGA HNSC -0.349; TCGA KIRC -0.383; TCGA LIHC -0.538; TCGA LUSC -0.304; TCGA PAAD -0.723; TCGA THCA -0.251; TCGA STAD -0.254 |
hsa-miR-29c-3p | DGKH | 9 cancers: BRCA; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BRCA -0.22; TCGA ESCA -0.193; TCGA KIRC -0.212; TCGA LUAD -0.093; TCGA LUSC -0.233; TCGA PAAD -0.223; TCGA PRAD -0.207; TCGA THCA -0.286; TCGA STAD -0.341 |
hsa-miR-29c-3p | DAG1 | 9 cancers: BRCA; CESC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.062; TCGA CESC -0.097; TCGA LUAD -0.088; TCGA LUSC -0.054; TCGA PAAD -0.118; TCGA PRAD -0.073; TCGA THCA -0.192; TCGA STAD -0.171; TCGA UCEC -0.107 |
hsa-miR-29c-3p | SMARCC1 | 14 cancers: BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.179; TCGA CESC -0.148; TCGA COAD -0.07; TCGA ESCA -0.094; TCGA LGG -0.183; TCGA LIHC -0.234; TCGA LUAD -0.062; TCGA LUSC -0.118; TCGA OV -0.068; TCGA PAAD -0.089; TCGA SARC -0.1; TCGA THCA -0.084; TCGA STAD -0.192; TCGA UCEC -0.205 |
hsa-miR-29c-3p | ETV4 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.197; TCGA CESC -0.348; TCGA COAD -0.177; TCGA ESCA -0.546; TCGA HNSC -0.191; TCGA LIHC -0.519; TCGA LUSC -0.563; TCGA PRAD -0.297; TCGA SARC -0.505; TCGA THCA -0.341; TCGA STAD -0.487; TCGA UCEC -0.401 |
hsa-miR-29c-3p | BTBD7 | 11 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.059; TCGA CESC -0.126; TCGA KIRC -0.1; TCGA KIRP -0.231; TCGA LGG -0.062; TCGA LIHC -0.067; TCGA LUSC -0.091; TCGA OV -0.061; TCGA SARC -0.095; TCGA STAD -0.092; TCGA UCEC -0.062 |
hsa-miR-29c-3p | GSK3B | 10 cancers: BRCA; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.149; TCGA COAD -0.057; TCGA ESCA -0.149; TCGA KIRP -0.109; TCGA LUAD -0.062; TCGA LUSC -0.121; TCGA PAAD -0.112; TCGA THCA -0.109; TCGA STAD -0.155; TCGA UCEC -0.066 |
hsa-miR-29c-3p | MMS19 | 10 cancers: CESC; ESCA; HNSC; KIRP; LIHC; LUSC; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.057; TCGA ESCA -0.085; TCGA HNSC -0.094; TCGA KIRP -0.061; TCGA LIHC -0.197; TCGA LUSC -0.062; TCGA SARC -0.097; TCGA THCA -0.115; TCGA STAD -0.091; TCGA UCEC -0.089 |
hsa-miR-29c-3p | SEC11A | 9 cancers: CESC; COAD; ESCA; HNSC; LGG; LIHC; PAAD; SARC; STAD | MirTarget | TCGA CESC -0.067; TCGA COAD -0.067; TCGA ESCA -0.07; TCGA HNSC -0.072; TCGA LGG -0.138; TCGA LIHC -0.1; TCGA PAAD -0.062; TCGA SARC -0.061; TCGA STAD -0.054 |
hsa-miR-29c-3p | NAA40 | 9 cancers: CESC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.136; TCGA KIRP -0.144; TCGA LGG -0.145; TCGA LIHC -0.337; TCGA LUAD -0.059; TCGA LUSC -0.164; TCGA SARC -0.063; TCGA STAD -0.172; TCGA UCEC -0.131 |
hsa-miR-29c-3p | ANKRD52 | 9 cancers: CESC; ESCA; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.066; TCGA ESCA -0.131; TCGA KIRP -0.167; TCGA LIHC -0.383; TCGA LUAD -0.07; TCGA LUSC -0.148; TCGA THCA -0.073; TCGA STAD -0.167; TCGA UCEC -0.088 |
hsa-miR-29c-3p | UBE2K | 9 cancers: CESC; COAD; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.077; TCGA COAD -0.092; TCGA LIHC -0.068; TCGA LUAD -0.062; TCGA LUSC -0.076; TCGA PAAD -0.071; TCGA PRAD -0.079; TCGA STAD -0.082; TCGA UCEC -0.056 |
hsa-miR-29c-3p | ZDHHC8 | 12 cancers: CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.099; TCGA ESCA -0.148; TCGA HNSC -0.151; TCGA KIRP -0.18; TCGA LGG -0.054; TCGA LUAD -0.083; TCGA LUSC -0.12; TCGA PAAD -0.129; TCGA SARC -0.127; TCGA THCA -0.057; TCGA STAD -0.114; TCGA UCEC -0.1 |
hsa-miR-29c-3p | ARID3A | 10 cancers: CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | mirMAP | TCGA CESC -0.131; TCGA ESCA -0.251; TCGA HNSC -0.119; TCGA LGG -0.092; TCGA LIHC -0.738; TCGA LUAD -0.144; TCGA LUSC -0.089; TCGA SARC -0.112; TCGA STAD -0.165; TCGA UCEC -0.208 |
hsa-miR-29c-3p | LSM14B | 9 cancers: CESC; ESCA; KIRP; LIHC; LUSC; OV; SARC; STAD; UCEC | mirMAP; miRNATAP | TCGA CESC -0.096; TCGA ESCA -0.129; TCGA KIRP -0.084; TCGA LIHC -0.176; TCGA LUSC -0.169; TCGA OV -0.106; TCGA SARC -0.075; TCGA STAD -0.167; TCGA UCEC -0.08 |
hsa-miR-29c-3p | NCKAP5L | 12 cancers: CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA CESC -0.123; TCGA ESCA -0.115; TCGA HNSC -0.101; TCGA KIRP -0.141; TCGA LGG -0.134; TCGA LIHC -0.189; TCGA LUAD -0.089; TCGA PAAD -0.134; TCGA PRAD -0.132; TCGA SARC -0.136; TCGA STAD -0.125; TCGA UCEC -0.058 |
hsa-miR-29c-3p | CSRNP2 | 10 cancers: CESC; COAD; KIRC; LIHC; LUSC; OV; PAAD; SARC; STAD; UCEC | miRNATAP | TCGA CESC -0.104; TCGA COAD -0.068; TCGA KIRC -0.087; TCGA LIHC -0.055; TCGA LUSC -0.073; TCGA OV -0.063; TCGA PAAD -0.07; TCGA SARC -0.068; TCGA STAD -0.153; TCGA UCEC -0.11 |
hsa-miR-29c-3p | PDRG1 | 9 cancers: COAD; HNSC; KIRP; LIHC; LUAD; LUSC; OV; STAD; UCEC | MirTarget | TCGA COAD -0.132; TCGA HNSC -0.09; TCGA KIRP -0.123; TCGA LIHC -0.257; TCGA LUAD -0.082; TCGA LUSC -0.196; TCGA OV -0.138; TCGA STAD -0.164; TCGA UCEC -0.063 |
hsa-miR-29c-3p | ARHGEF19 | 11 cancers: COAD; ESCA; KIRC; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA COAD -0.17; TCGA ESCA -0.302; TCGA KIRC -0.137; TCGA LGG -0.078; TCGA LUSC -0.322; TCGA OV -0.127; TCGA PAAD -0.325; TCGA PRAD -0.203; TCGA SARC -0.229; TCGA STAD -0.192; TCGA UCEC -0.261 |
hsa-miR-29c-3p | GPATCH2 | 9 cancers: COAD; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; SARC; STAD | MirTarget | TCGA COAD -0.08; TCGA ESCA -0.125; TCGA HNSC -0.074; TCGA LGG -0.097; TCGA LIHC -0.082; TCGA LUSC -0.16; TCGA PRAD -0.108; TCGA SARC -0.089; TCGA STAD -0.138 |
hsa-miR-29c-3p | UBE2I | 10 cancers: COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; OV; PRAD; THCA | mirMAP | TCGA COAD -0.076; TCGA ESCA -0.105; TCGA HNSC -0.066; TCGA KIRP -0.214; TCGA LGG -0.082; TCGA LIHC -0.142; TCGA LUSC -0.098; TCGA OV -0.059; TCGA PRAD -0.088; TCGA THCA -0.087 |
hsa-miR-29c-3p | CCND1 | 9 cancers: COAD; ESCA; HNSC; LGG; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA COAD -0.141; TCGA ESCA -0.21; TCGA HNSC -0.164; TCGA LGG -0.263; TCGA PAAD -0.241; TCGA SARC -0.209; TCGA THCA -0.316; TCGA STAD -0.157; TCGA UCEC -0.298 |
hsa-miR-29c-3p | CBX8 | 9 cancers: COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; OV; STAD | mirMAP | TCGA COAD -0.086; TCGA ESCA -0.16; TCGA HNSC -0.092; TCGA KIRP -0.19; TCGA LGG -0.172; TCGA LIHC -0.169; TCGA LUSC -0.24; TCGA OV -0.123; TCGA STAD -0.165 |
hsa-miR-29c-3p | TRAF4 | 9 cancers: COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; UCEC | miRNATAP | TCGA COAD -0.083; TCGA HNSC -0.078; TCGA KIRP -0.199; TCGA LGG -0.243; TCGA LIHC -0.072; TCGA LUAD -0.103; TCGA LUSC -0.166; TCGA SARC -0.132; TCGA UCEC -0.197 |
hsa-miR-29c-3p | ZNF282 | 11 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA ESCA -0.132; TCGA HNSC -0.099; TCGA KIRC -0.073; TCGA KIRP -0.202; TCGA LGG -0.173; TCGA LIHC -0.179; TCGA LUAD -0.108; TCGA LUSC -0.186; TCGA SARC -0.078; TCGA THCA -0.054; TCGA STAD -0.079 |
hsa-miR-29c-3p | ARF5 | 9 cancers: ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC | miRNATAP | TCGA ESCA -0.093; TCGA HNSC -0.069; TCGA KIRP -0.243; TCGA LIHC -0.072; TCGA LUAD -0.072; TCGA LUSC -0.154; TCGA OV -0.079; TCGA THCA -0.054; TCGA UCEC -0.086 |
hsa-miR-29c-3p | POFUT2 | 9 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD | mirMAP | TCGA HNSC -0.09; TCGA KIRC -0.09; TCGA KIRP -0.137; TCGA LGG -0.125; TCGA LIHC -0.136; TCGA LUAD -0.05; TCGA LUSC -0.057; TCGA SARC -0.13; TCGA STAD -0.071 |
hsa-miR-29c-3p | LASP1 | 10 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; THCA; UCEC | miRNATAP | TCGA HNSC -0.079; TCGA KIRC -0.15; TCGA KIRP -0.212; TCGA LGG -0.063; TCGA LIHC -0.198; TCGA LUAD -0.082; TCGA PAAD -0.128; TCGA SARC -0.144; TCGA THCA -0.166; TCGA UCEC -0.092 |
hsa-miR-29c-3p | PCGF3 | 9 cancers: KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA KIRC -0.106; TCGA KIRP -0.217; TCGA LGG -0.064; TCGA LIHC -0.135; TCGA LUSC -0.093; TCGA OV -0.065; TCGA SARC -0.144; TCGA STAD -0.104; TCGA UCEC -0.089 |
hsa-miR-29c-3p | SETDB1 | 9 cancers: KIRC; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA KIRC -0.062; TCGA LGG -0.165; TCGA LIHC -0.225; TCGA LUSC -0.118; TCGA OV -0.06; TCGA PRAD -0.051; TCGA SARC -0.077; TCGA STAD -0.098; TCGA UCEC -0.085 |
Enriched cancer pathways of putative targets