microRNA information: hsa-miR-3065-3p

SectionIDlink
Mature name: hsa-miR-3065-3pmiRbase
Accession: MIMAT0015378miRbase
Precursor name: hsa-mir-3065 miRbase
Precursor accession: MI0014228miRbase
Symbol: MIR3065HGNC
RefSeq ID: NR_036151GenBank
Sequence: UCAGCACCAGGAUAUUGUUGGAG



Reported expression in cancers: hsa-miR-3065-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-3065-3p

NANA"NA ......"NANA
hsa-miR-3065-3p

" ......"



Reported cancer pathway affected by hsa-miR-3065-3p

miRNAcancerpathwayreportingPUBMEDfunctional study



Reported cancer prognosis affected by hsa-miR-3065-3p

miRNAcancerprognosisreportingPUBMEDfunctional study



Reported gene related to hsa-miR-3065-3p

miRNAcancergenereportingPUBMED



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-3065-3p
MLXIP
9 cancers: BLCA; BRCA; ESCA; HNSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.118; TCGA BRCA -0.091; TCGA ESCA -0.094; TCGA HNSC -0.081; TCGA PRAD -0.162; TCGA SARC -0.155; TCGA THCA -0.054; TCGA STAD -0.104; TCGA UCEC -0.058
hsa-miR-3065-3p
COL5A3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.164; TCGA BRCA -0.085; TCGA CESC -0.186; TCGA ESCA -0.232; TCGA HNSC -0.183; TCGA KIRC -0.519; TCGA LIHC -0.135; TCGA LUAD -0.223; TCGA LUSC -0.319; TCGA STAD -0.143; TCGA UCEC -0.103
hsa-miR-3065-3p
CCND2
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.234; TCGA BRCA -0.215; TCGA CESC -0.207; TCGA ESCA -0.203; TCGA KIRC -0.157; TCGA KIRP -0.275; TCGA LGG -0.082; TCGA PRAD -0.171; TCGA STAD -0.196; TCGA UCEC -0.243
hsa-miR-3065-3p
PTRF
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.253; TCGA BRCA -0.208; TCGA CESC -0.263; TCGA HNSC -0.109; TCGA KIRC -0.159; TCGA KIRP -0.108; TCGA PAAD -0.109; TCGA PRAD -0.156; TCGA SARC -0.113; TCGA STAD -0.196; TCGA UCEC -0.197
hsa-miR-3065-3p
COL16A1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.174; TCGA BRCA -0.074; TCGA CESC -0.145; TCGA ESCA -0.135; TCGA HNSC -0.205; TCGA LGG -0.11; TCGA LUAD -0.081; TCGA LUSC -0.317; TCGA PAAD -0.313; TCGA STAD -0.108; TCGA UCEC -0.174
hsa-miR-3065-3p
MARVELD1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.166; TCGA BRCA -0.07; TCGA CESC -0.156; TCGA HNSC -0.118; TCGA KIRC -0.166; TCGA KIRP -0.085; TCGA LUSC -0.058; TCGA PAAD -0.15; TCGA PRAD -0.205; TCGA STAD -0.091; TCGA UCEC -0.098
hsa-miR-3065-3p
RBMS3
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; PRAD; UCEC
MirTarget
TCGA BLCA -0.293; TCGA BRCA -0.311; TCGA CESC -0.152; TCGA ESCA -0.143; TCGA HNSC -0.101; TCGA KIRC -0.073; TCGA LGG -0.12; TCGA PRAD -0.354; TCGA UCEC -0.115
hsa-miR-3065-3p
PI15
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.199; TCGA CESC -0.274; TCGA ESCA -0.246; TCGA HNSC -0.116; TCGA KIRC -0.243; TCGA LIHC -0.205; TCGA LUAD -0.348; TCGA LUSC -0.285; TCGA PAAD -0.225; TCGA SARC -0.482; TCGA THCA -0.218; TCGA UCEC -0.168
hsa-miR-3065-3p
TRAM2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA
MirTarget; miRNATAP
TCGA BLCA -0.124; TCGA BRCA -0.092; TCGA CESC -0.105; TCGA ESCA -0.079; TCGA HNSC -0.076; TCGA KIRC -0.073; TCGA LUAD -0.083; TCGA LUSC -0.074; TCGA PAAD -0.16; TCGA THCA -0.065
hsa-miR-3065-3p
CD248
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.184; TCGA CESC -0.148; TCGA ESCA -0.244; TCGA HNSC -0.135; TCGA KIRC -0.23; TCGA LGG -0.187; TCGA LUAD -0.106; TCGA LUSC -0.127; TCGA PAAD -0.23; TCGA PRAD -0.086; TCGA STAD -0.167; TCGA UCEC -0.141
hsa-miR-3065-3p
ADAMTS2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.19; TCGA CESC -0.188; TCGA ESCA -0.251; TCGA HNSC -0.245; TCGA KIRC -0.245; TCGA LGG -0.303; TCGA LUAD -0.175; TCGA LUSC -0.284; TCGA THCA -0.261; TCGA STAD -0.204; TCGA UCEC -0.154
hsa-miR-3065-3p
IL2RA
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.261; TCGA BRCA -0.179; TCGA CESC -0.211; TCGA ESCA -0.305; TCGA HNSC -0.306; TCGA KIRC -0.344; TCGA LUAD -0.142; TCGA LUSC -0.266; TCGA PAAD -0.317; TCGA THCA -0.262; TCGA STAD -0.12
hsa-miR-3065-3p
SACS
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.163; TCGA CESC -0.144; TCGA HNSC -0.088; TCGA KIRC -0.144; TCGA KIRP -0.197; TCGA LIHC -0.068; TCGA LUAD -0.117; TCGA LUSC -0.087; TCGA PAAD -0.122; TCGA PRAD -0.143; TCGA SARC -0.081; TCGA THCA -0.121; TCGA UCEC -0.074
hsa-miR-3065-3p
DIXDC1
9 cancers: BLCA; BRCA; CESC; ESCA; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.255; TCGA BRCA -0.139; TCGA CESC -0.103; TCGA ESCA -0.134; TCGA PRAD -0.194; TCGA SARC -0.222; TCGA THCA -0.07; TCGA STAD -0.174; TCGA UCEC -0.148
hsa-miR-3065-3p
TUBA1A
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.117; TCGA CESC -0.151; TCGA ESCA -0.142; TCGA HNSC -0.073; TCGA KIRC -0.156; TCGA KIRP -0.12; TCGA LUAD -0.057; TCGA PRAD -0.128; TCGA STAD -0.051; TCGA UCEC -0.067
hsa-miR-3065-3p
XYLT1
12 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.142; TCGA BRCA -0.114; TCGA ESCA -0.126; TCGA HNSC -0.1; TCGA LGG -0.387; TCGA LUAD -0.126; TCGA LUSC -0.136; TCGA PAAD -0.195; TCGA PRAD -0.222; TCGA SARC -0.098; TCGA STAD -0.084; TCGA UCEC -0.236
hsa-miR-3065-3p
ACSL4
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.157; TCGA BRCA -0.214; TCGA CESC -0.105; TCGA ESCA -0.104; TCGA HNSC -0.111; TCGA LGG -0.067; TCGA LIHC -0.226; TCGA PAAD -0.138; TCGA PRAD -0.142; TCGA SARC -0.07; TCGA THCA -0.052; TCGA UCEC -0.105
hsa-miR-3065-3p
CSPG4
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.246; TCGA BRCA -0.115; TCGA CESC -0.161; TCGA HNSC -0.171; TCGA KIRC -0.326; TCGA LGG -0.261; TCGA LIHC -0.137; TCGA LUSC -0.118; TCGA PRAD -0.165; TCGA SARC -0.256; TCGA STAD -0.202; TCGA UCEC -0.136
hsa-miR-3065-3p
TNS1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.365; TCGA BRCA -0.256; TCGA CESC -0.125; TCGA ESCA -0.178; TCGA HNSC -0.145; TCGA LGG -0.051; TCGA PAAD -0.141; TCGA PRAD -0.316; TCGA SARC -0.396; TCGA STAD -0.248; TCGA UCEC -0.217
hsa-miR-3065-3p
KIAA1644
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; PRAD; THCA; UCEC
mirMAP
TCGA BLCA -0.424; TCGA BRCA -0.108; TCGA CESC -0.251; TCGA ESCA -0.179; TCGA HNSC -0.28; TCGA KIRC -0.145; TCGA LGG -0.33; TCGA LUSC -0.143; TCGA PRAD -0.413; TCGA THCA -0.201; TCGA UCEC -0.31
hsa-miR-3065-3p
PLXDC1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; UCEC
mirMAP
TCGA BLCA -0.094; TCGA BRCA -0.073; TCGA CESC -0.168; TCGA ESCA -0.194; TCGA HNSC -0.158; TCGA KIRC -0.365; TCGA LGG -0.145; TCGA LIHC -0.124; TCGA LUSC -0.104; TCGA UCEC -0.215
hsa-miR-3065-3p
ZCCHC24
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.27; TCGA BRCA -0.174; TCGA CESC -0.11; TCGA ESCA -0.12; TCGA HNSC -0.152; TCGA LGG -0.074; TCGA PAAD -0.16; TCGA PRAD -0.092; TCGA STAD -0.141; TCGA UCEC -0.24
hsa-miR-3065-3p
CIITA
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; PAAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.175; TCGA BRCA -0.11; TCGA ESCA -0.187; TCGA HNSC -0.279; TCGA KIRC -0.085; TCGA LIHC -0.094; TCGA PAAD -0.223; TCGA SARC -0.217; TCGA THCA -0.31; TCGA STAD -0.135
hsa-miR-3065-3p
KIRREL
9 cancers: BLCA; BRCA; ESCA; LGG; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.23; TCGA BRCA -0.265; TCGA ESCA -0.169; TCGA LGG -0.138; TCGA PAAD -0.213; TCGA PRAD -0.371; TCGA SARC -0.158; TCGA THCA -0.1; TCGA STAD -0.137
hsa-miR-3065-3p
SFMBT2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.258; TCGA BRCA -0.121; TCGA CESC -0.157; TCGA ESCA -0.17; TCGA HNSC -0.138; TCGA KIRC -0.078; TCGA LUAD -0.144; TCGA PRAD -0.136; TCGA THCA -0.149; TCGA STAD -0.139; TCGA UCEC -0.2
hsa-miR-3065-3p
LOX
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.142; TCGA BRCA -0.177; TCGA CESC -0.173; TCGA ESCA -0.158; TCGA HNSC -0.22; TCGA KIRC -0.568; TCGA LUAD -0.196; TCGA LUSC -0.153; TCGA PAAD -0.271; TCGA PRAD -0.198; TCGA THCA -0.262; TCGA STAD -0.16
hsa-miR-3065-3p
ENAH
10 cancers: BLCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC
miRNATAP
TCGA BLCA -0.056; TCGA CESC -0.143; TCGA HNSC -0.122; TCGA KIRC -0.061; TCGA LIHC -0.114; TCGA LUAD -0.056; TCGA LUSC -0.142; TCGA PAAD -0.143; TCGA PRAD -0.095; TCGA SARC -0.179
hsa-miR-3065-3p
CCDC50
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.068; TCGA BRCA -0.106; TCGA CESC -0.09; TCGA HNSC -0.106; TCGA KIRC -0.094; TCGA KIRP -0.097; TCGA SARC -0.121; TCGA STAD -0.063; TCGA UCEC -0.051
hsa-miR-3065-3p
BNC2
12 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.264; TCGA BRCA -0.229; TCGA CESC -0.208; TCGA HNSC -0.167; TCGA LUAD -0.09; TCGA LUSC -0.156; TCGA PAAD -0.304; TCGA PRAD -0.304; TCGA SARC -0.109; TCGA THCA -0.115; TCGA STAD -0.24; TCGA UCEC -0.286
hsa-miR-3065-3p
EPB41L2
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.191; TCGA BRCA -0.216; TCGA ESCA -0.178; TCGA HNSC -0.075; TCGA KIRC -0.074; TCGA KIRP -0.066; TCGA PAAD -0.151; TCGA PRAD -0.134; TCGA THCA -0.103; TCGA STAD -0.157; TCGA UCEC -0.063
hsa-miR-3065-3p
COL5A1
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.16; TCGA CESC -0.243; TCGA ESCA -0.236; TCGA HNSC -0.292; TCGA KIRC -0.362; TCGA LGG -0.138; TCGA LUAD -0.178; TCGA LUSC -0.368; TCGA PAAD -0.347; TCGA THCA -0.104; TCGA STAD -0.162; TCGA UCEC -0.213
hsa-miR-3065-3p
ITGA5
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.284; TCGA BRCA -0.067; TCGA CESC -0.259; TCGA ESCA -0.176; TCGA HNSC -0.198; TCGA KIRC -0.336; TCGA LIHC -0.054; TCGA LUAD -0.149; TCGA LUSC -0.073; TCGA PAAD -0.216; TCGA PRAD -0.19; TCGA SARC -0.254; TCGA STAD -0.19; TCGA UCEC -0.1
hsa-miR-3065-3p
FAM65B
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.204; TCGA CESC -0.153; TCGA ESCA -0.151; TCGA HNSC -0.184; TCGA KIRP -0.13; TCGA LGG -0.09; TCGA PRAD -0.227; TCGA SARC -0.192; TCGA UCEC -0.174
hsa-miR-3065-3p
POU2F2
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; PRAD; THCA
miRNATAP
TCGA BLCA -0.236; TCGA BRCA -0.109; TCGA CESC -0.105; TCGA HNSC -0.19; TCGA KIRC -0.301; TCGA LUAD -0.102; TCGA LUSC -0.147; TCGA PRAD -0.185; TCGA THCA -0.235
hsa-miR-3065-3p
SERPINH1
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.066; TCGA CESC -0.113; TCGA ESCA -0.137; TCGA HNSC -0.154; TCGA KIRC -0.222; TCGA KIRP -0.098; TCGA LUSC -0.145; TCGA PAAD -0.206; TCGA STAD -0.084
hsa-miR-3065-3p
PDLIM7
13 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.253; TCGA CESC -0.111; TCGA HNSC -0.169; TCGA KIRC -0.154; TCGA KIRP -0.064; TCGA LIHC -0.065; TCGA LUAD -0.086; TCGA LUSC -0.168; TCGA PAAD -0.121; TCGA PRAD -0.129; TCGA SARC -0.244; TCGA STAD -0.209; TCGA UCEC -0.111
hsa-miR-3065-3p
PIP4K2A
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.062; TCGA ESCA -0.061; TCGA HNSC -0.092; TCGA KIRC -0.077; TCGA PAAD -0.127; TCGA SARC -0.11; TCGA THCA -0.097; TCGA STAD -0.092
hsa-miR-3065-3p
MMP2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.167; TCGA CESC -0.144; TCGA ESCA -0.205; TCGA HNSC -0.211; TCGA KIRC -0.115; TCGA LGG -0.114; TCGA LUAD -0.084; TCGA LUSC -0.2; TCGA PAAD -0.396; TCGA PRAD -0.111; TCGA STAD -0.143; TCGA UCEC -0.275
hsa-miR-3065-3p
DES
10 cancers: BLCA; BRCA; CESC; HNSC; LGG; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.708; TCGA BRCA -0.253; TCGA CESC -0.301; TCGA HNSC -0.565; TCGA LGG -0.274; TCGA PRAD -0.332; TCGA SARC -1.131; TCGA THCA -0.269; TCGA STAD -0.372; TCGA UCEC -0.603
hsa-miR-3065-3p
MMP14
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.094; TCGA CESC -0.183; TCGA ESCA -0.142; TCGA HNSC -0.148; TCGA KIRC -0.173; TCGA LUAD -0.139; TCGA LUSC -0.275; TCGA PAAD -0.337; TCGA PRAD -0.084; TCGA STAD -0.099; TCGA UCEC -0.093
hsa-miR-3065-3p
WISP2
9 cancers: BLCA; BRCA; HNSC; KIRC; LUAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.466; TCGA BRCA -0.232; TCGA HNSC -0.286; TCGA KIRC -0.614; TCGA LUAD -0.098; TCGA PRAD -0.456; TCGA SARC -0.351; TCGA THCA -0.411; TCGA UCEC -0.312
hsa-miR-3065-3p
ARL4C
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA
miRNATAP
TCGA BLCA -0.09; TCGA BRCA -0.127; TCGA CESC -0.125; TCGA HNSC -0.194; TCGA KIRC -0.346; TCGA KIRP -0.183; TCGA LGG -0.232; TCGA LUAD -0.155; TCGA LUSC -0.111; TCGA PAAD -0.148; TCGA THCA -0.212
hsa-miR-3065-3p
ADAM19
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.276; TCGA BRCA -0.061; TCGA CESC -0.178; TCGA ESCA -0.22; TCGA HNSC -0.3; TCGA KIRC -0.281; TCGA LGG -0.147; TCGA LUAD -0.159; TCGA LUSC -0.236; TCGA PAAD -0.188; TCGA PRAD -0.2; TCGA SARC -0.35; TCGA THCA -0.241; TCGA STAD -0.182; TCGA UCEC -0.105
hsa-miR-3065-3p
PLCG1
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA CESC -0.087; TCGA ESCA -0.104; TCGA HNSC -0.07; TCGA KIRC -0.053; TCGA KIRP -0.068; TCGA LUAD -0.055; TCGA PAAD -0.05; TCGA PRAD -0.063; TCGA STAD -0.111; TCGA UCEC -0.057
hsa-miR-3065-3p
PLAU
9 cancers: CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC
miRNATAP
TCGA CESC -0.24; TCGA ESCA -0.18; TCGA HNSC -0.24; TCGA LIHC -0.063; TCGA LUAD -0.133; TCGA LUSC -0.366; TCGA PAAD -0.273; TCGA PRAD -0.101; TCGA SARC -0.164





Enriched cancer pathways of putative targets