microRNA information: hsa-miR-302a-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-302a-3p | miRbase |
Accession: | MIMAT0000684 | miRbase |
Precursor name: | hsa-mir-302a | miRbase |
Precursor accession: | MI0000738 | miRbase |
Symbol: | MIR302A | HGNC |
RefSeq ID: | NR_029835 | GenBank |
Sequence: | UAAGUGCUUCCAUGUUUUGGUGA |
Reported expression in cancers: hsa-miR-302a-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-302a-3p | breast cancer | downregulation | "Our studies show that miR-302a expression levels w ......" | 25030358 | |
hsa-miR-302a-3p | head and neck cancer | downregulation | "These CSCs were transfected with a specific anti-m ......" | 22847005 |
Reported cancer pathway affected by hsa-miR-302a-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-302a-3p | colorectal cancer | PI3K/Akt signaling pathway | "Up regulation of microRNA 302a inhibited the proli ......" | 26191138 | Transwell assay; Western blot |
hsa-miR-302a-3p | endometrial cancer | cell cycle pathway | "MicroRNA miR 302 inhibits the tumorigenicity of en ......" | 24333727 | Western blot |
hsa-miR-302a-3p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "MiR 302a inhibits the tumorigenicity of ovarian ca ......" | 26191180 |
Reported cancer prognosis affected by hsa-miR-302a-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-302a-3p | breast cancer | drug resistance | "MicroRNA 302 replacement therapy sensitizes breast ......" | 23184229 | |
hsa-miR-302a-3p | breast cancer | metastasis | "Inhibition of breast cancer metastasis with microR ......" | 25030358 | |
hsa-miR-302a-3p | breast cancer | drug resistance | "The differential miRNA expression profiling in par ......" | 26644266 | Luciferase; Western blot; Cell Proliferation Assay; Flow cytometry |
hsa-miR-302a-3p | breast cancer | drug resistance | "The levels of miRNAs and mRNA expression were dete ......" | 26842910 | Western blot; Cell Proliferation Assay; Luciferase |
hsa-miR-302a-3p | colon cancer | drug resistance | "MiRNA microarray technology facilitates analysis o ......" | 25526515 | |
hsa-miR-302a-3p | colon cancer | staging | "We assessed by qRT-PCR expression of 754 microRNAs ......" | 27485175 | |
hsa-miR-302a-3p | gastric cancer | differentiation | "CSC characteristics were checked using spheroid fo ......" | 22374783 | Colony formation |
hsa-miR-302a-3p | gastric cancer | metastasis; poor survival | "microRNA miRNA; miR array identified that RACK1 mo ......" | 26199092 | |
hsa-miR-302a-3p | head and neck cancer | drug resistance; poor survival | "Hyaluronan CD44v3 interaction with Oct4 Sox2 Nanog ......" | 22847005 | |
hsa-miR-302a-3p | ovarian cancer | progression | "MiR 302a inhibits the tumorigenicity of ovarian ca ......" | 26191180 | |
hsa-miR-302a-3p | sarcoma | differentiation | "Mir 302 reprograms human skin cancer cells into a ......" | 18755840 |
Reported gene related to hsa-miR-302a-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-302a-3p | breast cancer | AKT1 | "Additionally the expression levels of miR-302a wer ......" | 23184229 |
hsa-miR-302a-3p | cervical and endocervical cancer | AKT1 | "The microRNA 302 367 cluster suppresses the prolif ......" | 23185040 |
hsa-miR-302a-3p | breast cancer | ABCB1 | "However our results showed that the suppression of ......" | 26842910 |
hsa-miR-302a-3p | breast cancer | ABCG2 | "Luciferase activity assay showed that miR-302 inhi ......" | 26644266 |
hsa-miR-302a-3p | breast cancer | AKR1B1 | "Overexpression of miR-302 increased intracellular ......" | 26842910 |
hsa-miR-302a-3p | breast cancer | CXCR4 | "Inhibition of breast cancer metastasis with microR ......" | 25030358 |
hsa-miR-302a-3p | breast cancer | MAP3K1 | "Further studies identified MAP/ERK kinase kinase 1 ......" | 26842910 |
hsa-miR-302a-3p | colorectal cancer | MMP9 | "The expressions and secretions of MMP-9 and -2 wer ......" | 26191138 |
hsa-miR-302a-3p | breast cancer | MX1 | "Overexpression of miR-302 increased intracellular ......" | 26644266 |
hsa-miR-302a-3p | head and neck cancer | NANOG | "Hyaluronan CD44v3 interaction with Oct4 Sox2 Nanog ......" | 22847005 |
hsa-miR-302a-3p | breast cancer | RAD52 | "Additionally the expression levels of miR-302a wer ......" | 23184229 |
hsa-miR-302a-3p | ovarian cancer | SDC1 | "MiR 302a inhibits the tumorigenicity of ovarian ca ......" | 26191180 |
hsa-miR-302a-3p | head and neck cancer | SOX2 | "Hyaluronan CD44v3 interaction with Oct4 Sox2 Nanog ......" | 22847005 |