microRNA information: hsa-miR-300
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-300 | miRbase |
| Accession: | MIMAT0004903 | miRbase |
| Precursor name: | hsa-mir-300 | miRbase |
| Precursor accession: | MI0005525 | miRbase |
| Symbol: | MIR300 | HGNC |
| RefSeq ID: | NR_030582 | GenBank |
| Sequence: | UAUACAAGGGCAGACUCUCUCU |
Reported expression in cancers: hsa-miR-300
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-300 | bladder cancer | deregulation | "Fresh normal 5 samples and BUC 30 samples tissues ......" | 21223810 | Reverse transcription PCR; Microarray |
| hsa-miR-300 | breast cancer | upregulation | "We observed that miR-300 expression was frequently ......" | 26221232 | |
| hsa-miR-300 | gastric cancer | upregulation | "We observed that miR-300 expression was frequently ......" | 26221215 | |
| hsa-miR-300 | sarcoma | downregulation | "This study is aimed to investigate the clinical im ......" | 26330295 | qPCR |
Reported cancer pathway affected by hsa-miR-300
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-300 | breast cancer | cell cycle pathway | "MiR 300 regulate the malignancy of breast cancer b ......" | 26221232 | |
| hsa-miR-300 | gastric cancer | cell cycle pathway | "The up regulation of miR 300 in gastric cancer and ......" | 26221215 | |
| hsa-miR-300 | sarcoma | Epithelial mesenchymal transition pathway | "Up Regulation of MiR 300 Promotes Proliferation an ......" | 26010572 | |
| hsa-miR-300 | sarcoma | Epithelial mesenchymal transition pathway | "Endothelin 1 promotes epithelial mesenchymal trans ......" | 27602960 |
Reported cancer prognosis affected by hsa-miR-300
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-300 | breast cancer | progression; tumorigenesis | "MiR 300 regulate the malignancy of breast cancer b ......" | 26221232 | |
| hsa-miR-300 | gastric cancer | progression; tumorigenesis | "The up regulation of miR 300 in gastric cancer and ......" | 26221215 | |
| hsa-miR-300 | sarcoma | metastasis; progression; worse prognosis; staging; poor survival | "Upregulation of miR 300 and downregulation of miR ......" | 26330295 | |
| hsa-miR-300 | sarcoma | metastasis | "Endothelin 1 promotes epithelial mesenchymal trans ......" | 27602960 |
Reported gene related to hsa-miR-300
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-300 | breast cancer | TP53 | "MiR 300 regulate the malignancy of breast cancer b ......" | 26221232 |
| hsa-miR-300 | gastric cancer | TP53 | "Moreover p53 a key inhibitor of cell cycle was ver ......" | 26221215 |
| hsa-miR-300 | sarcoma | BRD7 | "Up Regulation of MiR 300 Promotes Proliferation an ......" | 26010572 |
| hsa-miR-300 | sarcoma | EDN1 | "Endothelin 1 promotes epithelial mesenchymal trans ......" | 27602960 |
| hsa-miR-300 | sarcoma | TWIST1 | "We also show that miR-300 directly targets Twist w ......" | 27602960 |