microRNA information: hsa-miR-302c-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-302c-3p | miRbase |
| Accession: | MIMAT0000717 | miRbase |
| Precursor name: | hsa-mir-302c | miRbase |
| Precursor accession: | MI0000773 | miRbase |
| Symbol: | MIR302C | HGNC |
| RefSeq ID: | NR_029858 | GenBank |
| Sequence: | UAAGUGCUUCCAUGUUUCAGUGG |
Reported expression in cancers: hsa-miR-302c-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-302c-3p | lung squamous cell cancer | deregulation | "In this study we evaluated the expression profiles ......" | 27533249 |
Reported cancer pathway affected by hsa-miR-302c-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-302c-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-302c-3p | liver cancer | motility | "MiR 302c inhibits tumor growth of hepatocellular c ......" | 25027009 | |
| hsa-miR-302c-3p | liver cancer | staging | "Serum microRNAs; miR 30c 5p miR 223 3p miR 302c 3p ......" | 25391771 |
Reported gene related to hsa-miR-302c-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-302c-3p | liver cancer | CDH5 | "When miR-302c was overexpressed in HUVECs the moti ......" | 25027009 |
| hsa-miR-302c-3p | liver cancer | MTDH | "Reporter assays showed that miR-302c inhibited met ......" | 25027009 |