microRNA information: hsa-miR-301b-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-301b-3p | miRbase |
Accession: | MIMAT0004958 | miRbase |
Precursor name: | hsa-mir-301b | miRbase |
Precursor accession: | MI0005568 | miRbase |
Symbol: | MIR301B | HGNC |
RefSeq ID: | NR_030622 | GenBank |
Sequence: | CAGUGCAAUGAUAUUGUCAAAGC |
Reported expression in cancers: hsa-miR-301b-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-301b-3p | bladder cancer | upregulation | "We focused on the miR-130 family miR-130b miR-301a ......" | 26837847 | |
hsa-miR-301b-3p | lung cancer | upregulation | "This study aimed to explore the role of miR-301b i ......" | 27352910 | qPCR |
hsa-miR-301b-3p | prostate cancer | downregulation | "Multiple tumor-suppressive miRNAs were downregulat ......" | 22719071 | |
hsa-miR-301b-3p | prostate cancer | downregulation | "miR-301 was found to be markedly downregulated. Th ......" | 27307749 | Reverse transcription PCR; in situ hybridization |
Reported cancer pathway affected by hsa-miR-301b-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-301b-3p | lung cancer | Apoptosis pathway | "Hypoxia induced microRNA 301b regulates apoptosis ......" | 27352910 | Western blot; Luciferase |
hsa-miR-301b-3p | lung cancer | cell cycle pathway; Apoptosis pathway | "Therefore using miRNA microarray technology this s ......" | 27524914 | |
hsa-miR-301b-3p | prostate cancer | Apoptosis pathway | "Luteolin inhibited proliferation and induced apopt ......" | 27307749 | Luciferase |
Reported cancer prognosis affected by hsa-miR-301b-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-301b-3p | breast cancer | drug resistance | "MicroRNA-301 miR-301 overexpression has been impli ......" | 21393507 | Luciferase |
hsa-miR-301b-3p | lung squamous cell cancer | poor survival | "Five selected miRNAs let-7f miR-20b miR-30e-3p miR ......" | 20595154 | |
hsa-miR-301b-3p | prostate cancer | poor survival | "Luteolin inhibited proliferation and induced apopt ......" | 27307749 | Luciferase |
hsa-miR-301b-3p | prostate cancer | drug resistance | "Hypoxia Responsive Mir 301a and Mir 301b Promote R ......" | 27327120 | Western blot; Flow cytometry |
Reported gene related to hsa-miR-301b-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-301b-3p | prostate cancer | NDRG2 | "Hypoxia Responsive Mir 301a and Mir 301b Promote R ......" | 27327120 |
hsa-miR-301b-3p | prostate cancer | NDRG2 | "Both miR-301a and miR-301b could directly target 3 ......" | 26813459 |
hsa-miR-301b-3p | lung cancer | ARID1A | "Among them hsa-miR-301b was verified to regulate F ......" | 27524914 |
hsa-miR-301b-3p | lung cancer | BCL2L11 | "Hypoxia induced microRNA 301b regulates apoptosis ......" | 27352910 |
hsa-miR-301b-3p | prostate cancer | DEDD2 | "The proapoptotic gene DEDD2 was predicted to be th ......" | 27307749 |
hsa-miR-301b-3p | lung cancer | FOXF2 | "Among them hsa-miR-301b was verified to regulate F ......" | 27524914 |
hsa-miR-301b-3p | thyroid cancer | HLF | "Significant interaction of hsa-miR-301b with HLF H ......" | 27350898 |
hsa-miR-301b-3p | breast cancer | SKA2 | "We noted that miR-301 is located in an intron of t ......" | 21393507 |
Expression profile in cancer corhorts: