microRNA information: hsa-miR-30a-5p

SectionIDlink
Mature name: hsa-miR-30a-5pmiRbase
Accession: MIMAT0000087miRbase
Precursor name: hsa-mir-30a miRbase
Precursor accession: MI0000088miRbase
Symbol: MIR30AHGNC
RefSeq ID: NR_029504GenBank
Sequence: UGUAAACAUCCUCGACUGGAAG



Reported expression in cancers: hsa-miR-30a-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-30a-5p

breast cancerupregulation"Then five up-regulated miRNAs miR-100 miR-29a miR- ......"23994196
hsa-miR-30a-5p

cervical and endocervical cancerdownregulation"Has miR 30a regulates autophagic activity in cervi ......"26463633
hsa-miR-30a-5p

colorectal cancerdownregulation"miRNA 30a miR-30a is a member of the miR-30 family ......"25582198
hsa-miR-30a-5p

colorectal cancerdownregulation"Heterochromatin protein HP1γ promotes colorectal ......"26333808
hsa-miR-30a-5p

colorectal cancerdownregulation"Screening miRNAs for early diagnosis of colorectal ......"27022275RNA-Seq
hsa-miR-30a-5p

colorectal cancerdownregulation"MiRNA-30a-5p a member of the miR-30 family has bee ......"27576787qPCR
hsa-miR-30a-5p

endometrial cancerderegulation"A set of EEC-associated miRNAs in tissue and plasm ......"24491411RNA-Seq
hsa-miR-30a-5p

gastric cancerupregulation"The present study was designed to investigate the ......"27729002
hsa-miR-30a-5p

kidney renal cell cancerdownregulation"We found that expression of miR-30a was significan ......"25712526
hsa-miR-30a-5p

kidney renal cell cancerdownregulation"Integrated analyses allow understanding the interp ......"26002553
hsa-miR-30a-5p

liver cancerdownregulation"MicroRNA 30a 3p inhibits tumor proliferation invas ......"24290372
hsa-miR-30a-5p

liver cancerdownregulation"Effects of microRNA 30a on migration invasion and ......"24954667
hsa-miR-30a-5p

liver cancerdownregulation"Overexpression of microRNA 30a 5p inhibits liver c ......"26589417qPCR
hsa-miR-30a-5p

lung cancerdownregulation"In the consistently reported down-regulated microR ......"22672859
hsa-miR-30a-5p

lung squamous cell cancerdownregulation"Using a chicken embryonic metastasis assay we foun ......"21633953
hsa-miR-30a-5p

lung squamous cell cancerdownregulation"Increasing evidences indicate that miR-30 expressi ......"25249344Reverse transcription PCR; qPCR
hsa-miR-30a-5p

lung squamous cell cancerdownregulation"Expression profile analysis of microRNAs and downr ......"26238736Microarray
hsa-miR-30a-5p

pancreatic cancerupregulation"We focused on miR-30a -30b and -30c in the miR-30 ......"26965588
hsa-miR-30a-5p

prostate cancerdownregulation"MiR-30a and miR-205 are two miRNAs downregulated i ......"27160121
hsa-miR-30a-5p

sarcomaderegulation"Expression profiles of 741 miRNAs were evaluated u ......"26299703qPCR



Reported cancer pathway affected by hsa-miR-30a-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-30a-5p

breast cancerApoptosis pathway"Mir 30 reduction maintains self renewal and inhibi ......"20498642
hsa-miR-30a-5p

breast cancerEpithelial mesenchymal transition pathway"MicroRNA 30a inhibits cell migration and invasion ......"22476851Western blot; Luciferase
hsa-miR-30a-5p

breast cancerApoptosis pathway"MicroRNA miR 30 family regulates non attachment gr ......"23445407
hsa-miR-30a-5p

breast cancerPI3K/Akt signaling pathway"Mutation R273H confers p53 a stimulating effect on ......"26898459
hsa-miR-30a-5p

breast cancerEpithelial mesenchymal transition pathway"MicroRNA 30a increases tight junction protein expr ......"26918943
hsa-miR-30a-5p

chronic myeloid leukemiaApoptosis pathway"Targeting microRNA 30a mediated autophagy enhances ......"22395361
hsa-miR-30a-5p

chronic myeloid leukemiacell cycle pathway"Decreased microRNA 30a levels are associated with ......"23287430
hsa-miR-30a-5p

colon cancercell cycle pathway"MiR 30a 5p suppresses tumor growth in colon carcin ......"22287560
hsa-miR-30a-5p

colorectal cancerApoptosis pathway"Association of Beclin 1 and microRNA 30a expressio ......"27173217
hsa-miR-30a-5p

colorectal cancerEpithelial mesenchymal transition pathway"MiR 30a 5p Suppresses Tumor Metastasis of Human Co ......"27576787Western blot; Luciferase; Transwell assay
hsa-miR-30a-5p

gastric cancerEpithelial mesenchymal transition pathway"RUNX3 regulates vimentin expression via miR 30a du ......"24447545
hsa-miR-30a-5p

gastric cancerApoptosis pathway"miR 30 functions as an oncomiR in gastric cancer c ......"27729002
hsa-miR-30a-5p

kidney renal cell cancerApoptosis pathway"MiRNA-30a miR-30a is a potent inhibitor of autopha ......"25712526
hsa-miR-30a-5p

liver cancerEpithelial mesenchymal transition pathway"Effects of microRNA 30a on migration invasion and ......"24954667
hsa-miR-30a-5p

liver cancerApoptosis pathway"Effect of miR 30a 5p on the proliferation apoptosi ......"25654285Flow cytometry; Colony formation
hsa-miR-30a-5p

liver cancerApoptosis pathway"Overexpression of microRNA 30a 5p inhibits liver c ......"26589417Flow cytometry; Western blot; Luciferase
hsa-miR-30a-5p

lung cancercell cycle pathway"Overexpression of microRNA miR 30a or miR 191 in A ......"20169152Colony formation
hsa-miR-30a-5p

lung cancercell cycle pathway"Overexpression of miR 30a in lung adenocarcinoma A ......"26837415Flow cytometry; Cell proliferation assay; Cell Proliferation Assay; Wound Healing Assay; Luciferase
hsa-miR-30a-5p

lung squamous cell cancerEpithelial mesenchymal transition pathway"AEG 1 3' untranslated region functions as a ceRNA ......"25484183
hsa-miR-30a-5p

lung squamous cell cancerPI3K/Akt signaling pathway"MiR 30a suppresses non small cell lung cancer prog ......"26025408Luciferase
hsa-miR-30a-5p

ovarian cancerApoptosis pathway"miR 30a inhibits endothelin A receptor and chemore ......"26675258
hsa-miR-30a-5p

sarcomacell cycle pathway"The overexpression of miR 30a affects cell prolife ......"26596830Colony formation; Flow cytometry; Luciferase
hsa-miR-30a-5p

thyroid cancerEpithelial mesenchymal transition pathway"We identified two significantly decreased microRNA ......"20498632



Reported cancer prognosis affected by hsa-miR-30a-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-30a-5p

breast cancermetastasis; tumorigenesis"Mir 30 reduction maintains self renewal and inhibi ......"20498642
hsa-miR-30a-5p

breast cancerdrug resistance"MiRNA microarray analysis identified 299 and 226 m ......"21399894
hsa-miR-30a-5p

breast cancercell migration; metastasis; progression; poor survival; staging; recurrence"MicroRNA 30a inhibits cell migration and invasion ......"22476851Western blot; Luciferase
hsa-miR-30a-5p

breast cancerprogression"MicroRNA miR 30 family regulates non attachment gr ......"23445407
hsa-miR-30a-5p

breast cancermetastasis"MicroRNA 30a suppresses breast tumor growth and me ......"23851509Luciferase
hsa-miR-30a-5p

breast cancerdrug resistance"In present study miRNA expression profiles of MCF- ......"23994196
hsa-miR-30a-5p

breast cancerprogression"miR 30a suppresses breast cancer cell proliferatio ......"24508260
hsa-miR-30a-5p

breast cancerprogression"Downregulation of β3 integrin by miR 30a 5p modul ......"26781040Luciferase
hsa-miR-30a-5p

breast cancermetastasis; malignant trasformation"MicroRNA 30a increases tight junction protein expr ......"26918943
hsa-miR-30a-5p

chronic myeloid leukemiaprogression"Decreased microRNA 30a levels are associated with ......"23287430
hsa-miR-30a-5p

colorectal cancercell migration; metastasis"miR 30a suppresses cell migration and invasion thr ......"23486085Luciferase
hsa-miR-30a-5p

colorectal cancertumorigenesis; staging"Role of microRNA 30a targeting insulin receptor su ......"25582198Luciferase
hsa-miR-30a-5p

colorectal cancermalignant trasformation"MiR-30c belongs to miR-30 family and is involved i ......"25799050
hsa-miR-30a-5p

colorectal cancerprogression"Heterochromatin protein HP1γ promotes colorectal ......"26333808
hsa-miR-30a-5p

colorectal cancerworse prognosis"Screening miRNAs for early diagnosis of colorectal ......"27022275
hsa-miR-30a-5p

colorectal cancerdrug resistance"Association of Beclin 1 and microRNA 30a expressio ......"27173217
hsa-miR-30a-5p

colorectal cancermetastasis"MiR 30a 5p Suppresses Tumor Metastasis of Human Co ......"27576787Western blot; Luciferase; Transwell assay
hsa-miR-30a-5p

gastric cancerpoor survival"Several microarray studies have reported microRNA ......"19951901
hsa-miR-30a-5p

head and neck cancerprogression"Alcohol dysregulated miR 30a and miR 934 in head a ......"26472042
hsa-miR-30a-5p

kidney renal cell cancermetastasis; poor survival"Integrated analyses allow understanding the interp ......"26002553
hsa-miR-30a-5p

liver cancermetastasis"MicroRNA 30a 3p inhibits tumor proliferation invas ......"24290372
hsa-miR-30a-5p

liver cancerworse prognosis; progression; poor survival; cell migration; metastasis"Effects of microRNA 30a on migration invasion and ......"24954667
hsa-miR-30a-5p

lung cancercell migration"Overexpression of microRNA miR 30a or miR 191 in A ......"20169152Colony formation
hsa-miR-30a-5p

lung cancerworse prognosis; staging; metastasis; tumor size; poor survival"Downregulation of MiR 30a is Associated with Poor ......"26305739
hsa-miR-30a-5p

lung cancerprogression; cell migration"Overexpression of miR 30a in lung adenocarcinoma A ......"26837415Flow cytometry; Cell proliferation assay; Cell Proliferation Assay; Wound Healing Assay; Luciferase
hsa-miR-30a-5p

lung squamous cell cancermetastasis"MicroRNA 30a inhibits epithelial to mesenchymal tr ......"21633953
hsa-miR-30a-5p

lung squamous cell cancerpoor survival"BCL11A overexpression predicts survival and relaps ......"23758992Western blot; Luciferase
hsa-miR-30a-5p

lung squamous cell cancertumorigenesis"Increasing evidences indicate that miR-30 expressi ......"25249344Luciferase; Western blot; MTT assay
hsa-miR-30a-5p

lung squamous cell cancermetastasis"AEG 1 3' untranslated region functions as a ceRNA ......"25484183
hsa-miR-30a-5p

lung squamous cell cancerprogression"MiR 30a suppresses non small cell lung cancer prog ......"26025408Luciferase
hsa-miR-30a-5p

ovarian cancerpoor survival"The Cox proportional hazards model and the log-ran ......"21345725
hsa-miR-30a-5p

ovarian cancerdrug resistance"miR 30a inhibits endothelin A receptor and chemore ......"26675258
hsa-miR-30a-5p

ovarian cancerdrug resistance"Expression of microRNA 30a 5p in drug resistant an ......"27602140
hsa-miR-30a-5p

sarcomaworse prognosis"Association of SOX4 regulated by tumor suppressor ......"25572678
hsa-miR-30a-5p

thyroid cancercell migration"However specific miRNAs are downregulated in ATC s ......"25202329



Reported gene related to hsa-miR-30a-5p

miRNAcancergenereportingPUBMED
hsa-miR-30a-5p

chronic myeloid leukemiaBECN1"miR-30a is a potent inhibitor of autophagy by down ......"22395361
hsa-miR-30a-5p

colorectal cancerBECN1"Association of Beclin 1 and microRNA 30a expressio ......"27173217
hsa-miR-30a-5p

gastric cancerBECN1"Fluorouracil induces autophagy related gastric car ......"26209295
hsa-miR-30a-5p

kidney renal cell cancerBECN1"MiRNA-30a miR-30a is a potent inhibitor of autopha ......"25712526
hsa-miR-30a-5p

breast cancerVIM"MicroRNA 30a inhibits cell migration and invasion ......"22476851
hsa-miR-30a-5p

gastric cancerVIM"RUNX3 regulates vimentin expression via miR 30a du ......"24447545
hsa-miR-30a-5p

gastric cancerVIM"Knockdown of endogenous miR-30a promoted the elong ......"27212164
hsa-miR-30a-5p

prostate cancerVIM"Furthermore low-expression levels of miR-30a and h ......"25409297
hsa-miR-30a-5p

breast cancerMTDH"MicroRNA 30a suppresses breast tumor growth and me ......"23851509
hsa-miR-30a-5p

liver cancerMTDH"Luciferase assay showed that metadherin MTDH mRNA ......"26589417
hsa-miR-30a-5p

lung squamous cell cancerMTDH"AEG 1 3' untranslated region functions as a ceRNA ......"25484183
hsa-miR-30a-5p

gastric cancerSNAI1"Knockdown of endogenous miR-30a promoted the elong ......"27212164
hsa-miR-30a-5p

liver cancerSNAI1"We identified SNAI1 as a direct target of miR-30a ......"24954667
hsa-miR-30a-5p

lung squamous cell cancerSNAI1"MicroRNA 30a inhibits epithelial to mesenchymal tr ......"21633953
hsa-miR-30a-5p

breast cancerTP53"Mutation R273H confers p53 a stimulating effect on ......"26898459
hsa-miR-30a-5p

colon cancerTP53"In addition TP53 and CDKN1A expression were increa ......"22287560
hsa-miR-30a-5p

gastric cancerTP53"miR 30 functions as an oncomiR in gastric cancer c ......"27729002
hsa-miR-30a-5p

breast cancerEYA2"miR 30a suppresses breast cancer cell proliferatio ......"24508260
hsa-miR-30a-5p

lung cancerEYA2"Overexpression of miR 30a in lung adenocarcinoma A ......"26837415
hsa-miR-30a-5p

breast cancerITGA9"Downregulation of β3 integrin by miR 30a 5p modul ......"26781040
hsa-miR-30a-5p

colorectal cancerITGA9"Bioinformatic algorithms and luciferase reporter a ......"27576787
hsa-miR-30a-5p

breast cancerITGB3"Enforced constitutive expression of mir-30 in BT-I ......"20498642
hsa-miR-30a-5p

colorectal cancerITGB3"MiR 30a 5p Suppresses Tumor Metastasis of Human Co ......"27576787
hsa-miR-30a-5p

chronic myeloid leukemiaABL1"In K562 leukemia cells overexpression of miR-30a r ......"23287430
hsa-miR-30a-5p

prostate cancerAR"Results uncovered miR-30 family members as direct ......"27683042
hsa-miR-30a-5p

chronic myeloid leukemiaATG5"miR-30a is a potent inhibitor of autophagy by down ......"22395361
hsa-miR-30a-5p

thyroid cancerATM"However specific miRNAs are downregulated in ATC s ......"25202329
hsa-miR-30a-5p

breast cancerAVEN"At least one of these targets the anti-apoptotic p ......"23445407
hsa-miR-30a-5p

lung squamous cell cancerBCL11A"BCL11A overexpression predicts survival and relaps ......"23758992
hsa-miR-30a-5p

head and neck cancerBCL2"Overexpression of miR-30a and miR-934 in normal an ......"26472042
hsa-miR-30a-5p

B cell lymphomaBCL6"It was also shown that the patients with BCL-6 pro ......"23450486
hsa-miR-30a-5p

lung squamous cell cancerCDH1"Consistent with this microRNA-30a expression was f ......"21633953
hsa-miR-30a-5p

lung squamous cell cancerCDH2"Consistent with this microRNA-30a expression was f ......"21633953
hsa-miR-30a-5p

colon cancerCDKN1A"In addition TP53 and CDKN1A expression were increa ......"22287560
hsa-miR-30a-5p

thyroid cancerCHST14"We identified two significantly decreased microRNA ......"20498632
hsa-miR-30a-5p

prostate cancerDICER1"The expression change of miR-30a miR-205 and Dicer ......"27160121
hsa-miR-30a-5p

colorectal cancerDLL1"A luciferase reporter assay was performed to deter ......"23486085
hsa-miR-30a-5p

colon cancerDTL"MiR 30a 5p suppresses tumor growth in colon carcin ......"22287560
hsa-miR-30a-5p

ovarian cancerEDNRA"miR 30a inhibits endothelin A receptor and chemore ......"26675258
hsa-miR-30a-5p

lung squamous cell cancerIGF1R"MiR 30a suppresses non small cell lung cancer prog ......"26025408
hsa-miR-30a-5p

colorectal cancerINSR"Role of microRNA 30a targeting insulin receptor su ......"25582198
hsa-miR-30a-5p

colorectal cancerIRS2"Moreover bioinformatic algorithms and luciferase r ......"25582198
hsa-miR-30a-5p

ovarian cancerMAP2K6"Overexpression of miR-30a decreased Akt and mitoge ......"26675258
hsa-miR-30a-5p

colorectal cancerPIK3CD"miR 30a suppresses cell migration and invasion thr ......"23486085
hsa-miR-30a-5p

pancreatic cancerPROM1"Using miRNA microarray we found that the expressio ......"26965588
hsa-miR-30a-5p

sarcomaRUNX2"The overexpression of miR 30a affects cell prolife ......"26596830
hsa-miR-30a-5p

gastric cancerRUNX3"RUNX3 regulates vimentin expression via miR 30a du ......"24447545
hsa-miR-30a-5p

breast cancerSNAI2"MicroRNA 30a increases tight junction protein expr ......"26918943
hsa-miR-30a-5p

sarcomaSOX4"Association of SOX4 regulated by tumor suppressor ......"25572678
hsa-miR-30a-5p

gastric cancerTIMM8A"In this study we investigated the association betw ......"27212164
hsa-miR-30a-5p

prostate cancerTP53INP1"MiR 30a and miR 205 are downregulated in hypoxia a ......"27160121
hsa-miR-30a-5p

prostate cancerTWIST1"Furthermore low-expression levels of miR-30a and h ......"25409297
hsa-miR-30a-5p

breast cancerUBE2I"Enforced constitutive expression of mir-30 in BT-I ......"20498642
hsa-miR-30a-5p

breast cancerUBE3C"In this study we report that UBE3C was a direct ta ......"27003255



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-30a-5p
ASCC3
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.092; TCGA BRCA -0.093; TCGA ESCA -0.082; TCGA HNSC -0.112; TCGA KIRP -0.126; TCGA LGG -0.089; TCGA LIHC -0.078; TCGA LUAD -0.075; TCGA LUSC -0.098; TCGA PRAD -0.235; TCGA THCA -0.34; TCGA STAD -0.252; TCGA UCEC -0.071
hsa-miR-30a-5p
ATL2
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; OV; PRAD; THCA
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.08; TCGA COAD -0.103; TCGA ESCA -0.106; TCGA LGG -0.055; TCGA LUAD -0.103; TCGA LUSC -0.129; TCGA OV -0.077; TCGA PRAD -0.122; TCGA THCA -0.088
hsa-miR-30a-5p
AVEN
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.08; TCGA BRCA -0.183; TCGA CESC -0.108; TCGA ESCA -0.158; TCGA HNSC -0.091; TCGA KIRC -0.548; TCGA KIRP -0.252; TCGA LIHC -0.106; TCGA LUAD -0.158; TCGA LUSC -0.211; TCGA SARC -0.095; TCGA THCA -0.31; TCGA STAD -0.093; TCGA UCEC -0.127
hsa-miR-30a-5p
BAZ1B
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.108; TCGA BRCA -0.093; TCGA CESC -0.075; TCGA HNSC -0.077; TCGA KIRC -0.148; TCGA LUAD -0.087; TCGA LUSC -0.129; TCGA PAAD -0.092; TCGA PRAD -0.12; TCGA STAD -0.078; TCGA UCEC -0.078
hsa-miR-30a-5p
BMS1
9 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.051; TCGA BRCA -0.063; TCGA COAD -0.186; TCGA ESCA -0.106; TCGA LGG -0.243; TCGA LUAD -0.111; TCGA LUSC -0.13; TCGA SARC -0.071; TCGA STAD -0.185
hsa-miR-30a-5p
CDC20
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.144; TCGA BRCA -0.42; TCGA COAD -0.333; TCGA ESCA -0.481; TCGA HNSC -0.274; TCGA KIRC -0.992; TCGA KIRP -0.836; TCGA LGG -0.456; TCGA LIHC -0.687; TCGA LUAD -0.66; TCGA LUSC -0.901; TCGA PRAD -0.275; TCGA THCA -0.393; TCGA STAD -0.713
hsa-miR-30a-5p
CPOX
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; STAD
miRNAWalker2 validate
TCGA BLCA -0.068; TCGA CESC -0.149; TCGA COAD -0.271; TCGA ESCA -0.143; TCGA HNSC -0.088; TCGA KIRC -0.42; TCGA KIRP -0.225; TCGA LUAD -0.13; TCGA LUSC -0.257; TCGA STAD -0.32
hsa-miR-30a-5p
CSNK1G1
10 cancers: BLCA; CESC; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate; MirTarget; mirMAP
TCGA BLCA -0.081; TCGA CESC -0.069; TCGA ESCA -0.094; TCGA HNSC -0.133; TCGA LGG -0.078; TCGA LIHC -0.053; TCGA LUSC -0.127; TCGA PRAD -0.187; TCGA STAD -0.124; TCGA UCEC -0.071
hsa-miR-30a-5p
DARS2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.12; TCGA BRCA -0.119; TCGA CESC -0.075; TCGA COAD -0.152; TCGA ESCA -0.141; TCGA HNSC -0.142; TCGA LIHC -0.138; TCGA LUAD -0.238; TCGA LUSC -0.324; TCGA PRAD -0.171; TCGA SARC -0.119; TCGA STAD -0.347
hsa-miR-30a-5p
DDX10
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.076; TCGA COAD -0.237; TCGA ESCA -0.116; TCGA LGG -0.223; TCGA LUAD -0.129; TCGA LUSC -0.211; TCGA SARC -0.093; TCGA STAD -0.19; TCGA UCEC -0.053
hsa-miR-30a-5p
DHX8
10 cancers: BLCA; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.068; TCGA ESCA -0.061; TCGA HNSC -0.096; TCGA LGG -0.156; TCGA LUSC -0.133; TCGA PAAD -0.053; TCGA PRAD -0.145; TCGA THCA -0.086; TCGA STAD -0.08; TCGA UCEC -0.081
hsa-miR-30a-5p
DTL
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.149; TCGA BRCA -0.263; TCGA CESC -0.113; TCGA COAD -0.414; TCGA ESCA -0.298; TCGA HNSC -0.228; TCGA KIRC -0.86; TCGA KIRP -0.591; TCGA LGG -0.797; TCGA LIHC -0.451; TCGA LUAD -0.397; TCGA LUSC -0.618; TCGA OV -0.089; TCGA PRAD -0.309; TCGA SARC -0.139; TCGA THCA -0.459; TCGA STAD -0.69; TCGA UCEC -0.151
hsa-miR-30a-5p
EXOSC10
9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.053; TCGA CESC -0.087; TCGA COAD -0.088; TCGA ESCA -0.067; TCGA KIRP -0.088; TCGA LUAD -0.065; TCGA PRAD -0.063; TCGA THCA -0.121; TCGA STAD -0.13
hsa-miR-30a-5p
FSCN1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; OV
miRNAWalker2 validate
TCGA BLCA -0.143; TCGA BRCA -0.092; TCGA CESC -0.399; TCGA ESCA -0.539; TCGA HNSC -0.453; TCGA KIRC -0.693; TCGA KIRP -0.214; TCGA LUSC -0.522; TCGA OV -0.158
hsa-miR-30a-5p
FXR1
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC
miRNAWalker2 validate; RAID
TCGA BLCA -0.078; TCGA CESC -0.084; TCGA ESCA -0.119; TCGA KIRC -0.114; TCGA KIRP -0.093; TCGA LGG -0.064; TCGA LIHC -0.073; TCGA LUAD -0.086; TCGA LUSC -0.304; TCGA SARC -0.063
hsa-miR-30a-5p
G3BP1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.062; TCGA CESC -0.079; TCGA COAD -0.206; TCGA ESCA -0.18; TCGA HNSC -0.097; TCGA KIRP -0.13; TCGA LUAD -0.094; TCGA LUSC -0.183; TCGA PRAD -0.065; TCGA SARC -0.072; TCGA THCA -0.119; TCGA STAD -0.249
hsa-miR-30a-5p
GALNT7
9 cancers: BLCA; COAD; KIRC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.118; TCGA COAD -0.191; TCGA KIRC -0.202; TCGA KIRP -0.287; TCGA LUAD -0.141; TCGA LUSC -0.166; TCGA THCA -0.629; TCGA STAD -0.119; TCGA UCEC -0.155
hsa-miR-30a-5p
GATC
9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.102; TCGA COAD -0.2; TCGA ESCA -0.107; TCGA HNSC -0.136; TCGA LIHC -0.075; TCGA LUAD -0.157; TCGA LUSC -0.183; TCGA PRAD -0.141; TCGA STAD -0.19
hsa-miR-30a-5p
GPD2
9 cancers: BLCA; CESC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.149; TCGA CESC -0.093; TCGA KIRP -0.115; TCGA LIHC -0.07; TCGA LUAD -0.085; TCGA LUSC -0.194; TCGA PRAD -0.106; TCGA THCA -0.115; TCGA STAD -0.206
hsa-miR-30a-5p
GRPEL2
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.061; TCGA CESC -0.12; TCGA COAD -0.31; TCGA ESCA -0.132; TCGA HNSC -0.077; TCGA KIRC -0.083; TCGA LIHC -0.107; TCGA LUAD -0.06; TCGA LUSC -0.126; TCGA PAAD -0.104; TCGA PRAD -0.053; TCGA STAD -0.226
hsa-miR-30a-5p
HDAC1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD
miRNAWalker2 validate
TCGA BLCA -0.053; TCGA CESC -0.086; TCGA COAD -0.219; TCGA ESCA -0.085; TCGA HNSC -0.097; TCGA KIRP -0.124; TCGA LIHC -0.146; TCGA LUAD -0.073; TCGA LUSC -0.228; TCGA STAD -0.209
hsa-miR-30a-5p
HDGF
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.065; TCGA BRCA -0.078; TCGA ESCA -0.177; TCGA HNSC -0.086; TCGA KIRP -0.117; TCGA LGG -0.159; TCGA LIHC -0.068; TCGA LUAD -0.224; TCGA LUSC -0.255; TCGA OV -0.065; TCGA SARC -0.141; TCGA THCA -0.138; TCGA STAD -0.197
hsa-miR-30a-5p
KIF11
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.198; TCGA BRCA -0.298; TCGA CESC -0.116; TCGA COAD -0.359; TCGA ESCA -0.281; TCGA HNSC -0.189; TCGA KIRC -0.547; TCGA KIRP -0.495; TCGA LGG -0.674; TCGA LIHC -0.333; TCGA LUAD -0.478; TCGA LUSC -0.689; TCGA OV -0.102; TCGA PRAD -0.167; TCGA THCA -0.392; TCGA STAD -0.628
hsa-miR-30a-5p
KPNA1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; THCA
miRNAWalker2 validate
TCGA BLCA -0.062; TCGA BRCA -0.079; TCGA CESC -0.113; TCGA ESCA -0.093; TCGA HNSC -0.124; TCGA LUAD -0.08; TCGA LUSC -0.149; TCGA PRAD -0.095; TCGA THCA -0.104
hsa-miR-30a-5p
KRT6B
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUSC; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.549; TCGA CESC -1.186; TCGA ESCA -1.163; TCGA HNSC -0.71; TCGA KIRP -0.489; TCGA LUSC -1.562; TCGA PRAD -0.299; TCGA SARC -0.361; TCGA THCA -1.257; TCGA UCEC -0.542
hsa-miR-30a-5p
LARP4
9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate; mirMAP; miRNATAP
TCGA BLCA -0.056; TCGA CESC -0.052; TCGA COAD -0.204; TCGA HNSC -0.06; TCGA LUAD -0.125; TCGA LUSC -0.054; TCGA PAAD -0.103; TCGA PRAD -0.093; TCGA STAD -0.221
hsa-miR-30a-5p
LCLAT1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.122; TCGA BRCA -0.125; TCGA COAD -0.193; TCGA ESCA -0.069; TCGA HNSC -0.136; TCGA LGG -0.146; TCGA LUAD -0.16; TCGA LUSC -0.277; TCGA PAAD -0.116; TCGA STAD -0.191
hsa-miR-30a-5p
LIG3
11 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.106; TCGA KIRC -0.062; TCGA KIRP -0.178; TCGA LGG -0.231; TCGA LIHC -0.097; TCGA LUAD -0.175; TCGA LUSC -0.23; TCGA PAAD -0.138; TCGA SARC -0.173; TCGA STAD -0.129; TCGA UCEC -0.057
hsa-miR-30a-5p
MAK16
9 cancers: BLCA; COAD; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.059; TCGA COAD -0.324; TCGA KIRP -0.082; TCGA LGG -0.139; TCGA LUAD -0.073; TCGA LUSC -0.059; TCGA PRAD -0.067; TCGA STAD -0.223; TCGA UCEC -0.062
hsa-miR-30a-5p
MLLT11
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.149; TCGA BRCA -0.169; TCGA CESC -0.15; TCGA ESCA -0.289; TCGA KIRC -0.476; TCGA KIRP -0.489; TCGA LGG -0.677; TCGA LUAD -0.471; TCGA LUSC -0.604; TCGA OV -0.156; TCGA THCA -0.419; TCGA UCEC -0.22
hsa-miR-30a-5p
MTDH
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.123; TCGA COAD -0.163; TCGA ESCA -0.152; TCGA HNSC -0.155; TCGA KIRC -0.143; TCGA KIRP -0.105; TCGA LGG -0.075; TCGA LIHC -0.102; TCGA LUAD -0.139; TCGA LUSC -0.104; TCGA OV -0.122; TCGA PRAD -0.211; TCGA STAD -0.193
hsa-miR-30a-5p
NCL
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD
miRNAWalker2 validate
TCGA BLCA -0.069; TCGA COAD -0.184; TCGA ESCA -0.123; TCGA HNSC -0.062; TCGA KIRC -0.055; TCGA KIRP -0.097; TCGA LGG -0.108; TCGA LIHC -0.075; TCGA LUAD -0.137; TCGA LUSC -0.172; TCGA STAD -0.258
hsa-miR-30a-5p
NOL9
10 cancers: BLCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.089; TCGA CESC -0.079; TCGA HNSC -0.091; TCGA KIRP -0.094; TCGA LGG -0.118; TCGA LUAD -0.059; TCGA LUSC -0.067; TCGA PRAD -0.071; TCGA SARC -0.098; TCGA STAD -0.086
hsa-miR-30a-5p
PAICS
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.101; TCGA BRCA -0.082; TCGA COAD -0.36; TCGA ESCA -0.201; TCGA HNSC -0.128; TCGA KIRP -0.198; TCGA LUAD -0.314; TCGA LUSC -0.448; TCGA SARC -0.094; TCGA STAD -0.432; TCGA UCEC -0.073
hsa-miR-30a-5p
PAIP1
9 cancers: BLCA; COAD; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.073; TCGA COAD -0.102; TCGA LGG -0.093; TCGA LUAD -0.166; TCGA LUSC -0.183; TCGA PAAD -0.085; TCGA PRAD -0.07; TCGA THCA -0.073; TCGA STAD -0.143
hsa-miR-30a-5p
PDCD10
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.056; TCGA BRCA -0.06; TCGA CESC -0.153; TCGA COAD -0.114; TCGA ESCA -0.182; TCGA HNSC -0.142; TCGA LUAD -0.096; TCGA LUSC -0.253; TCGA PRAD -0.095; TCGA THCA -0.078; TCGA STAD -0.064
hsa-miR-30a-5p
PPP1CC
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD
miRNAWalker2 validate
TCGA BLCA -0.054; TCGA CESC -0.057; TCGA COAD -0.169; TCGA ESCA -0.103; TCGA KIRC -0.18; TCGA KIRP -0.078; TCGA LGG -0.094; TCGA LIHC -0.151; TCGA LUAD -0.142; TCGA LUSC -0.134; TCGA STAD -0.128
hsa-miR-30a-5p
PRMT1
11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.071; TCGA COAD -0.276; TCGA ESCA -0.139; TCGA KIRC -0.17; TCGA KIRP -0.109; TCGA LGG -0.066; TCGA LIHC -0.084; TCGA LUAD -0.127; TCGA LUSC -0.162; TCGA PAAD -0.096; TCGA STAD -0.203
hsa-miR-30a-5p
PRPF40A
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.105; TCGA BRCA -0.054; TCGA COAD -0.132; TCGA ESCA -0.082; TCGA HNSC -0.103; TCGA KIRP -0.077; TCGA LGG -0.198; TCGA LUAD -0.109; TCGA LUSC -0.125; TCGA PRAD -0.129; TCGA STAD -0.19
hsa-miR-30a-5p
PTGFRN
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.105; TCGA BRCA -0.068; TCGA CESC -0.137; TCGA ESCA -0.235; TCGA HNSC -0.295; TCGA KIRC -0.481; TCGA KIRP -0.191; TCGA LUAD -0.132; TCGA LUSC -0.423; TCGA PRAD -0.238; TCGA THCA -0.331; TCGA UCEC -0.163
hsa-miR-30a-5p
RPP40
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.082; TCGA BRCA -0.157; TCGA CESC -0.092; TCGA COAD -0.232; TCGA ESCA -0.306; TCGA HNSC -0.105; TCGA KIRC -0.187; TCGA KIRP -0.299; TCGA LGG -0.118; TCGA LIHC -0.157; TCGA LUAD -0.187; TCGA LUSC -0.396; TCGA THCA -0.108; TCGA STAD -0.25
hsa-miR-30a-5p
RPRD1A
10 cancers: BLCA; CESC; COAD; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.094; TCGA CESC -0.058; TCGA COAD -0.181; TCGA LGG -0.125; TCGA LIHC -0.088; TCGA LUAD -0.096; TCGA LUSC -0.09; TCGA PAAD -0.116; TCGA THCA -0.113; TCGA STAD -0.116
hsa-miR-30a-5p
RRM2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.19; TCGA BRCA -0.532; TCGA CESC -0.16; TCGA COAD -0.503; TCGA ESCA -0.408; TCGA HNSC -0.289; TCGA KIRC -1.194; TCGA KIRP -1.016; TCGA LGG -0.775; TCGA LIHC -0.586; TCGA LUAD -0.558; TCGA LUSC -0.79; TCGA PRAD -0.286; TCGA THCA -0.948; TCGA STAD -0.719
hsa-miR-30a-5p
RRP15
10 cancers: BLCA; COAD; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.06; TCGA COAD -0.152; TCGA KIRP -0.084; TCGA LGG -0.167; TCGA LIHC -0.129; TCGA LUAD -0.112; TCGA LUSC -0.091; TCGA PRAD -0.056; TCGA STAD -0.14; TCGA UCEC -0.091
hsa-miR-30a-5p
SCD
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.225; TCGA BRCA -0.269; TCGA CESC -0.203; TCGA ESCA -0.413; TCGA HNSC -0.335; TCGA KIRC -1.07; TCGA KIRP -0.459; TCGA LIHC -0.24; TCGA LUAD -0.097; TCGA PRAD -0.313; TCGA THCA -1.09; TCGA STAD -0.513; TCGA UCEC -0.196
hsa-miR-30a-5p
SEC23A
13 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.088; TCGA BRCA -0.159; TCGA HNSC -0.17; TCGA KIRC -0.436; TCGA KIRP -0.327; TCGA LGG -0.082; TCGA LUAD -0.225; TCGA LUSC -0.103; TCGA OV -0.105; TCGA PRAD -0.238; TCGA SARC -0.094; TCGA THCA -0.392; TCGA UCEC -0.104
hsa-miR-30a-5p
SF3B3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.058; TCGA BRCA -0.13; TCGA CESC -0.113; TCGA COAD -0.152; TCGA ESCA -0.112; TCGA HNSC -0.095; TCGA KIRC -0.107; TCGA LGG -0.244; TCGA LUAD -0.077; TCGA LUSC -0.188; TCGA PRAD -0.087; TCGA THCA -0.1; TCGA STAD -0.276; TCGA UCEC -0.107
hsa-miR-30a-5p
SLC38A2
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; THCA
miRNAWalker2 validate; mirMAP; miRNATAP
TCGA BLCA -0.109; TCGA CESC -0.16; TCGA ESCA -0.133; TCGA HNSC -0.222; TCGA KIRC -0.217; TCGA KIRP -0.16; TCGA LGG -0.213; TCGA LUSC -0.119; TCGA THCA -0.07
hsa-miR-30a-5p
SMN2
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.067; TCGA CESC -0.075; TCGA COAD -0.266; TCGA ESCA -0.154; TCGA KIRC -0.149; TCGA KIRP -0.085; TCGA LGG -0.072; TCGA LIHC -0.107; TCGA LUAD -0.156; TCGA LUSC -0.136; TCGA PAAD -0.097; TCGA STAD -0.202
hsa-miR-30a-5p
STRN
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; STAD
miRNAWalker2 validate; mirMAP
TCGA BLCA -0.136; TCGA BRCA -0.105; TCGA CESC -0.121; TCGA ESCA -0.096; TCGA HNSC -0.162; TCGA LUAD -0.064; TCGA LUSC -0.135; TCGA PRAD -0.529; TCGA STAD -0.082
hsa-miR-30a-5p
TMED10
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.071; TCGA COAD -0.183; TCGA ESCA -0.066; TCGA HNSC -0.057; TCGA KIRC -0.104; TCGA KIRP -0.101; TCGA LUAD -0.051; TCGA LUSC -0.076; TCGA OV -0.07; TCGA PAAD -0.105; TCGA STAD -0.068
hsa-miR-30a-5p
TMED2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.062; TCGA COAD -0.309; TCGA ESCA -0.051; TCGA HNSC -0.054; TCGA KIRC -0.175; TCGA KIRP -0.11; TCGA LUAD -0.224; TCGA LUSC -0.132; TCGA OV -0.06; TCGA PAAD -0.119; TCGA STAD -0.146
hsa-miR-30a-5p
TNPO3
10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.108; TCGA BRCA -0.083; TCGA CESC -0.161; TCGA HNSC -0.122; TCGA LGG -0.173; TCGA LUAD -0.074; TCGA LUSC -0.134; TCGA PRAD -0.287; TCGA STAD -0.113; TCGA UCEC -0.06
hsa-miR-30a-5p
TPI1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.105; TCGA BRCA -0.127; TCGA COAD -0.322; TCGA ESCA -0.229; TCGA HNSC -0.106; TCGA KIRC -0.263; TCGA KIRP -0.101; TCGA LIHC -0.078; TCGA LUAD -0.234; TCGA LUSC -0.329; TCGA PAAD -0.143; TCGA STAD -0.216; TCGA UCEC -0.089
hsa-miR-30a-5p
TRIM28
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.069; TCGA COAD -0.143; TCGA ESCA -0.107; TCGA HNSC -0.059; TCGA KIRC -0.145; TCGA KIRP -0.097; TCGA LGG -0.125; TCGA LIHC -0.141; TCGA LUAD -0.132; TCGA LUSC -0.216; TCGA SARC -0.118; TCGA STAD -0.262
hsa-miR-30a-5p
TWF1
11 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.101; TCGA COAD -0.175; TCGA ESCA -0.109; TCGA HNSC -0.154; TCGA KIRP -0.165; TCGA LUAD -0.195; TCGA LUSC -0.239; TCGA PAAD -0.11; TCGA PRAD -0.175; TCGA THCA -0.126; TCGA STAD -0.177
hsa-miR-30a-5p
USP5
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.073; TCGA COAD -0.11; TCGA ESCA -0.113; TCGA HNSC -0.074; TCGA KIRC -0.066; TCGA LGG -0.172; TCGA LUAD -0.056; TCGA LUSC -0.195; TCGA PAAD -0.168; TCGA SARC -0.063; TCGA STAD -0.09; TCGA UCEC -0.083
hsa-miR-30a-5p
WDR12
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.075; TCGA BRCA -0.07; TCGA CESC -0.073; TCGA COAD -0.254; TCGA ESCA -0.202; TCGA HNSC -0.074; TCGA KIRP -0.116; TCGA LGG -0.237; TCGA LIHC -0.06; TCGA LUAD -0.229; TCGA LUSC -0.349; TCGA PRAD -0.107; TCGA SARC -0.076; TCGA STAD -0.317
hsa-miR-30a-5p
WDR75
13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.092; TCGA COAD -0.236; TCGA ESCA -0.133; TCGA HNSC -0.102; TCGA KIRC -0.12; TCGA KIRP -0.145; TCGA LGG -0.217; TCGA LIHC -0.077; TCGA LUAD -0.16; TCGA LUSC -0.243; TCGA SARC -0.068; TCGA THCA -0.079; TCGA STAD -0.209
hsa-miR-30a-5p
XPO1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.085; TCGA BRCA -0.083; TCGA COAD -0.127; TCGA ESCA -0.079; TCGA HNSC -0.08; TCGA KIRC -0.115; TCGA LGG -0.117; TCGA LIHC -0.058; TCGA LUAD -0.103; TCGA LUSC -0.222; TCGA PRAD -0.12; TCGA SARC -0.051; TCGA STAD -0.221
hsa-miR-30a-5p
XPO7
9 cancers: BLCA; CESC; COAD; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.109; TCGA CESC -0.06; TCGA COAD -0.257; TCGA LGG -0.091; TCGA LUAD -0.065; TCGA LUSC -0.07; TCGA PRAD -0.101; TCGA STAD -0.151; TCGA UCEC -0.114
hsa-miR-30a-5p
XPOT
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.113; TCGA BRCA -0.156; TCGA CESC -0.129; TCGA COAD -0.141; TCGA ESCA -0.145; TCGA HNSC -0.187; TCGA KIRC -0.205; TCGA KIRP -0.19; TCGA LGG -0.092; TCGA LIHC -0.095; TCGA LUAD -0.274; TCGA LUSC -0.324; TCGA PAAD -0.119; TCGA PRAD -0.086; TCGA STAD -0.28
hsa-miR-30a-5p
YWHAE
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.082; TCGA COAD -0.228; TCGA ESCA -0.162; TCGA LGG -0.05; TCGA LUAD -0.057; TCGA LUSC -0.086; TCGA PAAD -0.117; TCGA STAD -0.185; TCGA UCEC -0.063
hsa-miR-30a-5p
DIP2B
11 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.082; TCGA CESC -0.208; TCGA ESCA -0.176; TCGA HNSC -0.285; TCGA LGG -0.339; TCGA LUAD -0.059; TCGA LUSC -0.266; TCGA PAAD -0.123; TCGA PRAD -0.162; TCGA STAD -0.121; TCGA UCEC -0.056
hsa-miR-30a-5p
CBX3
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget; RAID
TCGA BLCA -0.072; TCGA BRCA -0.065; TCGA CESC -0.057; TCGA ESCA -0.16; TCGA HNSC -0.097; TCGA KIRC -0.21; TCGA KIRP -0.105; TCGA LGG -0.174; TCGA LIHC -0.088; TCGA LUAD -0.22; TCGA LUSC -0.202; TCGA PRAD -0.092; TCGA THCA -0.254; TCGA STAD -0.253
hsa-miR-30a-5p
PLAGL2
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.052; TCGA CESC -0.084; TCGA HNSC -0.124; TCGA KIRC -0.098; TCGA KIRP -0.12; TCGA LGG -0.102; TCGA LIHC -0.156; TCGA LUAD -0.073; TCGA LUSC -0.152; TCGA PAAD -0.191; TCGA PRAD -0.069; TCGA THCA -0.072; TCGA STAD -0.215
hsa-miR-30a-5p
EFNA3
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.24; TCGA BRCA -0.219; TCGA CESC -0.287; TCGA COAD -0.398; TCGA ESCA -0.575; TCGA HNSC -0.197; TCGA KIRC -0.791; TCGA KIRP -0.366; TCGA LGG -0.245; TCGA LIHC -0.325; TCGA LUAD -0.324; TCGA LUSC -0.701; TCGA OV -0.158; TCGA PRAD -0.244; TCGA SARC -0.393; TCGA THCA -0.27; TCGA STAD -0.505; TCGA UCEC -0.097
hsa-miR-30a-5p
RAB10
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.059; TCGA CESC -0.16; TCGA COAD -0.08; TCGA ESCA -0.202; TCGA HNSC -0.132; TCGA KIRP -0.107; TCGA LUAD -0.142; TCGA LUSC -0.188; TCGA PRAD -0.058; TCGA STAD -0.063
hsa-miR-30a-5p
ZMYND8
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; THCA
MirTarget; miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.079; TCGA CESC -0.072; TCGA HNSC -0.069; TCGA KIRC -0.086; TCGA KIRP -0.127; TCGA LGG -0.117; TCGA LUSC -0.095; TCGA PAAD -0.141; TCGA PRAD -0.283; TCGA THCA -0.12
hsa-miR-30a-5p
BCOR
9 cancers: BLCA; CESC; COAD; LGG; LUAD; PAAD; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.107; TCGA CESC -0.076; TCGA COAD -0.104; TCGA LGG -0.371; TCGA LUAD -0.072; TCGA PAAD -0.14; TCGA PRAD -0.259; TCGA SARC -0.166; TCGA UCEC -0.105
hsa-miR-30a-5p
CRKL
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.083; TCGA CESC -0.155; TCGA COAD -0.073; TCGA ESCA -0.189; TCGA HNSC -0.194; TCGA KIRC -0.06; TCGA KIRP -0.126; TCGA LGG -0.182; TCGA LIHC -0.061; TCGA LUAD -0.056; TCGA LUSC -0.217; TCGA PAAD -0.136; TCGA PRAD -0.121; TCGA STAD -0.1
hsa-miR-30a-5p
CDC73
9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.071; TCGA CESC -0.054; TCGA COAD -0.153; TCGA HNSC -0.071; TCGA LUAD -0.095; TCGA LUSC -0.069; TCGA PRAD -0.157; TCGA STAD -0.097; TCGA UCEC -0.089
hsa-miR-30a-5p
SNX16
9 cancers: BLCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; OV; THCA
MirTarget; miRNATAP
TCGA BLCA -0.077; TCGA CESC -0.141; TCGA HNSC -0.079; TCGA LGG -0.103; TCGA LIHC -0.072; TCGA LUAD -0.123; TCGA LUSC -0.072; TCGA OV -0.067; TCGA THCA -0.14
hsa-miR-30a-5p
CCDC117
10 cancers: BLCA; BRCA; COAD; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.066; TCGA BRCA -0.057; TCGA COAD -0.163; TCGA LGG -0.2; TCGA LIHC -0.134; TCGA LUAD -0.085; TCGA LUSC -0.151; TCGA OV -0.101; TCGA PRAD -0.059; TCGA STAD -0.159
hsa-miR-30a-5p
CAPZA1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.065; TCGA BRCA -0.095; TCGA CESC -0.127; TCGA COAD -0.093; TCGA ESCA -0.161; TCGA HNSC -0.131; TCGA KIRC -0.277; TCGA KIRP -0.28; TCGA LUAD -0.055; TCGA LUSC -0.061; TCGA PRAD -0.097; TCGA THCA -0.201; TCGA STAD -0.175
hsa-miR-30a-5p
JARID2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD
MirTarget; miRNATAP
TCGA BLCA -0.166; TCGA BRCA -0.083; TCGA CESC -0.212; TCGA ESCA -0.186; TCGA HNSC -0.213; TCGA KIRC -0.117; TCGA KIRP -0.125; TCGA LGG -0.241; TCGA LIHC -0.101; TCGA LUSC -0.261; TCGA PRAD -0.111
hsa-miR-30a-5p
SCN8A
10 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; THCA
MirTarget
TCGA BLCA -0.393; TCGA BRCA -0.241; TCGA HNSC -0.279; TCGA KIRC -0.579; TCGA LGG -0.258; TCGA LIHC -0.192; TCGA LUAD -0.407; TCGA LUSC -0.462; TCGA PRAD -0.293; TCGA THCA -0.437
hsa-miR-30a-5p
AVL9
13 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.123; TCGA BRCA -0.125; TCGA HNSC -0.189; TCGA KIRP -0.269; TCGA LGG -0.187; TCGA LIHC -0.092; TCGA LUAD -0.172; TCGA LUSC -0.219; TCGA PRAD -0.307; TCGA SARC -0.094; TCGA THCA -0.157; TCGA STAD -0.204; TCGA UCEC -0.102
hsa-miR-30a-5p
CDCA7
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.213; TCGA BRCA -0.327; TCGA COAD -0.371; TCGA ESCA -0.334; TCGA KIRC -0.94; TCGA LIHC -0.442; TCGA LUAD -0.31; TCGA LUSC -0.657; TCGA PRAD -0.386; TCGA SARC -0.162; TCGA THCA -0.307; TCGA STAD -0.629; TCGA UCEC -0.141
hsa-miR-30a-5p
LMBR1
9 cancers: BLCA; BRCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.055; TCGA BRCA -0.054; TCGA HNSC -0.082; TCGA LUAD -0.102; TCGA LUSC -0.12; TCGA PAAD -0.149; TCGA PRAD -0.215; TCGA STAD -0.152; TCGA UCEC -0.084
hsa-miR-30a-5p
CEP76
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.072; TCGA BRCA -0.051; TCGA CESC -0.082; TCGA COAD -0.272; TCGA ESCA -0.084; TCGA LGG -0.194; TCGA LUAD -0.121; TCGA LUSC -0.257; TCGA PAAD -0.184; TCGA PRAD -0.174; TCGA THCA -0.054; TCGA STAD -0.207
hsa-miR-30a-5p
DGKH
9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; THCA
MirTarget
TCGA BLCA -0.179; TCGA BRCA -0.066; TCGA ESCA -0.194; TCGA HNSC -0.238; TCGA LGG -0.272; TCGA LIHC -0.128; TCGA LUSC -0.181; TCGA PRAD -0.374; TCGA THCA -0.363
hsa-miR-30a-5p
STK35
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.154; TCGA BRCA -0.07; TCGA CESC -0.132; TCGA HNSC -0.154; TCGA KIRC -0.213; TCGA LGG -0.091; TCGA LIHC -0.097; TCGA LUAD -0.068; TCGA LUSC -0.192; TCGA PAAD -0.165; TCGA PRAD -0.141; TCGA THCA -0.137; TCGA STAD -0.19
hsa-miR-30a-5p
PFN2
9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.166; TCGA BRCA -0.115; TCGA ESCA -0.234; TCGA HNSC -0.16; TCGA LGG -0.237; TCGA LUAD -0.391; TCGA LUSC -0.53; TCGA PAAD -0.174; TCGA UCEC -0.155
hsa-miR-30a-5p
ERCC6
9 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.098; TCGA CESC -0.12; TCGA ESCA -0.088; TCGA HNSC -0.107; TCGA LGG -0.108; TCGA LUSC -0.074; TCGA PRAD -0.131; TCGA THCA -0.104; TCGA STAD -0.084
hsa-miR-30a-5p
FKBP3
10 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD
MirTarget
TCGA BLCA -0.065; TCGA COAD -0.16; TCGA ESCA -0.174; TCGA LGG -0.069; TCGA LIHC -0.054; TCGA LUAD -0.215; TCGA LUSC -0.214; TCGA OV -0.071; TCGA PAAD -0.102; TCGA STAD -0.12
hsa-miR-30a-5p
YIPF6
10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD
MirTarget
TCGA BLCA -0.075; TCGA BRCA -0.062; TCGA COAD -0.17; TCGA HNSC -0.081; TCGA LGG -0.128; TCGA LUAD -0.129; TCGA LUSC -0.087; TCGA OV -0.061; TCGA PAAD -0.106; TCGA PRAD -0.251
hsa-miR-30a-5p
GMEB2
10 cancers: BLCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.06; TCGA CESC -0.051; TCGA HNSC -0.092; TCGA KIRC -0.104; TCGA LGG -0.069; TCGA LIHC -0.119; TCGA LUAD -0.105; TCGA LUSC -0.122; TCGA PAAD -0.111; TCGA STAD -0.108
hsa-miR-30a-5p
SKP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.2; TCGA CESC -0.111; TCGA COAD -0.341; TCGA ESCA -0.239; TCGA HNSC -0.182; TCGA KIRC -0.255; TCGA KIRP -0.224; TCGA LUAD -0.251; TCGA LUSC -0.486; TCGA PAAD -0.148; TCGA PRAD -0.478; TCGA STAD -0.529; TCGA UCEC -0.162
hsa-miR-30a-5p
RFX7
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.152; TCGA CESC -0.175; TCGA ESCA -0.092; TCGA KIRC -0.083; TCGA KIRP -0.177; TCGA LGG -0.476; TCGA LUSC -0.099; TCGA PRAD -0.123; TCGA STAD -0.104; TCGA UCEC -0.079
hsa-miR-30a-5p
UBE3C
11 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.057; TCGA CESC -0.12; TCGA HNSC -0.105; TCGA LUAD -0.099; TCGA LUSC -0.135; TCGA PAAD -0.073; TCGA PRAD -0.184; TCGA THCA -0.091; TCGA STAD -0.128; TCGA UCEC -0.066
hsa-miR-30a-5p
ENOX2
11 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.111; TCGA CESC -0.172; TCGA ESCA -0.099; TCGA HNSC -0.077; TCGA LUAD -0.084; TCGA LUSC -0.144; TCGA OV -0.088; TCGA PAAD -0.155; TCGA PRAD -0.111; TCGA THCA -0.161; TCGA STAD -0.073
hsa-miR-30a-5p
MED28
10 cancers: BLCA; COAD; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.051; TCGA COAD -0.14; TCGA KIRP -0.115; TCGA LGG -0.123; TCGA LUAD -0.086; TCGA OV -0.075; TCGA PAAD -0.059; TCGA PRAD -0.093; TCGA THCA -0.067; TCGA STAD -0.093
hsa-miR-30a-5p
BRWD3
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.219; TCGA BRCA -0.092; TCGA CESC -0.152; TCGA HNSC -0.121; TCGA KIRP -0.225; TCGA LGG -0.474; TCGA LUAD -0.12; TCGA LUSC -0.143; TCGA PRAD -0.336; TCGA STAD -0.111
hsa-miR-30a-5p
R3HDM1
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.132; TCGA BRCA -0.117; TCGA COAD -0.135; TCGA ESCA -0.097; TCGA HNSC -0.081; TCGA KIRC -0.109; TCGA KIRP -0.085; TCGA LGG -0.212; TCGA LIHC -0.132; TCGA LUAD -0.201; TCGA LUSC -0.25; TCGA PAAD -0.094; TCGA PRAD -0.137; TCGA SARC -0.077; TCGA STAD -0.178; TCGA UCEC -0.082
hsa-miR-30a-5p
LRRC40
9 cancers: BLCA; CESC; COAD; LGG; LUAD; OV; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.087; TCGA CESC -0.102; TCGA COAD -0.168; TCGA LGG -0.076; TCGA LUAD -0.118; TCGA OV -0.075; TCGA PRAD -0.094; TCGA THCA -0.064; TCGA STAD -0.128
hsa-miR-30a-5p
EAF1
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.085; TCGA BRCA -0.064; TCGA COAD -0.111; TCGA HNSC -0.119; TCGA LGG -0.172; TCGA PAAD -0.129; TCGA PRAD -0.177; TCGA STAD -0.163; TCGA UCEC -0.06
hsa-miR-30a-5p
FLVCR1
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.129; TCGA BRCA -0.062; TCGA COAD -0.23; TCGA HNSC -0.117; TCGA KIRP -0.217; TCGA LGG -0.362; TCGA LIHC -0.445; TCGA LUAD -0.226; TCGA LUSC -0.241; TCGA PAAD -0.248; TCGA PRAD -0.116; TCGA STAD -0.188
hsa-miR-30a-5p
SPAST
13 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.086; TCGA BRCA -0.092; TCGA ESCA -0.115; TCGA KIRC -0.176; TCGA KIRP -0.208; TCGA LGG -0.299; TCGA LIHC -0.061; TCGA LUAD -0.107; TCGA LUSC -0.24; TCGA PAAD -0.073; TCGA PRAD -0.105; TCGA THCA -0.094; TCGA STAD -0.162
hsa-miR-30a-5p
ZBTB39
10 cancers: BLCA; CESC; COAD; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.113; TCGA CESC -0.064; TCGA COAD -0.117; TCGA LGG -0.218; TCGA LUAD -0.095; TCGA LUSC -0.152; TCGA PAAD -0.129; TCGA PRAD -0.142; TCGA STAD -0.204; TCGA UCEC -0.056
hsa-miR-30a-5p
PGM2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.114; TCGA CESC -0.284; TCGA COAD -0.198; TCGA ESCA -0.15; TCGA HNSC -0.162; TCGA KIRP -0.286; TCGA LUSC -0.232; TCGA PRAD -0.122; TCGA STAD -0.169; TCGA UCEC -0.102
hsa-miR-30a-5p
B3GNT5
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.182; TCGA CESC -0.359; TCGA ESCA -0.367; TCGA HNSC -0.325; TCGA KIRC -0.456; TCGA KIRP -0.34; TCGA LUAD -0.127; TCGA LUSC -0.334; TCGA PRAD -0.523; TCGA THCA -0.41; TCGA STAD -0.136
hsa-miR-30a-5p
TFDP1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.095; TCGA BRCA -0.081; TCGA CESC -0.149; TCGA COAD -0.222; TCGA ESCA -0.259; TCGA HNSC -0.113; TCGA LGG -0.158; TCGA LUAD -0.132; TCGA LUSC -0.261; TCGA OV -0.059; TCGA PAAD -0.067; TCGA PRAD -0.094; TCGA STAD -0.331; TCGA UCEC -0.087
hsa-miR-30a-5p
HNRNPA3
9 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; STAD
MirTarget
TCGA BLCA -0.066; TCGA COAD -0.13; TCGA ESCA -0.09; TCGA KIRP -0.07; TCGA LGG -0.251; TCGA LIHC -0.124; TCGA LUAD -0.072; TCGA LUSC -0.111; TCGA STAD -0.132
hsa-miR-30a-5p
KDM3A
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD
MirTarget; miRNATAP
TCGA BLCA -0.146; TCGA CESC -0.147; TCGA COAD -0.175; TCGA ESCA -0.084; TCGA HNSC -0.083; TCGA KIRC -0.116; TCGA LUAD -0.067; TCGA LUSC -0.202; TCGA PRAD -0.147
hsa-miR-30a-5p
ATAD2B
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.145; TCGA BRCA -0.075; TCGA CESC -0.087; TCGA ESCA -0.074; TCGA HNSC -0.082; TCGA LGG -0.24; TCGA LUAD -0.059; TCGA LUSC -0.122; TCGA PRAD -0.161; TCGA STAD -0.077; TCGA UCEC -0.051
hsa-miR-30a-5p
SLC38A7
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.119; TCGA CESC -0.162; TCGA ESCA -0.139; TCGA HNSC -0.291; TCGA LGG -0.093; TCGA LUAD -0.088; TCGA LUSC -0.21; TCGA PRAD -0.25; TCGA STAD -0.13; TCGA UCEC -0.074
hsa-miR-30a-5p
DSP
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.247; TCGA CESC -0.421; TCGA ESCA -0.512; TCGA HNSC -0.346; TCGA LUAD -0.37; TCGA LUSC -0.712; TCGA PRAD -0.181; TCGA THCA -0.315; TCGA STAD -0.244
hsa-miR-30a-5p
PAWR
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD
MirTarget; mirMAP
TCGA BLCA -0.143; TCGA CESC -0.09; TCGA COAD -0.106; TCGA ESCA -0.13; TCGA HNSC -0.225; TCGA LUAD -0.178; TCGA LUSC -0.223; TCGA PRAD -0.119; TCGA STAD -0.265
hsa-miR-30a-5p
DBF4
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.111; TCGA BRCA -0.197; TCGA CESC -0.084; TCGA COAD -0.224; TCGA ESCA -0.167; TCGA HNSC -0.135; TCGA KIRC -0.465; TCGA KIRP -0.374; TCGA LGG -0.454; TCGA LIHC -0.233; TCGA LUAD -0.319; TCGA LUSC -0.398; TCGA PRAD -0.076; TCGA THCA -0.168; TCGA STAD -0.43
hsa-miR-30a-5p
ZDHHC20
9 cancers: BLCA; BRCA; HNSC; KIRP; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.179; TCGA BRCA -0.153; TCGA HNSC -0.196; TCGA KIRP -0.456; TCGA OV -0.088; TCGA PRAD -0.594; TCGA THCA -0.203; TCGA STAD -0.19; TCGA UCEC -0.159
hsa-miR-30a-5p
CDK12
9 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.101; TCGA BRCA -0.128; TCGA HNSC -0.171; TCGA KIRP -0.123; TCGA LGG -0.188; TCGA LUAD -0.074; TCGA LUSC -0.12; TCGA PRAD -0.195; TCGA STAD -0.163
hsa-miR-30a-5p
ARHGAP32
9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; LUSC; THCA; STAD
MirTarget; mirMAP
TCGA BLCA -0.14; TCGA CESC -0.143; TCGA COAD -0.213; TCGA ESCA -0.196; TCGA KIRP -0.144; TCGA LGG -0.114; TCGA LUSC -0.105; TCGA THCA -0.152; TCGA STAD -0.25
hsa-miR-30a-5p
SYNCRIP
9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.061; TCGA COAD -0.126; TCGA ESCA -0.095; TCGA HNSC -0.074; TCGA LGG -0.115; TCGA LUAD -0.066; TCGA LUSC -0.139; TCGA PRAD -0.13; TCGA STAD -0.227
hsa-miR-30a-5p
VKORC1L1
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.113; TCGA BRCA -0.062; TCGA HNSC -0.063; TCGA KIRC -0.178; TCGA KIRP -0.09; TCGA LGG -0.092; TCGA PAAD -0.139; TCGA PRAD -0.102; TCGA THCA -0.065; TCGA STAD -0.108
hsa-miR-30a-5p
ZNF746
13 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.053; TCGA ESCA -0.096; TCGA HNSC -0.115; TCGA KIRC -0.157; TCGA KIRP -0.107; TCGA LGG -0.057; TCGA LUAD -0.077; TCGA LUSC -0.146; TCGA OV -0.052; TCGA PAAD -0.163; TCGA PRAD -0.062; TCGA STAD -0.092; TCGA UCEC -0.09
hsa-miR-30a-5p
SDAD1
10 cancers: BLCA; BRCA; CESC; COAD; LUAD; LUSC; OV; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.062; TCGA BRCA -0.058; TCGA CESC -0.086; TCGA COAD -0.075; TCGA LUAD -0.083; TCGA LUSC -0.122; TCGA OV -0.103; TCGA PAAD -0.091; TCGA PRAD -0.083; TCGA STAD -0.112
hsa-miR-30a-5p
ZNF207
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.062; TCGA CESC -0.054; TCGA COAD -0.153; TCGA ESCA -0.094; TCGA HNSC -0.064; TCGA KIRP -0.082; TCGA LGG -0.107; TCGA LUAD -0.071; TCGA LUSC -0.113; TCGA PRAD -0.069; TCGA THCA -0.058; TCGA STAD -0.114
hsa-miR-30a-5p
EIF2AK2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.09; TCGA BRCA -0.192; TCGA CESC -0.093; TCGA ESCA -0.174; TCGA HNSC -0.319; TCGA KIRP -0.168; TCGA LUAD -0.148; TCGA LUSC -0.235; TCGA PRAD -0.3; TCGA THCA -0.169; TCGA STAD -0.11
hsa-miR-30a-5p
TFRC
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.117; TCGA BRCA -0.191; TCGA CESC -0.103; TCGA COAD -0.354; TCGA ESCA -0.281; TCGA HNSC -0.201; TCGA KIRC -0.138; TCGA KIRP -0.239; TCGA LIHC -0.133; TCGA LUSC -0.319; TCGA PRAD -0.273; TCGA STAD -0.468; TCGA UCEC -0.083
hsa-miR-30a-5p
TP63
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUSC; PRAD; THCA; UCEC
mirMAP
TCGA BLCA -0.338; TCGA CESC -1.331; TCGA ESCA -0.894; TCGA HNSC -0.388; TCGA KIRP -1.294; TCGA LUSC -0.872; TCGA PRAD -0.363; TCGA THCA -1.263; TCGA UCEC -0.375
hsa-miR-30a-5p
UBE2K
12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.052; TCGA CESC -0.051; TCGA COAD -0.115; TCGA HNSC -0.074; TCGA KIRP -0.053; TCGA LIHC -0.071; TCGA LUAD -0.163; TCGA LUSC -0.077; TCGA PAAD -0.115; TCGA PRAD -0.064; TCGA STAD -0.147; TCGA UCEC -0.091
hsa-miR-30a-5p
RCOR1
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; PRAD; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.157; TCGA CESC -0.164; TCGA ESCA -0.183; TCGA HNSC -0.237; TCGA KIRP -0.089; TCGA LGG -0.193; TCGA LUSC -0.091; TCGA PRAD -0.081; TCGA THCA -0.083; TCGA STAD -0.209
hsa-miR-30a-5p
RFFL
9 cancers: BLCA; CESC; KIRC; KIRP; LUAD; LUSC; OV; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.071; TCGA CESC -0.074; TCGA KIRC -0.083; TCGA KIRP -0.235; TCGA LUAD -0.089; TCGA LUSC -0.102; TCGA OV -0.062; TCGA STAD -0.079; TCGA UCEC -0.074
hsa-miR-30a-5p
EIF5
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.083; TCGA CESC -0.064; TCGA COAD -0.13; TCGA ESCA -0.09; TCGA HNSC -0.084; TCGA LUSC -0.108; TCGA PAAD -0.134; TCGA PRAD -0.093; TCGA STAD -0.07
hsa-miR-30a-5p
RPS6KB1
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD
mirMAP; miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.118; TCGA CESC -0.07; TCGA COAD -0.129; TCGA KIRC -0.104; TCGA KIRP -0.133; TCGA LGG -0.206; TCGA LIHC -0.052; TCGA LUAD -0.149; TCGA LUSC -0.103; TCGA PRAD -0.073
hsa-miR-30a-5p
PFKFB4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.081; TCGA CESC -0.223; TCGA COAD -0.301; TCGA ESCA -0.554; TCGA HNSC -0.181; TCGA KIRC -0.723; TCGA KIRP -0.526; TCGA LIHC -0.272; TCGA LUAD -0.239; TCGA LUSC -0.262; TCGA THCA -0.23; TCGA STAD -0.366; TCGA UCEC -0.126
hsa-miR-30a-5p
SENP5
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD
mirMAP
TCGA BLCA -0.085; TCGA BRCA -0.085; TCGA CESC -0.151; TCGA ESCA -0.076; TCGA HNSC -0.148; TCGA KIRC -0.115; TCGA KIRP -0.073; TCGA LGG -0.132; TCGA LIHC -0.078; TCGA LUAD -0.065; TCGA LUSC -0.246; TCGA PAAD -0.097; TCGA PRAD -0.056
hsa-miR-30a-5p
PDS5A
9 cancers: BLCA; COAD; HNSC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.08; TCGA COAD -0.165; TCGA HNSC -0.05; TCGA LGG -0.076; TCGA LUAD -0.077; TCGA PAAD -0.07; TCGA PRAD -0.154; TCGA STAD -0.208; TCGA UCEC -0.073
hsa-miR-30a-5p
P4HA1
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.092; TCGA BRCA -0.168; TCGA COAD -0.342; TCGA HNSC -0.139; TCGA KIRC -0.458; TCGA KIRP -0.318; TCGA LUAD -0.243; TCGA LUSC -0.212; TCGA PRAD -0.089; TCGA THCA -0.115; TCGA STAD -0.281
hsa-miR-30a-5p
STX6
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.115; TCGA BRCA -0.07; TCGA CESC -0.14; TCGA ESCA -0.195; TCGA HNSC -0.155; TCGA KIRC -0.126; TCGA KIRP -0.266; TCGA LGG -0.198; TCGA LIHC -0.1; TCGA LUAD -0.071; TCGA LUSC -0.162; TCGA PRAD -0.151; TCGA STAD -0.122; TCGA UCEC -0.142
hsa-miR-30a-5p
DCAF7
9 cancers: BLCA; BRCA; COAD; LGG; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.094; TCGA BRCA -0.093; TCGA COAD -0.095; TCGA LGG -0.267; TCGA LUAD -0.053; TCGA LUSC -0.062; TCGA PAAD -0.076; TCGA PRAD -0.086; TCGA STAD -0.107
hsa-miR-30a-5p
TMTC3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.143; TCGA BRCA -0.072; TCGA CESC -0.103; TCGA ESCA -0.198; TCGA HNSC -0.191; TCGA LUAD -0.158; TCGA LUSC -0.306; TCGA PAAD -0.094; TCGA PRAD -0.097; TCGA THCA -0.053; TCGA STAD -0.071
hsa-miR-30a-5p
TDG
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.127; TCGA BRCA -0.121; TCGA CESC -0.094; TCGA COAD -0.142; TCGA ESCA -0.186; TCGA HNSC -0.169; TCGA KIRC -0.156; TCGA KIRP -0.124; TCGA LGG -0.234; TCGA LIHC -0.098; TCGA LUAD -0.235; TCGA LUSC -0.233; TCGA PAAD -0.165; TCGA PRAD -0.163; TCGA STAD -0.218; TCGA UCEC -0.097
hsa-miR-30a-5p
DDX52
9 cancers: BLCA; COAD; HNSC; LGG; LUAD; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.067; TCGA COAD -0.115; TCGA HNSC -0.087; TCGA LGG -0.275; TCGA LUAD -0.134; TCGA LUSC -0.141; TCGA PRAD -0.063; TCGA THCA -0.309; TCGA STAD -0.146
hsa-miR-30a-5p
CLTC
9 cancers: BLCA; BRCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.077; TCGA BRCA -0.189; TCGA HNSC -0.139; TCGA KIRP -0.127; TCGA LUAD -0.099; TCGA LUSC -0.078; TCGA PAAD -0.091; TCGA PRAD -0.119; TCGA STAD -0.087
hsa-miR-30a-5p
PPP2R5E
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; STAD
mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.068; TCGA CESC -0.111; TCGA ESCA -0.086; TCGA HNSC -0.195; TCGA KIRP -0.124; TCGA LGG -0.195; TCGA LUAD -0.133; TCGA LUSC -0.137; TCGA PRAD -0.242; TCGA STAD -0.062
hsa-miR-30a-5p
PHF6
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.089; TCGA CESC -0.054; TCGA COAD -0.114; TCGA ESCA -0.106; TCGA HNSC -0.059; TCGA LGG -0.353; TCGA LUAD -0.131; TCGA LUSC -0.168; TCGA OV -0.072; TCGA PRAD -0.239; TCGA STAD -0.328; TCGA UCEC -0.087
hsa-miR-30a-5p
BAG4
10 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.159; TCGA CESC -0.113; TCGA COAD -0.271; TCGA HNSC -0.126; TCGA LGG -0.186; TCGA LUAD -0.086; TCGA LUSC -0.191; TCGA PRAD -0.405; TCGA STAD -0.203; TCGA UCEC -0.098
hsa-miR-30a-5p
CUL4B
9 cancers: BLCA; CESC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; THCA
mirMAP
TCGA BLCA -0.064; TCGA CESC -0.061; TCGA KIRC -0.143; TCGA LGG -0.141; TCGA LIHC -0.074; TCGA LUAD -0.061; TCGA LUSC -0.093; TCGA PRAD -0.093; TCGA THCA -0.054
hsa-miR-30a-5p
PAQR3
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.08; TCGA BRCA -0.055; TCGA CESC -0.093; TCGA COAD -0.178; TCGA HNSC -0.09; TCGA LUAD -0.143; TCGA LUSC -0.184; TCGA PAAD -0.1; TCGA PRAD -0.108; TCGA STAD -0.107
hsa-miR-30a-5p
LRRC58
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.183; TCGA BRCA -0.061; TCGA CESC -0.159; TCGA COAD -0.12; TCGA HNSC -0.184; TCGA LGG -0.183; TCGA LUSC -0.18; TCGA PRAD -0.172; TCGA STAD -0.141; TCGA UCEC -0.062
hsa-miR-30a-5p
KBTBD6
12 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.085; TCGA COAD -0.13; TCGA ESCA -0.165; TCGA HNSC -0.091; TCGA LGG -0.309; TCGA LIHC -0.057; TCGA LUAD -0.058; TCGA LUSC -0.152; TCGA OV -0.112; TCGA PAAD -0.212; TCGA STAD -0.173; TCGA UCEC -0.106
hsa-miR-30a-5p
NANP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.069; TCGA BRCA -0.105; TCGA CESC -0.056; TCGA COAD -0.142; TCGA ESCA -0.1; TCGA HNSC -0.055; TCGA LIHC -0.077; TCGA LUAD -0.132; TCGA LUSC -0.205; TCGA PAAD -0.141; TCGA PRAD -0.075; TCGA STAD -0.271; TCGA UCEC -0.053
hsa-miR-30a-5p
BEND3
12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.151; TCGA BRCA -0.188; TCGA COAD -0.32; TCGA HNSC -0.085; TCGA LGG -0.416; TCGA LIHC -0.3; TCGA LUAD -0.122; TCGA LUSC -0.18; TCGA PAAD -0.181; TCGA PRAD -0.231; TCGA THCA -0.17; TCGA STAD -0.363
hsa-miR-30a-5p
HDAC2
12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.085; TCGA BRCA -0.11; TCGA COAD -0.115; TCGA ESCA -0.113; TCGA KIRP -0.07; TCGA LGG -0.38; TCGA LIHC -0.063; TCGA LUAD -0.14; TCGA LUSC -0.209; TCGA THCA -0.071; TCGA STAD -0.21; TCGA UCEC -0.059
hsa-miR-30a-5p
PGAP1
9 cancers: BLCA; CESC; ESCA; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.138; TCGA CESC -0.222; TCGA ESCA -0.153; TCGA LGG -0.456; TCGA LUSC -0.161; TCGA PAAD -0.171; TCGA PRAD -0.174; TCGA STAD -0.142; TCGA UCEC -0.164
hsa-miR-30a-5p
ZNF770
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PRAD; STAD
mirMAP
TCGA BLCA -0.181; TCGA CESC -0.115; TCGA COAD -0.156; TCGA ESCA -0.119; TCGA HNSC -0.153; TCGA LGG -0.089; TCGA LUSC -0.159; TCGA PRAD -0.071; TCGA STAD -0.203
hsa-miR-30a-5p
STYX
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA
mirMAP; miRNATAP
TCGA BLCA -0.066; TCGA BRCA -0.059; TCGA CESC -0.096; TCGA ESCA -0.081; TCGA HNSC -0.098; TCGA KIRC -0.157; TCGA KIRP -0.089; TCGA LGG -0.053; TCGA LUAD -0.119; TCGA LUSC -0.122; TCGA PRAD -0.101; TCGA SARC -0.08; TCGA THCA -0.111
hsa-miR-30a-5p
C4orf46
13 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.096; TCGA BRCA -0.086; TCGA COAD -0.275; TCGA KIRC -0.207; TCGA LGG -0.201; TCGA LIHC -0.155; TCGA LUAD -0.252; TCGA LUSC -0.197; TCGA OV -0.082; TCGA PAAD -0.158; TCGA PRAD -0.073; TCGA SARC -0.091; TCGA STAD -0.317
hsa-miR-30a-5p
E2F7
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.177; TCGA BRCA -0.3; TCGA CESC -0.199; TCGA COAD -0.386; TCGA ESCA -0.357; TCGA HNSC -0.308; TCGA KIRC -1.086; TCGA KIRP -0.696; TCGA LIHC -0.336; TCGA LUAD -0.327; TCGA LUSC -0.876; TCGA PRAD -0.456; TCGA THCA -0.635; TCGA STAD -0.782; TCGA UCEC -0.169
hsa-miR-30a-5p
BCL11B
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; STAD
miRNATAP
TCGA BLCA -0.185; TCGA BRCA -0.194; TCGA CESC -0.438; TCGA ESCA -0.506; TCGA HNSC -0.324; TCGA KIRC -0.567; TCGA KIRP -0.419; TCGA LGG -0.452; TCGA LUSC -0.327; TCGA PRAD -0.199; TCGA STAD -0.219
hsa-miR-30a-5p
SLC36A1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA; UCEC
miRNATAP
TCGA BLCA -0.07; TCGA BRCA -0.188; TCGA CESC -0.093; TCGA ESCA -0.139; TCGA HNSC -0.184; TCGA KIRC -0.268; TCGA KIRP -0.151; TCGA LIHC -0.123; TCGA LUSC -0.169; TCGA THCA -0.265; TCGA UCEC -0.053
hsa-miR-30a-5p
SMARCD2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.07; TCGA BRCA -0.142; TCGA CESC -0.051; TCGA COAD -0.237; TCGA ESCA -0.108; TCGA KIRC -0.157; TCGA KIRP -0.26; TCGA LUAD -0.088; TCGA LUSC -0.164; TCGA THCA -0.095; TCGA STAD -0.205; TCGA UCEC -0.056
hsa-miR-30a-5p
PCGF3
9 cancers: BLCA; COAD; KIRC; LGG; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.107; TCGA COAD -0.129; TCGA KIRC -0.146; TCGA LGG -0.202; TCGA LUAD -0.05; TCGA LUSC -0.06; TCGA THCA -0.052; TCGA STAD -0.08; TCGA UCEC -0.078
hsa-miR-30a-5p
EDC3
10 cancers: BLCA; COAD; HNSC; KIRC; LGG; LIHC; LUSC; PAAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.064; TCGA COAD -0.118; TCGA HNSC -0.073; TCGA KIRC -0.079; TCGA LGG -0.3; TCGA LIHC -0.111; TCGA LUSC -0.12; TCGA PAAD -0.074; TCGA SARC -0.103; TCGA UCEC -0.051
hsa-miR-30a-5p
AP4E1
9 cancers: BLCA; CESC; HNSC; KIRP; LGG; LIHC; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.057; TCGA CESC -0.138; TCGA HNSC -0.12; TCGA KIRP -0.081; TCGA LGG -0.065; TCGA LIHC -0.05; TCGA PRAD -0.165; TCGA THCA -0.072; TCGA UCEC -0.094
hsa-miR-30a-5p
RNF220
9 cancers: BLCA; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.051; TCGA ESCA -0.094; TCGA KIRC -0.097; TCGA LIHC -0.088; TCGA LUAD -0.061; TCGA LUSC -0.091; TCGA PAAD -0.127; TCGA THCA -0.089; TCGA STAD -0.096
hsa-miR-30a-5p
BCL9
9 cancers: BLCA; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.154; TCGA LGG -0.187; TCGA LIHC -0.177; TCGA LUAD -0.176; TCGA LUSC -0.124; TCGA PAAD -0.134; TCGA PRAD -0.131; TCGA SARC -0.183; TCGA THCA -0.296
hsa-miR-30a-5p
RAB22A
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD
miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.08; TCGA CESC -0.114; TCGA ESCA -0.094; TCGA HNSC -0.154; TCGA KIRC -0.088; TCGA LUAD -0.104; TCGA LUSC -0.086; TCGA PAAD -0.16; TCGA PRAD -0.078
hsa-miR-30a-5p
SOX4
10 cancers: BLCA; BRCA; ESCA; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.069; TCGA ESCA -0.165; TCGA LGG -1.131; TCGA LUAD -0.258; TCGA LUSC -0.23; TCGA PRAD -0.089; TCGA THCA -0.812; TCGA STAD -0.287; TCGA UCEC -0.113
hsa-miR-30a-5p
UBN1
9 cancers: BLCA; CESC; HNSC; LGG; LUSC; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.056; TCGA CESC -0.095; TCGA HNSC -0.077; TCGA LGG -0.105; TCGA LUSC -0.083; TCGA PRAD -0.105; TCGA SARC -0.083; TCGA THCA -0.054; TCGA STAD -0.072
hsa-miR-30a-5p
NAA25
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.056; TCGA CESC -0.102; TCGA COAD -0.176; TCGA ESCA -0.126; TCGA HNSC -0.061; TCGA KIRC -0.14; TCGA KIRP -0.117; TCGA LGG -0.158; TCGA LIHC -0.102; TCGA LUAD -0.184; TCGA LUSC -0.195; TCGA PRAD -0.065; TCGA SARC -0.069; TCGA STAD -0.267
hsa-miR-30a-5p
FBXO45
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.153; TCGA BRCA -0.161; TCGA CESC -0.212; TCGA COAD -0.136; TCGA ESCA -0.262; TCGA HNSC -0.306; TCGA KIRC -0.274; TCGA KIRP -0.264; TCGA LGG -0.126; TCGA LIHC -0.14; TCGA LUAD -0.207; TCGA LUSC -0.448; TCGA OV -0.083; TCGA PAAD -0.1; TCGA PRAD -0.102; TCGA THCA -0.163; TCGA STAD -0.212; TCGA UCEC -0.069
hsa-miR-30a-5p
FBXO28
10 cancers: BLCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.054; TCGA HNSC -0.062; TCGA KIRP -0.096; TCGA LGG -0.117; TCGA LUAD -0.058; TCGA LUSC -0.076; TCGA PRAD -0.089; TCGA THCA -0.116; TCGA STAD -0.117; TCGA UCEC -0.06
hsa-miR-30a-5p
SBNO1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD
miRNATAP
TCGA BLCA -0.156; TCGA BRCA -0.08; TCGA CESC -0.18; TCGA COAD -0.142; TCGA ESCA -0.069; TCGA HNSC -0.174; TCGA LUAD -0.144; TCGA LUSC -0.212; TCGA PRAD -0.419; TCGA STAD -0.158
hsa-miR-30a-5p
IDE
9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.099; TCGA BRCA -0.096; TCGA COAD -0.125; TCGA HNSC -0.101; TCGA LUAD -0.069; TCGA LUSC -0.119; TCGA PRAD -0.211; TCGA STAD -0.12; TCGA UCEC -0.088
hsa-miR-30a-5p
CBX2
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.273; TCGA BRCA -0.614; TCGA CESC -0.232; TCGA COAD -0.387; TCGA ESCA -0.588; TCGA HNSC -0.334; TCGA KIRC -0.454; TCGA KIRP -0.642; TCGA LGG -0.712; TCGA LIHC -0.184; TCGA LUAD -0.405; TCGA LUSC -0.683; TCGA PRAD -0.388; TCGA SARC -0.205; TCGA THCA -0.257; TCGA STAD -0.724; TCGA UCEC -0.105
hsa-miR-30a-5p
ME1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD
miRNATAP
TCGA BLCA -0.175; TCGA BRCA -0.302; TCGA CESC -0.481; TCGA ESCA -0.276; TCGA HNSC -0.157; TCGA KIRC -0.311; TCGA KIRP -0.618; TCGA LUSC -0.391; TCGA PAAD -0.182; TCGA PRAD -0.304
hsa-miR-30a-5p
ARL6IP6
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.089; TCGA CESC -0.089; TCGA COAD -0.12; TCGA ESCA -0.194; TCGA HNSC -0.098; TCGA KIRC -0.29; TCGA LGG -0.151; TCGA LUAD -0.13; TCGA LUSC -0.205; TCGA PRAD -0.119; TCGA THCA -0.23; TCGA STAD -0.227
hsa-miR-30a-5p
GTF2E2
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.065; TCGA CESC -0.05; TCGA COAD -0.351; TCGA ESCA -0.136; TCGA HNSC -0.094; TCGA KIRC -0.241; TCGA KIRP -0.159; TCGA LIHC -0.111; TCGA LUAD -0.129; TCGA LUSC -0.153; TCGA THCA -0.149; TCGA STAD -0.164; TCGA UCEC -0.08
hsa-miR-30a-5p
C16orf87
10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; OV; STAD; UCEC
miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.159; TCGA ESCA -0.121; TCGA HNSC -0.115; TCGA LGG -0.429; TCGA LUAD -0.163; TCGA LUSC -0.197; TCGA OV -0.115; TCGA STAD -0.126; TCGA UCEC -0.099
hsa-miR-30a-5p
GORASP2
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.065; TCGA COAD -0.117; TCGA ESCA -0.095; TCGA HNSC -0.088; TCGA KIRC -0.107; TCGA KIRP -0.087; TCGA LGG -0.069; TCGA LIHC -0.075; TCGA LUAD -0.141; TCGA LUSC -0.126; TCGA OV -0.066; TCGA PAAD -0.078; TCGA PRAD -0.061; TCGA THCA -0.09; TCGA STAD -0.073
hsa-miR-30a-5p
YBX1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; STAD
miRNATAP
TCGA BLCA -0.072; TCGA BRCA -0.142; TCGA CESC -0.053; TCGA COAD -0.161; TCGA ESCA -0.11; TCGA KIRC -0.122; TCGA KIRP -0.169; TCGA LGG -0.3; TCGA LUAD -0.07; TCGA LUSC -0.119; TCGA STAD -0.115
hsa-miR-30a-5p
UBE2O
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA BLCA -0.128; TCGA BRCA -0.071; TCGA CESC -0.076; TCGA COAD -0.186; TCGA ESCA -0.117; TCGA HNSC -0.077; TCGA KIRC -0.221; TCGA KIRP -0.231; TCGA LGG -0.266; TCGA LIHC -0.144; TCGA LUAD -0.147; TCGA LUSC -0.264; TCGA PAAD -0.199; TCGA SARC -0.062; TCGA STAD -0.133
hsa-miR-30a-5p
CIT
9 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; STAD
miRNATAP
TCGA BLCA -0.184; TCGA BRCA -0.216; TCGA COAD -0.282; TCGA HNSC -0.101; TCGA LIHC -0.173; TCGA LUAD -0.177; TCGA LUSC -0.206; TCGA PRAD -0.355; TCGA STAD -0.395
hsa-miR-30a-5p
UPF2
9 cancers: BLCA; BRCA; CESC; COAD; LGG; LUAD; LUSC; PRAD; SARC
miRNATAP
TCGA BLCA -0.074; TCGA BRCA -0.06; TCGA CESC -0.073; TCGA COAD -0.092; TCGA LGG -0.196; TCGA LUAD -0.053; TCGA LUSC -0.053; TCGA PRAD -0.076; TCGA SARC -0.084
hsa-miR-30a-5p
HMGB3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.281; TCGA COAD -0.254; TCGA ESCA -0.348; TCGA HNSC -0.141; TCGA LGG -0.326; TCGA LIHC -0.124; TCGA LUAD -0.651; TCGA LUSC -0.466; TCGA OV -0.12; TCGA PAAD -0.145; TCGA THCA -0.169; TCGA STAD -0.565
hsa-miR-30a-5p
PLXNA1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.097; TCGA BRCA -0.063; TCGA CESC -0.098; TCGA ESCA -0.13; TCGA HNSC -0.15; TCGA KIRC -0.368; TCGA KIRP -0.249; TCGA LGG -0.186; TCGA LUSC -0.085; TCGA PRAD -0.185; TCGA THCA -0.273; TCGA STAD -0.158
hsa-miR-30a-5p
LARP1
10 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.066; TCGA BRCA -0.072; TCGA CESC -0.06; TCGA HNSC -0.085; TCGA LIHC -0.118; TCGA LUAD -0.101; TCGA LUSC -0.146; TCGA PRAD -0.117; TCGA SARC -0.062; TCGA STAD -0.151
hsa-miR-30a-5p
YWHAG
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.099; TCGA BRCA -0.13; TCGA CESC -0.121; TCGA ESCA -0.197; TCGA HNSC -0.147; TCGA KIRC -0.245; TCGA KIRP -0.177; TCGA LUAD -0.201; TCGA LUSC -0.227; TCGA PRAD -0.076; TCGA THCA -0.244; TCGA STAD -0.129; TCGA UCEC -0.058
hsa-miR-30a-5p
GRHL1
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LIHC; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.163; TCGA CESC -0.535; TCGA ESCA -0.36; TCGA HNSC -0.163; TCGA KIRP -0.317; TCGA LIHC -0.123; TCGA LUSC -0.466; TCGA PRAD -0.167; TCGA THCA -0.218; TCGA STAD -0.277
hsa-miR-30a-5p
AMMECR1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.107; TCGA BRCA -0.129; TCGA CESC -0.199; TCGA COAD -0.112; TCGA ESCA -0.26; TCGA HNSC -0.293; TCGA LGG -0.237; TCGA LUAD -0.108; TCGA LUSC -0.236; TCGA OV -0.112; TCGA PRAD -0.284; TCGA SARC -0.142; TCGA THCA -0.177; TCGA STAD -0.283
hsa-miR-30a-5p
U2AF2
10 cancers: BLCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD
RAID
TCGA BLCA -0.068; TCGA COAD -0.113; TCGA KIRC -0.07; TCGA KIRP -0.054; TCGA LIHC -0.094; TCGA LUAD -0.107; TCGA LUSC -0.148; TCGA PAAD -0.106; TCGA SARC -0.063; TCGA STAD -0.176
hsa-miR-30a-5p
AP2A1
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.056; TCGA CESC -0.06; TCGA ESCA -0.062; TCGA HNSC -0.086; TCGA KIRC -0.254; TCGA KIRP -0.144; TCGA LUSC -0.104; TCGA PRAD -0.054; TCGA THCA -0.182; TCGA STAD -0.061; TCGA UCEC -0.08
hsa-miR-30a-5p
AP2S1
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.086; TCGA COAD -0.127; TCGA ESCA -0.184; TCGA HNSC -0.075; TCGA KIRC -0.325; TCGA KIRP -0.207; TCGA LIHC -0.064; TCGA LUAD -0.07; TCGA LUSC -0.137; TCGA OV -0.094; TCGA THCA -0.093; TCGA STAD -0.102; TCGA UCEC -0.078
hsa-miR-30a-5p
AP3S1
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA
miRNAWalker2 validate
TCGA BRCA -0.113; TCGA CESC -0.087; TCGA ESCA -0.157; TCGA HNSC -0.091; TCGA KIRC -0.485; TCGA KIRP -0.227; TCGA LIHC -0.091; TCGA LUAD -0.086; TCGA LUSC -0.088; TCGA OV -0.055; TCGA THCA -0.24
hsa-miR-30a-5p
ARF6
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.065; TCGA CESC -0.113; TCGA ESCA -0.155; TCGA HNSC -0.078; TCGA KIRC -0.074; TCGA LUAD -0.075; TCGA LUSC -0.086; TCGA OV -0.075; TCGA PRAD -0.063; TCGA THCA -0.34; TCGA STAD -0.082
hsa-miR-30a-5p
ARPC5
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BRCA -0.084; TCGA ESCA -0.1; TCGA HNSC -0.088; TCGA KIRC -0.328; TCGA KIRP -0.194; TCGA PRAD -0.05; TCGA THCA -0.114; TCGA STAD -0.174; TCGA UCEC -0.06
hsa-miR-30a-5p
ATP2A2
11 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate; mirMAP
TCGA BRCA -0.091; TCGA CESC -0.125; TCGA ESCA -0.112; TCGA KIRC -0.126; TCGA LGG -0.079; TCGA LIHC -0.066; TCGA LUAD -0.162; TCGA LUSC -0.227; TCGA PAAD -0.197; TCGA PRAD -0.214; TCGA STAD -0.171
hsa-miR-30a-5p
ATP6V1B2
9 cancers: BRCA; CESC; COAD; ESCA; OV; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BRCA -0.08; TCGA CESC -0.108; TCGA COAD -0.181; TCGA ESCA -0.066; TCGA OV -0.096; TCGA PAAD -0.095; TCGA THCA -0.299; TCGA STAD -0.16; TCGA UCEC -0.116
hsa-miR-30a-5p
ATP6V1C1
10 cancers: BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD
miRNAWalker2 validate
TCGA BRCA -0.063; TCGA CESC -0.062; TCGA ESCA -0.092; TCGA HNSC -0.137; TCGA LIHC -0.157; TCGA LUAD -0.117; TCGA LUSC -0.073; TCGA OV -0.079; TCGA PAAD -0.067; TCGA STAD -0.109
hsa-miR-30a-5p
CBFB
12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; mirMAP; miRNATAP
TCGA BRCA -0.143; TCGA CESC -0.091; TCGA ESCA -0.136; TCGA HNSC -0.092; TCGA KIRC -0.284; TCGA KIRP -0.108; TCGA LGG -0.147; TCGA LUAD -0.053; TCGA LUSC -0.142; TCGA THCA -0.288; TCGA STAD -0.306; TCGA UCEC -0.111
hsa-miR-30a-5p
CDC123
11 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.092; TCGA COAD -0.165; TCGA ESCA -0.215; TCGA KIRC -0.097; TCGA KIRP -0.121; TCGA LGG -0.302; TCGA LIHC -0.05; TCGA LUAD -0.104; TCGA LUSC -0.149; TCGA THCA -0.065; TCGA STAD -0.243
hsa-miR-30a-5p
CORO1C
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.147; TCGA CESC -0.104; TCGA ESCA -0.181; TCGA HNSC -0.216; TCGA KIRC -0.359; TCGA LGG -0.445; TCGA LUSC -0.057; TCGA PRAD -0.182; TCGA THCA -0.459; TCGA UCEC -0.069
hsa-miR-30a-5p
CPSF3
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.101; TCGA COAD -0.151; TCGA ESCA -0.185; TCGA HNSC -0.099; TCGA KIRC -0.074; TCGA KIRP -0.089; TCGA LGG -0.272; TCGA LIHC -0.111; TCGA LUAD -0.158; TCGA LUSC -0.23; TCGA SARC -0.059; TCGA THCA -0.118; TCGA STAD -0.184
hsa-miR-30a-5p
DERL1
15 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.136; TCGA CESC -0.063; TCGA COAD -0.111; TCGA ESCA -0.152; TCGA HNSC -0.103; TCGA KIRC -0.229; TCGA LGG -0.115; TCGA LIHC -0.068; TCGA LUAD -0.12; TCGA LUSC -0.068; TCGA OV -0.127; TCGA PAAD -0.067; TCGA PRAD -0.101; TCGA THCA -0.156; TCGA STAD -0.138
hsa-miR-30a-5p
DNAJC2
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.073; TCGA CESC -0.08; TCGA COAD -0.112; TCGA HNSC -0.079; TCGA KIRC -0.235; TCGA KIRP -0.114; TCGA LIHC -0.134; TCGA LUAD -0.179; TCGA LUSC -0.236; TCGA THCA -0.066; TCGA STAD -0.197
hsa-miR-30a-5p
DPY19L1
9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.093; TCGA HNSC -0.061; TCGA KIRC -0.411; TCGA KIRP -0.156; TCGA LUAD -0.142; TCGA PRAD -0.187; TCGA THCA -0.628; TCGA STAD -0.21; TCGA UCEC -0.133
hsa-miR-30a-5p
GALNT1
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.08; TCGA ESCA -0.106; TCGA HNSC -0.074; TCGA KIRC -0.337; TCGA KIRP -0.349; TCGA LGG -0.135; TCGA LUAD -0.078; TCGA LUSC -0.171; TCGA THCA -0.144; TCGA STAD -0.168; TCGA UCEC -0.061
hsa-miR-30a-5p
GGCT
12 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.179; TCGA CESC -0.06; TCGA COAD -0.21; TCGA ESCA -0.244; TCGA KIRC -0.091; TCGA KIRP -0.197; TCGA LIHC -0.119; TCGA LUAD -0.221; TCGA LUSC -0.345; TCGA THCA -0.653; TCGA STAD -0.266; TCGA UCEC -0.118
hsa-miR-30a-5p
GLRX3
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.119; TCGA CESC -0.099; TCGA COAD -0.229; TCGA ESCA -0.212; TCGA HNSC -0.128; TCGA KIRC -0.097; TCGA LGG -0.169; TCGA LIHC -0.111; TCGA LUAD -0.131; TCGA LUSC -0.241; TCGA THCA -0.182; TCGA STAD -0.156
hsa-miR-30a-5p
IDH1
9 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.142; TCGA COAD -0.221; TCGA KIRC -0.202; TCGA KIRP -0.467; TCGA LGG -0.3; TCGA LUSC -0.146; TCGA THCA -0.322; TCGA STAD -0.262; TCGA UCEC -0.257
hsa-miR-30a-5p
IKBIP
9 cancers: BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PRAD; THCA
miRNAWalker2 validate; MirTarget
TCGA BRCA -0.106; TCGA ESCA -0.133; TCGA HNSC -0.11; TCGA KIRC -0.628; TCGA LIHC -0.154; TCGA LUAD -0.142; TCGA OV -0.099; TCGA PRAD -0.151; TCGA THCA -0.224
hsa-miR-30a-5p
LMNB2
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.114; TCGA CESC -0.107; TCGA COAD -0.196; TCGA ESCA -0.301; TCGA HNSC -0.194; TCGA KIRC -0.296; TCGA KIRP -0.132; TCGA LGG -0.262; TCGA LIHC -0.135; TCGA LUAD -0.248; TCGA LUSC -0.415; TCGA THCA -0.188; TCGA STAD -0.437; TCGA UCEC -0.131
hsa-miR-30a-5p
NIP7
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.118; TCGA CESC -0.135; TCGA COAD -0.113; TCGA ESCA -0.172; TCGA HNSC -0.161; TCGA KIRC -0.077; TCGA LGG -0.114; TCGA LUAD -0.111; TCGA LUSC -0.205; TCGA THCA -0.108; TCGA STAD -0.251
hsa-miR-30a-5p
OGFOD1
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.094; TCGA CESC -0.088; TCGA COAD -0.11; TCGA ESCA -0.102; TCGA HNSC -0.057; TCGA LGG -0.148; TCGA LUSC -0.104; TCGA PRAD -0.055; TCGA THCA -0.104; TCGA STAD -0.087; TCGA UCEC -0.07
hsa-miR-30a-5p
P4HA2
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; THCA
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.173; TCGA CESC -0.083; TCGA ESCA -0.18; TCGA HNSC -0.189; TCGA KIRC -0.515; TCGA KIRP -0.236; TCGA LIHC -0.121; TCGA LUAD -0.105; TCGA PRAD -0.218; TCGA THCA -0.536
hsa-miR-30a-5p
PABPC1
15 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.145; TCGA CESC -0.127; TCGA COAD -0.193; TCGA ESCA -0.206; TCGA HNSC -0.078; TCGA KIRC -0.34; TCGA KIRP -0.425; TCGA LGG -0.482; TCGA LIHC -0.212; TCGA LUAD -0.226; TCGA LUSC -0.228; TCGA OV -0.13; TCGA PRAD -0.139; TCGA THCA -0.228; TCGA STAD -0.251
hsa-miR-30a-5p
PAK1IP1
11 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.114; TCGA COAD -0.207; TCGA ESCA -0.191; TCGA KIRC -0.068; TCGA KIRP -0.181; TCGA LGG -0.18; TCGA LIHC -0.071; TCGA LUAD -0.22; TCGA LUSC -0.222; TCGA STAD -0.245; TCGA UCEC -0.082
hsa-miR-30a-5p
PCNA
12 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.147; TCGA CESC -0.111; TCGA COAD -0.328; TCGA ESCA -0.256; TCGA KIRC -0.169; TCGA KIRP -0.095; TCGA LIHC -0.14; TCGA LUAD -0.235; TCGA LUSC -0.391; TCGA THCA -0.201; TCGA STAD -0.446; TCGA UCEC -0.073
hsa-miR-30a-5p
PES1
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.052; TCGA COAD -0.239; TCGA ESCA -0.192; TCGA HNSC -0.1; TCGA KIRC -0.189; TCGA KIRP -0.117; TCGA LGG -0.295; TCGA LIHC -0.133; TCGA LUAD -0.058; TCGA LUSC -0.246; TCGA OV -0.09; TCGA THCA -0.079; TCGA STAD -0.194
hsa-miR-30a-5p
PHLDA2
11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.231; TCGA COAD -0.267; TCGA ESCA -0.342; TCGA HNSC -0.225; TCGA KIRC -0.475; TCGA KIRP -0.43; TCGA LUAD -0.217; TCGA LUSC -0.184; TCGA THCA -0.788; TCGA STAD -0.334; TCGA UCEC -0.139
hsa-miR-30a-5p
PPA1
9 cancers: BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.088; TCGA COAD -0.175; TCGA ESCA -0.128; TCGA KIRP -0.122; TCGA LGG -0.287; TCGA LIHC -0.096; TCGA LUAD -0.063; TCGA THCA -0.184; TCGA STAD -0.243
hsa-miR-30a-5p
PPP3R1
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.134; TCGA CESC -0.072; TCGA COAD -0.066; TCGA HNSC -0.062; TCGA KIRC -0.145; TCGA KIRP -0.181; TCGA LUAD -0.065; TCGA LUSC -0.114; TCGA PRAD -0.08; TCGA STAD -0.113; TCGA UCEC -0.058
hsa-miR-30a-5p
PRIM1
11 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BRCA -0.096; TCGA COAD -0.287; TCGA ESCA -0.157; TCGA KIRC -0.183; TCGA LGG -0.296; TCGA LIHC -0.341; TCGA LUAD -0.239; TCGA LUSC -0.319; TCGA PAAD -0.107; TCGA PRAD -0.11; TCGA STAD -0.401
hsa-miR-30a-5p
RAD23B
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.074; TCGA CESC -0.078; TCGA COAD -0.121; TCGA ESCA -0.174; TCGA HNSC -0.081; TCGA KIRP -0.079; TCGA LGG -0.124; TCGA LUAD -0.144; TCGA LUSC -0.141; TCGA PAAD -0.085; TCGA PRAD -0.085; TCGA THCA -0.257; TCGA STAD -0.152; TCGA UCEC -0.1
hsa-miR-30a-5p
RPN2
10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA BRCA -0.124; TCGA COAD -0.159; TCGA HNSC -0.071; TCGA KIRC -0.209; TCGA KIRP -0.134; TCGA LIHC -0.145; TCGA LUAD -0.141; TCGA LUSC -0.139; TCGA PAAD -0.136; TCGA STAD -0.152
hsa-miR-30a-5p
SH3GL1
12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.06; TCGA CESC -0.092; TCGA ESCA -0.201; TCGA HNSC -0.077; TCGA KIRC -0.47; TCGA KIRP -0.11; TCGA LGG -0.212; TCGA LIHC -0.05; TCGA LUAD -0.083; TCGA LUSC -0.194; TCGA THCA -0.243; TCGA UCEC -0.113
hsa-miR-30a-5p
SLC7A11
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC
miRNAWalker2 validate; mirMAP; miRNATAP
TCGA BRCA -0.136; TCGA ESCA -0.42; TCGA HNSC -0.652; TCGA KIRC -0.845; TCGA KIRP -1.145; TCGA LIHC -0.445; TCGA LUAD -0.274; TCGA LUSC -0.721; TCGA STAD -0.406; TCGA UCEC -0.137
hsa-miR-30a-5p
STMN1
14 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.22; TCGA COAD -0.183; TCGA ESCA -0.219; TCGA KIRC -0.155; TCGA LGG -0.248; TCGA LIHC -0.243; TCGA LUAD -0.229; TCGA LUSC -0.309; TCGA OV -0.113; TCGA PAAD -0.131; TCGA PRAD -0.151; TCGA THCA -0.391; TCGA STAD -0.343; TCGA UCEC -0.083
hsa-miR-30a-5p
TGFBI
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; OV; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.232; TCGA ESCA -0.432; TCGA HNSC -0.545; TCGA KIRC -1.864; TCGA KIRP -0.283; TCGA OV -0.186; TCGA PRAD -0.307; TCGA THCA -0.888; TCGA UCEC -0.317
hsa-miR-30a-5p
TIMM8A
9 cancers: BRCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; OV; STAD
miRNAWalker2 validate
TCGA BRCA -0.124; TCGA COAD -0.298; TCGA ESCA -0.165; TCGA KIRP -0.099; TCGA LGG -0.151; TCGA LUAD -0.225; TCGA LUSC -0.292; TCGA OV -0.088; TCGA STAD -0.277
hsa-miR-30a-5p
TOMM5
10 cancers: BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA BRCA -0.089; TCGA COAD -0.233; TCGA ESCA -0.19; TCGA KIRP -0.093; TCGA LGG -0.094; TCGA LIHC -0.128; TCGA LUAD -0.181; TCGA LUSC -0.2; TCGA PAAD -0.118; TCGA STAD -0.181
hsa-miR-30a-5p
TUBA1B
14 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.148; TCGA COAD -0.245; TCGA ESCA -0.205; TCGA HNSC -0.086; TCGA KIRC -0.555; TCGA KIRP -0.242; TCGA LIHC -0.156; TCGA LUAD -0.158; TCGA LUSC -0.139; TCGA OV -0.068; TCGA PAAD -0.124; TCGA THCA -0.207; TCGA STAD -0.222; TCGA UCEC -0.094
hsa-miR-30a-5p
UTP6
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD
miRNAWalker2 validate
TCGA BRCA -0.053; TCGA COAD -0.171; TCGA ESCA -0.107; TCGA HNSC -0.058; TCGA KIRC -0.118; TCGA KIRP -0.09; TCGA LGG -0.116; TCGA LIHC -0.106; TCGA LUAD -0.122; TCGA LUSC -0.135; TCGA SARC -0.064; TCGA STAD -0.133
hsa-miR-30a-5p
YRDC
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA BRCA -0.051; TCGA CESC -0.125; TCGA COAD -0.242; TCGA ESCA -0.12; TCGA HNSC -0.078; TCGA KIRP -0.098; TCGA LGG -0.155; TCGA LUAD -0.115; TCGA LUSC -0.141; TCGA PAAD -0.177; TCGA STAD -0.17
hsa-miR-30a-5p
YWHAZ
13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.184; TCGA CESC -0.114; TCGA ESCA -0.289; TCGA HNSC -0.257; TCGA KIRC -0.156; TCGA KIRP -0.18; TCGA LIHC -0.138; TCGA LUAD -0.201; TCGA LUSC -0.259; TCGA OV -0.162; TCGA PRAD -0.196; TCGA THCA -0.177; TCGA STAD -0.221
hsa-miR-30a-5p
UBE2I
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.055; TCGA COAD -0.101; TCGA ESCA -0.136; TCGA HNSC -0.057; TCGA KIRC -0.282; TCGA KIRP -0.116; TCGA LGG -0.142; TCGA LIHC -0.094; TCGA LUAD -0.079; TCGA LUSC -0.122; TCGA THCA -0.229; TCGA STAD -0.068; TCGA UCEC -0.07
hsa-miR-30a-5p
PHTF2
14 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.151; TCGA CESC -0.119; TCGA ESCA -0.096; TCGA KIRC -0.317; TCGA KIRP -0.171; TCGA LGG -0.297; TCGA LIHC -0.067; TCGA LUAD -0.198; TCGA LUSC -0.158; TCGA PAAD -0.118; TCGA PRAD -0.188; TCGA THCA -0.15; TCGA STAD -0.077; TCGA UCEC -0.098
hsa-miR-30a-5p
NUP93
9 cancers: BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BRCA -0.165; TCGA ESCA -0.138; TCGA HNSC -0.063; TCGA LGG -0.218; TCGA LIHC -0.056; TCGA LUAD -0.073; TCGA LUSC -0.176; TCGA STAD -0.216; TCGA UCEC -0.059
hsa-miR-30a-5p
SLC7A5
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.402; TCGA ESCA -0.399; TCGA HNSC -0.48; TCGA KIRC -0.612; TCGA KIRP -0.599; TCGA LUAD -0.447; TCGA LUSC -0.719; TCGA PRAD -0.5; TCGA THCA -0.696; TCGA STAD -0.311; TCGA UCEC -0.11
hsa-miR-30a-5p
PIGA
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.09; TCGA CESC -0.054; TCGA COAD -0.155; TCGA ESCA -0.094; TCGA HNSC -0.086; TCGA KIRC -0.088; TCGA KIRP -0.187; TCGA PRAD -0.134; TCGA THCA -0.088; TCGA STAD -0.19
hsa-miR-30a-5p
PGM3
11 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA BRCA -0.107; TCGA COAD -0.241; TCGA HNSC -0.085; TCGA KIRC -0.114; TCGA KIRP -0.182; TCGA LGG -0.142; TCGA LIHC -0.083; TCGA LUAD -0.147; TCGA LUSC -0.107; TCGA THCA -0.053; TCGA STAD -0.212
hsa-miR-30a-5p
UBE2F
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA
MirTarget; miRNATAP
TCGA BRCA -0.107; TCGA COAD -0.139; TCGA ESCA -0.099; TCGA HNSC -0.068; TCGA KIRC -0.165; TCGA KIRP -0.132; TCGA LIHC -0.054; TCGA LUAD -0.153; TCGA LUSC -0.06; TCGA OV -0.07; TCGA PAAD -0.076; TCGA THCA -0.075
hsa-miR-30a-5p
PSMD7
13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.178; TCGA CESC -0.11; TCGA ESCA -0.133; TCGA HNSC -0.09; TCGA KIRC -0.157; TCGA KIRP -0.107; TCGA LGG -0.067; TCGA LUAD -0.115; TCGA LUSC -0.198; TCGA PAAD -0.071; TCGA THCA -0.071; TCGA STAD -0.076; TCGA UCEC -0.096
hsa-miR-30a-5p
RTKN2
9 cancers: BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; THCA; STAD
MirTarget
TCGA BRCA -0.202; TCGA CESC -0.13; TCGA COAD -0.256; TCGA KIRC -0.373; TCGA KIRP -0.546; TCGA LGG -0.933; TCGA LIHC -0.562; TCGA THCA -0.581; TCGA STAD -0.564
hsa-miR-30a-5p
OTUD6B
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD
MirTarget
TCGA BRCA -0.078; TCGA CESC -0.102; TCGA COAD -0.186; TCGA ESCA -0.128; TCGA HNSC -0.08; TCGA LIHC -0.072; TCGA LUAD -0.149; TCGA LUSC -0.167; TCGA PRAD -0.105; TCGA SARC -0.088; TCGA STAD -0.24
hsa-miR-30a-5p
NRBP1
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; THCA
MirTarget; miRNATAP
TCGA BRCA -0.13; TCGA CESC -0.086; TCGA ESCA -0.132; TCGA HNSC -0.067; TCGA KIRC -0.216; TCGA KIRP -0.063; TCGA LIHC -0.068; TCGA LUAD -0.077; TCGA LUSC -0.153; TCGA THCA -0.184
hsa-miR-30a-5p
JOSD1
12 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.089; TCGA ESCA -0.092; TCGA HNSC -0.1; TCGA KIRC -0.182; TCGA KIRP -0.091; TCGA LGG -0.186; TCGA LUSC -0.082; TCGA PRAD -0.079; TCGA SARC -0.057; TCGA THCA -0.216; TCGA STAD -0.05; TCGA UCEC -0.066
hsa-miR-30a-5p
CELSR3
13 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.266; TCGA HNSC -0.283; TCGA KIRC -0.653; TCGA KIRP -0.272; TCGA LGG -0.941; TCGA LIHC -0.452; TCGA LUAD -0.412; TCGA LUSC -0.378; TCGA PAAD -0.571; TCGA PRAD -0.411; TCGA SARC -0.244; TCGA THCA -0.416; TCGA STAD -0.35
hsa-miR-30a-5p
ATG12
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; THCA; UCEC
MirTarget
TCGA BRCA -0.077; TCGA HNSC -0.084; TCGA KIRC -0.377; TCGA KIRP -0.175; TCGA LGG -0.131; TCGA LIHC -0.072; TCGA OV -0.063; TCGA THCA -0.108; TCGA UCEC -0.056
hsa-miR-30a-5p
DGKZ
10 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.059; TCGA COAD -0.098; TCGA ESCA -0.124; TCGA KIRC -0.378; TCGA KIRP -0.235; TCGA LIHC -0.131; TCGA LUSC -0.095; TCGA PAAD -0.118; TCGA THCA -0.224; TCGA STAD -0.17
hsa-miR-30a-5p
FAM91A1
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD
MirTarget
TCGA BRCA -0.119; TCGA CESC -0.083; TCGA COAD -0.137; TCGA ESCA -0.145; TCGA HNSC -0.189; TCGA LUAD -0.155; TCGA LUSC -0.163; TCGA OV -0.132; TCGA PRAD -0.181; TCGA STAD -0.295
hsa-miR-30a-5p
DOLPP1
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.059; TCGA CESC -0.072; TCGA COAD -0.153; TCGA ESCA -0.17; TCGA HNSC -0.104; TCGA LGG -0.21; TCGA LIHC -0.101; TCGA LUAD -0.098; TCGA LUSC -0.246; TCGA PAAD -0.11; TCGA STAD -0.144; TCGA UCEC -0.14
hsa-miR-30a-5p
CTHRC1
13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.274; TCGA CESC -0.129; TCGA ESCA -0.381; TCGA HNSC -0.254; TCGA KIRC -1.594; TCGA KIRP -0.841; TCGA LIHC -0.237; TCGA LUAD -0.653; TCGA LUSC -0.623; TCGA OV -0.271; TCGA PRAD -0.733; TCGA THCA -1.582; TCGA STAD -0.298
hsa-miR-30a-5p
MYBL2
13 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.579; TCGA ESCA -0.4; TCGA HNSC -0.333; TCGA KIRC -1.814; TCGA KIRP -0.976; TCGA LGG -0.922; TCGA LIHC -0.734; TCGA LUAD -0.758; TCGA LUSC -0.932; TCGA OV -0.154; TCGA PRAD -0.342; TCGA THCA -0.846; TCGA STAD -0.721
hsa-miR-30a-5p
ATP2B1
9 cancers: BRCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BRCA -0.052; TCGA HNSC -0.143; TCGA KIRP -0.13; TCGA LIHC -0.159; TCGA LUSC -0.152; TCGA PAAD -0.212; TCGA PRAD -0.085; TCGA THCA -0.076; TCGA UCEC -0.058
hsa-miR-30a-5p
RAP2C
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BRCA -0.135; TCGA CESC -0.166; TCGA ESCA -0.101; TCGA HNSC -0.12; TCGA KIRC -0.097; TCGA KIRP -0.14; TCGA LUAD -0.058; TCGA OV -0.102; TCGA PRAD -0.119; TCGA THCA -0.194; TCGA STAD -0.105
hsa-miR-30a-5p
DLGAP4
9 cancers: BRCA; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.084; TCGA ESCA -0.079; TCGA HNSC -0.079; TCGA KIRC -0.369; TCGA LGG -0.105; TCGA LUAD -0.115; TCGA PAAD -0.161; TCGA THCA -0.273; TCGA UCEC -0.06
hsa-miR-30a-5p
CUL2
10 cancers: BRCA; CESC; COAD; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BRCA -0.07; TCGA CESC -0.078; TCGA COAD -0.071; TCGA KIRP -0.082; TCGA LGG -0.242; TCGA LUAD -0.108; TCGA LUSC -0.082; TCGA PRAD -0.078; TCGA SARC -0.06; TCGA STAD -0.102
hsa-miR-30a-5p
VOPP1
11 cancers: BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.138; TCGA KIRC -0.335; TCGA KIRP -0.097; TCGA LIHC -0.075; TCGA LUAD -0.074; TCGA LUSC -0.122; TCGA OV -0.075; TCGA PAAD -0.206; TCGA THCA -0.322; TCGA STAD -0.141; TCGA UCEC -0.057
hsa-miR-30a-5p
UBE2V2
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD
MirTarget
TCGA BRCA -0.148; TCGA CESC -0.097; TCGA COAD -0.128; TCGA ESCA -0.169; TCGA HNSC -0.119; TCGA KIRC -0.073; TCGA KIRP -0.097; TCGA LGG -0.077; TCGA LIHC -0.083; TCGA LUAD -0.233; TCGA LUSC -0.203; TCGA PAAD -0.085; TCGA STAD -0.099
hsa-miR-30a-5p
DDIT4
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.105; TCGA ESCA -0.162; TCGA HNSC -0.154; TCGA KIRC -0.875; TCGA KIRP -0.467; TCGA LUSC -0.205; TCGA PRAD -0.352; TCGA THCA -0.359; TCGA UCEC -0.18
hsa-miR-30a-5p
PITX1
9 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC
mirMAP; miRNATAP
TCGA BRCA -0.276; TCGA CESC -0.615; TCGA COAD -0.22; TCGA ESCA -0.406; TCGA KIRC -0.825; TCGA KIRP -0.883; TCGA LIHC -0.523; TCGA LUAD -0.449; TCGA LUSC -1.29
hsa-miR-30a-5p
CAND1
11 cancers: BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.077; TCGA CESC -0.09; TCGA COAD -0.129; TCGA HNSC -0.142; TCGA LGG -0.119; TCGA LUAD -0.12; TCGA LUSC -0.183; TCGA PRAD -0.118; TCGA THCA -0.158; TCGA STAD -0.206; TCGA UCEC -0.063
hsa-miR-30a-5p
INHBA
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.339; TCGA ESCA -0.466; TCGA HNSC -0.689; TCGA KIRC -0.765; TCGA KIRP -0.71; TCGA LUAD -0.292; TCGA OV -0.329; TCGA PRAD -0.808; TCGA THCA -1.138; TCGA STAD -0.35; TCGA UCEC -0.243
hsa-miR-30a-5p
NLN
11 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.095; TCGA COAD -0.13; TCGA ESCA -0.156; TCGA HNSC -0.142; TCGA LUAD -0.194; TCGA LUSC -0.335; TCGA PRAD -0.148; TCGA SARC -0.11; TCGA THCA -0.309; TCGA STAD -0.277; TCGA UCEC -0.107
hsa-miR-30a-5p
PHF20L1
10 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD
mirMAP
TCGA BRCA -0.081; TCGA CESC -0.075; TCGA ESCA -0.158; TCGA HNSC -0.073; TCGA LGG -0.129; TCGA LUAD -0.136; TCGA LUSC -0.11; TCGA OV -0.11; TCGA PRAD -0.119; TCGA STAD -0.109
hsa-miR-30a-5p
GCH1
12 cancers: BRCA; CESC; COAD; ESCA; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.19; TCGA CESC -0.126; TCGA COAD -0.168; TCGA ESCA -0.126; TCGA KIRP -0.187; TCGA LUAD -0.166; TCGA OV -0.11; TCGA PAAD -0.419; TCGA PRAD -0.17; TCGA THCA -0.279; TCGA STAD -0.322; TCGA UCEC -0.076
hsa-miR-30a-5p
NAV1
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; UCEC
mirMAP; miRNATAP
TCGA BRCA -0.05; TCGA ESCA -0.292; TCGA HNSC -0.33; TCGA KIRC -0.523; TCGA KIRP -0.449; TCGA LGG -0.412; TCGA LUAD -0.289; TCGA LUSC -0.31; TCGA THCA -0.236; TCGA UCEC -0.153
hsa-miR-30a-5p
HAUS2
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.051; TCGA CESC -0.097; TCGA COAD -0.131; TCGA ESCA -0.15; TCGA HNSC -0.088; TCGA LUSC -0.057; TCGA PRAD -0.088; TCGA STAD -0.227; TCGA UCEC -0.069
hsa-miR-30a-5p
POLR2D
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
mirMAP
TCGA BRCA -0.124; TCGA COAD -0.193; TCGA ESCA -0.127; TCGA HNSC -0.07; TCGA KIRC -0.177; TCGA KIRP -0.167; TCGA LGG -0.235; TCGA LIHC -0.14; TCGA LUAD -0.184; TCGA LUSC -0.236; TCGA THCA -0.098; TCGA STAD -0.195
hsa-miR-30a-5p
GPR180
11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BRCA -0.115; TCGA COAD -0.134; TCGA ESCA -0.086; TCGA HNSC -0.092; TCGA KIRC -0.132; TCGA KIRP -0.105; TCGA LUAD -0.146; TCGA LUSC -0.115; TCGA PAAD -0.13; TCGA PRAD -0.1; TCGA STAD -0.22
hsa-miR-30a-5p
SNRPD1
13 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD
mirMAP
TCGA BRCA -0.067; TCGA COAD -0.329; TCGA ESCA -0.215; TCGA KIRC -0.142; TCGA KIRP -0.203; TCGA LGG -0.214; TCGA LIHC -0.217; TCGA LUAD -0.215; TCGA LUSC -0.292; TCGA OV -0.079; TCGA PAAD -0.105; TCGA THCA -0.127; TCGA STAD -0.244
hsa-miR-30a-5p
LRRC15
12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.302; TCGA CESC -0.402; TCGA ESCA -0.322; TCGA HNSC -0.472; TCGA KIRC -1.215; TCGA LUAD -0.557; TCGA LUSC -0.611; TCGA OV -0.403; TCGA PRAD -0.783; TCGA THCA -1.336; TCGA STAD -0.476; TCGA UCEC -0.268
hsa-miR-30a-5p
SOX11
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; STAD
mirMAP
TCGA BRCA -0.54; TCGA HNSC -0.317; TCGA KIRC -1.626; TCGA KIRP -0.447; TCGA LGG -0.999; TCGA LUAD -0.388; TCGA LUSC -0.626; TCGA THCA -1.626; TCGA STAD -0.302
hsa-miR-30a-5p
RAP2B
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PRAD; THCA
mirMAP
TCGA BRCA -0.149; TCGA CESC -0.25; TCGA ESCA -0.192; TCGA HNSC -0.29; TCGA KIRC -0.462; TCGA KIRP -0.467; TCGA LUSC -0.283; TCGA OV -0.072; TCGA PRAD -0.198; TCGA THCA -0.54
hsa-miR-30a-5p
C3orf58
9 cancers: BRCA; CESC; COAD; KIRC; KIRP; LUSC; PRAD; SARC; UCEC
mirMAP
TCGA BRCA -0.073; TCGA CESC -0.249; TCGA COAD -0.105; TCGA KIRC -0.248; TCGA KIRP -0.247; TCGA LUSC -0.17; TCGA PRAD -0.172; TCGA SARC -0.137; TCGA UCEC -0.095
hsa-miR-30a-5p
RABIF
14 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.131; TCGA CESC -0.087; TCGA ESCA -0.151; TCGA HNSC -0.067; TCGA KIRC -0.091; TCGA KIRP -0.179; TCGA LGG -0.069; TCGA LIHC -0.164; TCGA LUAD -0.146; TCGA LUSC -0.14; TCGA SARC -0.095; TCGA THCA -0.256; TCGA STAD -0.074; TCGA UCEC -0.114
hsa-miR-30a-5p
MEX3B
9 cancers: BRCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BRCA -0.105; TCGA KIRC -0.683; TCGA LGG -1.063; TCGA LUAD -0.206; TCGA LUSC -0.271; TCGA PRAD -0.367; TCGA SARC -0.178; TCGA THCA -0.324; TCGA UCEC -0.282
hsa-miR-30a-5p
CCNE2
15 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.39; TCGA CESC -0.229; TCGA COAD -0.439; TCGA ESCA -0.217; TCGA HNSC -0.161; TCGA KIRC -0.724; TCGA KIRP -0.417; TCGA LGG -0.404; TCGA LIHC -0.356; TCGA LUAD -0.486; TCGA LUSC -0.53; TCGA PRAD -0.434; TCGA THCA -0.358; TCGA STAD -0.478; TCGA UCEC -0.176
hsa-miR-30a-5p
RHEBL1
11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; STAD
miRNATAP
TCGA BRCA -0.217; TCGA CESC -0.091; TCGA ESCA -0.222; TCGA KIRC -0.824; TCGA KIRP -0.224; TCGA LIHC -0.203; TCGA LUAD -0.194; TCGA LUSC -0.197; TCGA OV -0.175; TCGA THCA -0.404; TCGA STAD -0.359
hsa-miR-30a-5p
RAB15
10 cancers: BRCA; COAD; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.13; TCGA COAD -0.378; TCGA KIRP -0.299; TCGA LUAD -0.115; TCGA LUSC -0.122; TCGA PAAD -0.266; TCGA PRAD -0.18; TCGA THCA -0.184; TCGA STAD -0.339; TCGA UCEC -0.108
hsa-miR-30a-5p
NEURL1B
10 cancers: BRCA; CESC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.069; TCGA CESC -0.201; TCGA KIRC -0.325; TCGA KIRP -0.426; TCGA LGG -0.256; TCGA LUAD -0.141; TCGA PAAD -0.159; TCGA PRAD -0.195; TCGA THCA -0.363; TCGA UCEC -0.19
hsa-miR-30a-5p
NID1
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.117; TCGA HNSC -0.244; TCGA KIRC -0.615; TCGA KIRP -0.337; TCGA LGG -0.215; TCGA LUAD -0.098; TCGA PRAD -0.278; TCGA THCA -0.487; TCGA UCEC -0.116
hsa-miR-30a-5p
E2F3
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA BRCA -0.128; TCGA ESCA -0.104; TCGA HNSC -0.084; TCGA KIRC -0.143; TCGA KIRP -0.216; TCGA LGG -0.411; TCGA LUAD -0.211; TCGA LUSC -0.217; TCGA PRAD -0.191; TCGA THCA -0.051; TCGA STAD -0.265
hsa-miR-30a-5p
SYNGR3
9 cancers: BRCA; CESC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA
miRNATAP
TCGA BRCA -0.194; TCGA CESC -0.222; TCGA LIHC -0.197; TCGA LUAD -0.413; TCGA LUSC -0.335; TCGA OV -0.22; TCGA PAAD -0.229; TCGA PRAD -0.364; TCGA THCA -1.071
hsa-miR-30a-5p
RPIA
10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
miRNATAP
TCGA BRCA -0.063; TCGA COAD -0.186; TCGA KIRC -0.208; TCGA KIRP -0.184; TCGA LGG -0.21; TCGA LIHC -0.115; TCGA LUAD -0.101; TCGA LUSC -0.116; TCGA THCA -0.099; TCGA STAD -0.243
hsa-miR-30a-5p
NRBF2
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; STAD
miRNATAP
TCGA BRCA -0.099; TCGA CESC -0.068; TCGA ESCA -0.132; TCGA HNSC -0.163; TCGA KIRC -0.172; TCGA KIRP -0.161; TCGA LGG -0.077; TCGA LUAD -0.053; TCGA PRAD -0.069; TCGA STAD -0.088
hsa-miR-30a-5p
ASAP1
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; OV; PRAD; THCA
miRNATAP
TCGA BRCA -0.143; TCGA CESC -0.105; TCGA HNSC -0.195; TCGA KIRC -0.379; TCGA KIRP -0.31; TCGA LGG -0.086; TCGA LUAD -0.063; TCGA OV -0.072; TCGA PRAD -0.256; TCGA THCA -0.235
hsa-miR-30a-5p
PDSS1
13 cancers: BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD
miRNATAP
TCGA BRCA -0.2; TCGA CESC -0.115; TCGA COAD -0.428; TCGA ESCA -0.256; TCGA KIRP -0.141; TCGA LGG -0.273; TCGA LIHC -0.153; TCGA LUAD -0.225; TCGA LUSC -0.214; TCGA OV -0.089; TCGA PAAD -0.115; TCGA SARC -0.106; TCGA STAD -0.41
hsa-miR-30a-5p
KCTD5
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNATAP
TCGA BRCA -0.137; TCGA CESC -0.154; TCGA COAD -0.108; TCGA ESCA -0.178; TCGA HNSC -0.149; TCGA KIRC -0.23; TCGA KIRP -0.112; TCGA LGG -0.162; TCGA LUAD -0.111; TCGA LUSC -0.157; TCGA OV -0.062; TCGA PRAD -0.103; TCGA THCA -0.13; TCGA STAD -0.242
hsa-miR-30a-5p
FOXN2
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; THCA; STAD
miRNATAP
TCGA BRCA -0.142; TCGA ESCA -0.147; TCGA HNSC -0.227; TCGA KIRC -0.12; TCGA KIRP -0.134; TCGA LGG -0.396; TCGA PRAD -0.222; TCGA THCA -0.097; TCGA STAD -0.24
hsa-miR-30a-5p
POLR3G
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.084; TCGA CESC -0.3; TCGA COAD -0.259; TCGA ESCA -0.404; TCGA HNSC -0.219; TCGA KIRC -0.399; TCGA KIRP -0.158; TCGA LUAD -0.206; TCGA LUSC -0.268; TCGA PRAD -0.338; TCGA STAD -0.474; TCGA UCEC -0.104
hsa-miR-30a-5p
FAP
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNATAP
TCGA BRCA -0.246; TCGA ESCA -0.389; TCGA HNSC -0.302; TCGA KIRC -1.551; TCGA KIRP -1.32; TCGA LUAD -0.349; TCGA LUSC -0.285; TCGA OV -0.293; TCGA PRAD -0.633; TCGA THCA -1.482; TCGA STAD -0.281
hsa-miR-30a-5p
LOX
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; THCA
miRNATAP
TCGA BRCA -0.228; TCGA CESC -0.163; TCGA ESCA -0.204; TCGA HNSC -0.285; TCGA KIRC -1.596; TCGA KIRP -0.438; TCGA LUAD -0.123; TCGA PRAD -0.184; TCGA THCA -1.258
hsa-miR-30a-5p
AZIN1
11 cancers: BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD
miRNATAP
TCGA BRCA -0.126; TCGA ESCA -0.098; TCGA HNSC -0.059; TCGA KIRP -0.215; TCGA LGG -0.089; TCGA LIHC -0.123; TCGA LUAD -0.14; TCGA LUSC -0.135; TCGA OV -0.118; TCGA PRAD -0.096; TCGA STAD -0.229
hsa-miR-30a-5p
HOXA11
9 cancers: BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BRCA -0.273; TCGA ESCA -0.489; TCGA HNSC -0.435; TCGA KIRP -0.572; TCGA LIHC -0.355; TCGA LUAD -0.413; TCGA LUSC -0.92; TCGA STAD -1.248; TCGA UCEC -0.338
hsa-miR-30a-5p
MAPRE1
9 cancers: BRCA; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; STAD
miRNATAP
TCGA BRCA -0.105; TCGA ESCA -0.063; TCGA HNSC -0.117; TCGA LGG -0.103; TCGA LUAD -0.125; TCGA LUSC -0.106; TCGA OV -0.055; TCGA PAAD -0.133; TCGA STAD -0.084
hsa-miR-30a-5p
CASP3
13 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.147; TCGA COAD -0.203; TCGA KIRC -0.346; TCGA KIRP -0.218; TCGA LIHC -0.075; TCGA LUAD -0.092; TCGA LUSC -0.174; TCGA OV -0.104; TCGA PAAD -0.08; TCGA PRAD -0.148; TCGA THCA -0.233; TCGA STAD -0.237; TCGA UCEC -0.066
hsa-miR-30a-5p
HSPA5
10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BRCA -0.061; TCGA COAD -0.197; TCGA HNSC -0.107; TCGA KIRC -0.157; TCGA KIRP -0.128; TCGA LIHC -0.183; TCGA LUAD -0.153; TCGA LUSC -0.16; TCGA PAAD -0.123; TCGA STAD -0.182
hsa-miR-30a-5p
RBM15
10 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD
miRNATAP
TCGA BRCA -0.051; TCGA COAD -0.138; TCGA HNSC -0.062; TCGA KIRP -0.13; TCGA LGG -0.133; TCGA LIHC -0.056; TCGA LUAD -0.066; TCGA LUSC -0.091; TCGA SARC -0.094; TCGA STAD -0.169
hsa-miR-30a-5p
ZIC2
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; STAD
miRNATAP
TCGA BRCA -0.438; TCGA COAD -0.756; TCGA ESCA -0.624; TCGA HNSC -0.592; TCGA KIRC -1.038; TCGA KIRP -0.793; TCGA LIHC -0.85; TCGA LUSC -1.038; TCGA STAD -1.354
hsa-miR-30a-5p
EIF4A3
10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
RAID
TCGA BRCA -0.061; TCGA COAD -0.203; TCGA KIRC -0.078; TCGA KIRP -0.145; TCGA LGG -0.143; TCGA LIHC -0.076; TCGA LUAD -0.183; TCGA LUSC -0.258; TCGA THCA -0.074; TCGA STAD -0.163
hsa-miR-30a-5p
CDCP1
10 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA CESC -0.162; TCGA COAD -0.144; TCGA ESCA -0.291; TCGA HNSC -0.233; TCGA KIRC -0.571; TCGA KIRP -0.849; TCGA LUSC -0.291; TCGA PRAD -0.4; TCGA THCA -0.468; TCGA STAD -0.439
hsa-miR-30a-5p
CPSF4
9 cancers: CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC
miRNAWalker2 validate
TCGA CESC -0.062; TCGA COAD -0.14; TCGA KIRC -0.203; TCGA KIRP -0.098; TCGA LIHC -0.184; TCGA LUAD -0.144; TCGA LUSC -0.231; TCGA STAD -0.118; TCGA UCEC -0.079
hsa-miR-30a-5p
HNRNPM
11 cancers: CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA CESC -0.052; TCGA COAD -0.121; TCGA ESCA -0.097; TCGA LGG -0.17; TCGA LIHC -0.07; TCGA LUAD -0.061; TCGA LUSC -0.135; TCGA PAAD -0.083; TCGA SARC -0.062; TCGA STAD -0.164; TCGA UCEC -0.103
hsa-miR-30a-5p
NDE1
9 cancers: CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA CESC -0.144; TCGA ESCA -0.111; TCGA HNSC -0.233; TCGA KIRC -0.168; TCGA LUAD -0.136; TCGA LUSC -0.241; TCGA PRAD -0.298; TCGA THCA -0.233; TCGA UCEC -0.092
hsa-miR-30a-5p
NOL8
10 cancers: CESC; COAD; ESCA; KIRC; LGG; LIHC; LUSC; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA CESC -0.102; TCGA COAD -0.123; TCGA ESCA -0.083; TCGA KIRC -0.09; TCGA LGG -0.163; TCGA LIHC -0.054; TCGA LUSC -0.121; TCGA PRAD -0.073; TCGA SARC -0.06; TCGA STAD -0.205
hsa-miR-30a-5p
NOP14
10 cancers: CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA CESC -0.051; TCGA COAD -0.256; TCGA HNSC -0.064; TCGA KIRP -0.171; TCGA LGG -0.154; TCGA LUAD -0.093; TCGA LUSC -0.109; TCGA SARC -0.069; TCGA STAD -0.292; TCGA UCEC -0.106
hsa-miR-30a-5p
PLIN3
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; SARC; THCA; UCEC
miRNAWalker2 validate; MirTarget
TCGA CESC -0.113; TCGA ESCA -0.157; TCGA HNSC -0.085; TCGA KIRC -0.433; TCGA KIRP -0.1; TCGA LIHC -0.073; TCGA LUSC -0.1; TCGA OV -0.062; TCGA SARC -0.089; TCGA THCA -0.15; TCGA UCEC -0.11
hsa-miR-30a-5p
RBM34
13 cancers: CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA CESC -0.063; TCGA COAD -0.112; TCGA ESCA -0.159; TCGA KIRC -0.095; TCGA KIRP -0.146; TCGA LGG -0.178; TCGA LIHC -0.189; TCGA LUAD -0.112; TCGA LUSC -0.167; TCGA SARC -0.069; TCGA THCA -0.071; TCGA STAD -0.098; TCGA UCEC -0.064
hsa-miR-30a-5p
REXO1
9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA CESC -0.066; TCGA COAD -0.082; TCGA ESCA -0.071; TCGA HNSC -0.057; TCGA KIRC -0.186; TCGA LGG -0.147; TCGA LUSC -0.068; TCGA THCA -0.086; TCGA STAD -0.11
hsa-miR-30a-5p
TBC1D10B
12 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA CESC -0.065; TCGA COAD -0.076; TCGA ESCA -0.1; TCGA HNSC -0.08; TCGA KIRC -0.203; TCGA KIRP -0.079; TCGA LGG -0.144; TCGA LUAD -0.109; TCGA LUSC -0.139; TCGA SARC -0.061; TCGA THCA -0.082; TCGA STAD -0.116
hsa-miR-30a-5p
RARG
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA
MirTarget; miRNATAP
TCGA CESC -0.267; TCGA ESCA -0.263; TCGA HNSC -0.114; TCGA KIRC -0.34; TCGA KIRP -0.287; TCGA LUSC -0.274; TCGA PRAD -0.318; TCGA SARC -0.189; TCGA THCA -0.394
hsa-miR-30a-5p
CSNK1A1
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; UCEC
MirTarget; miRNATAP
TCGA CESC -0.135; TCGA ESCA -0.109; TCGA HNSC -0.154; TCGA KIRC -0.164; TCGA KIRP -0.078; TCGA LUSC -0.084; TCGA PAAD -0.085; TCGA THCA -0.098; TCGA UCEC -0.062
hsa-miR-30a-5p
BTBD10
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA
MirTarget; miRNATAP
TCGA CESC -0.146; TCGA ESCA -0.083; TCGA HNSC -0.091; TCGA KIRC -0.135; TCGA KIRP -0.088; TCGA LUAD -0.053; TCGA LUSC -0.132; TCGA SARC -0.067; TCGA THCA -0.211
hsa-miR-30a-5p
FRMD6
10 cancers: CESC; HNSC; KIRC; KIRP; LUSC; OV; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA CESC -0.469; TCGA HNSC -0.196; TCGA KIRC -0.365; TCGA KIRP -0.42; TCGA LUSC -0.443; TCGA OV -0.155; TCGA PRAD -0.151; TCGA SARC -0.2; TCGA THCA -0.489; TCGA UCEC -0.258
hsa-miR-30a-5p
FAM104A
12 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA
MirTarget
TCGA CESC -0.057; TCGA COAD -0.128; TCGA ESCA -0.082; TCGA HNSC -0.07; TCGA KIRC -0.191; TCGA KIRP -0.184; TCGA LGG -0.183; TCGA LIHC -0.079; TCGA LUAD -0.131; TCGA LUSC -0.129; TCGA PAAD -0.089; TCGA THCA -0.053
hsa-miR-30a-5p
FOXK1
11 cancers: CESC; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA CESC -0.101; TCGA HNSC -0.16; TCGA LGG -0.091; TCGA LIHC -0.129; TCGA LUAD -0.063; TCGA LUSC -0.16; TCGA PAAD -0.225; TCGA PRAD -0.232; TCGA SARC -0.105; TCGA THCA -0.158; TCGA STAD -0.095
hsa-miR-30a-5p
MAFG
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD
mirMAP; miRNATAP
TCGA CESC -0.078; TCGA ESCA -0.086; TCGA HNSC -0.072; TCGA KIRC -0.086; TCGA KIRP -0.113; TCGA LGG -0.13; TCGA LUSC -0.182; TCGA PAAD -0.077; TCGA PRAD -0.141
hsa-miR-30a-5p
C7orf43
10 cancers: CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNATAP
TCGA CESC -0.136; TCGA ESCA -0.079; TCGA HNSC -0.114; TCGA KIRC -0.149; TCGA LIHC -0.098; TCGA LUAD -0.053; TCGA LUSC -0.118; TCGA PAAD -0.15; TCGA THCA -0.103; TCGA STAD -0.092
hsa-miR-30a-5p
RAB38
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; THCA; UCEC
miRNATAP
TCGA CESC -0.312; TCGA ESCA -0.559; TCGA HNSC -0.353; TCGA KIRC -0.251; TCGA KIRP -0.213; TCGA LUSC -0.396; TCGA PRAD -0.269; TCGA THCA -0.14; TCGA UCEC -0.095
hsa-miR-30a-5p
MOV10
9 cancers: CESC; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; THCA; STAD
miRNATAP
TCGA CESC -0.059; TCGA HNSC -0.054; TCGA KIRC -0.117; TCGA KIRP -0.161; TCGA LIHC -0.166; TCGA LUSC -0.073; TCGA SARC -0.108; TCGA THCA -0.27; TCGA STAD -0.176
hsa-miR-30a-5p
UBE2D2
9 cancers: CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD
miRNATAP
TCGA CESC -0.065; TCGA COAD -0.108; TCGA ESCA -0.108; TCGA KIRC -0.16; TCGA KIRP -0.11; TCGA LIHC -0.077; TCGA LUAD -0.065; TCGA LUSC -0.066; TCGA PAAD -0.094
hsa-miR-30a-5p
PHF13
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; UCEC
miRNATAP
TCGA CESC -0.106; TCGA ESCA -0.075; TCGA HNSC -0.054; TCGA KIRC -0.075; TCGA KIRP -0.151; TCGA LUAD -0.101; TCGA LUSC -0.142; TCGA SARC -0.097; TCGA THCA -0.214; TCGA UCEC -0.054
hsa-miR-30a-5p
SEH1L
11 cancers: CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNATAP
TCGA CESC -0.086; TCGA COAD -0.218; TCGA ESCA -0.102; TCGA KIRP -0.062; TCGA LGG -0.059; TCGA LIHC -0.061; TCGA LUAD -0.131; TCGA LUSC -0.17; TCGA PAAD -0.085; TCGA THCA -0.116; TCGA STAD -0.266
hsa-miR-30a-5p
ANAPC5
10 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRNAWalker2 validate
TCGA COAD -0.202; TCGA ESCA -0.086; TCGA KIRC -0.144; TCGA LGG -0.129; TCGA LIHC -0.109; TCGA LUAD -0.094; TCGA LUSC -0.108; TCGA PAAD -0.111; TCGA SARC -0.093; TCGA STAD -0.141
hsa-miR-30a-5p
CEP72
10 cancers: COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; STAD
miRNAWalker2 validate
TCGA COAD -0.349; TCGA ESCA -0.234; TCGA HNSC -0.119; TCGA KIRC -0.15; TCGA LGG -0.148; TCGA LIHC -0.273; TCGA LUAD -0.233; TCGA LUSC -0.322; TCGA PRAD -0.076; TCGA STAD -0.394
hsa-miR-30a-5p
CPSF1
11 cancers: COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD
miRNAWalker2 validate
TCGA COAD -0.133; TCGA ESCA -0.122; TCGA HNSC -0.077; TCGA KIRC -0.186; TCGA LGG -0.239; TCGA LIHC -0.15; TCGA LUAD -0.109; TCGA LUSC -0.163; TCGA SARC -0.084; TCGA THCA -0.133; TCGA STAD -0.25
hsa-miR-30a-5p
EIF2B1
9 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; THCA
miRNAWalker2 validate
TCGA COAD -0.093; TCGA ESCA -0.115; TCGA KIRC -0.134; TCGA LGG -0.096; TCGA LIHC -0.101; TCGA LUAD -0.125; TCGA LUSC -0.104; TCGA PAAD -0.062; TCGA THCA -0.06
hsa-miR-30a-5p
EIF2B4
9 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; SARC; THCA
miRNAWalker2 validate
TCGA COAD -0.113; TCGA ESCA -0.055; TCGA KIRC -0.088; TCGA LGG -0.133; TCGA LIHC -0.106; TCGA LUAD -0.089; TCGA LUSC -0.107; TCGA SARC -0.056; TCGA THCA -0.061
hsa-miR-30a-5p
HNRNPA1
10 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA COAD -0.243; TCGA ESCA -0.079; TCGA KIRC -0.141; TCGA LGG -0.386; TCGA LIHC -0.15; TCGA LUAD -0.082; TCGA LUSC -0.09; TCGA THCA -0.12; TCGA STAD -0.209; TCGA UCEC -0.076
hsa-miR-30a-5p
HNRNPA1L2
9 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; THCA; UCEC
miRNAWalker2 validate
TCGA COAD -0.248; TCGA ESCA -0.095; TCGA KIRC -0.096; TCGA LGG -0.37; TCGA LIHC -0.104; TCGA LUAD -0.079; TCGA LUSC -0.114; TCGA THCA -0.101; TCGA UCEC -0.102
hsa-miR-30a-5p
LSM12
10 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD
miRNAWalker2 validate
TCGA COAD -0.231; TCGA ESCA -0.124; TCGA HNSC -0.068; TCGA KIRC -0.067; TCGA KIRP -0.147; TCGA LGG -0.101; TCGA LIHC -0.056; TCGA LUAD -0.175; TCGA LUSC -0.201; TCGA STAD -0.168
hsa-miR-30a-5p
NXT1
12 cancers: COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD
miRNAWalker2 validate
TCGA COAD -0.153; TCGA ESCA -0.177; TCGA KIRC -0.285; TCGA KIRP -0.125; TCGA LGG -0.129; TCGA LIHC -0.12; TCGA LUAD -0.147; TCGA LUSC -0.181; TCGA OV -0.078; TCGA PAAD -0.156; TCGA THCA -0.081; TCGA STAD -0.144
hsa-miR-30a-5p
PRPF19
11 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD
miRNAWalker2 validate
TCGA COAD -0.218; TCGA ESCA -0.206; TCGA HNSC -0.061; TCGA KIRC -0.099; TCGA KIRP -0.078; TCGA LGG -0.143; TCGA LIHC -0.055; TCGA LUAD -0.113; TCGA LUSC -0.214; TCGA SARC -0.06; TCGA STAD -0.192
hsa-miR-30a-5p
REXO4
9 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA COAD -0.107; TCGA ESCA -0.16; TCGA KIRC -0.156; TCGA LGG -0.177; TCGA LIHC -0.167; TCGA LUAD -0.081; TCGA LUSC -0.165; TCGA PAAD -0.066; TCGA STAD -0.176
hsa-miR-30a-5p
TIMM9
10 cancers: COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD
miRNAWalker2 validate
TCGA COAD -0.263; TCGA ESCA -0.116; TCGA KIRC -0.153; TCGA KIRP -0.1; TCGA LGG -0.176; TCGA LIHC -0.174; TCGA LUAD -0.174; TCGA LUSC -0.169; TCGA OV -0.078; TCGA PAAD -0.081
hsa-miR-30a-5p
UAP1
9 cancers: COAD; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; THCA; UCEC
miRNAWalker2 validate
TCGA COAD -0.204; TCGA KIRC -0.106; TCGA KIRP -0.161; TCGA LGG -0.081; TCGA LIHC -0.077; TCGA LUAD -0.162; TCGA PAAD -0.112; TCGA THCA -0.276; TCGA UCEC -0.097
hsa-miR-30a-5p
UGDH
12 cancers: COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA COAD -0.193; TCGA HNSC -0.142; TCGA KIRC -0.226; TCGA KIRP -0.175; TCGA LGG -0.346; TCGA LIHC -0.127; TCGA LUAD -0.262; TCGA LUSC -0.329; TCGA PAAD -0.165; TCGA PRAD -0.193; TCGA THCA -0.062; TCGA STAD -0.136
hsa-miR-30a-5p
RBM12
11 cancers: COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.123; TCGA HNSC -0.065; TCGA LGG -0.259; TCGA LIHC -0.059; TCGA LUAD -0.079; TCGA LUSC -0.091; TCGA PAAD -0.073; TCGA PRAD -0.065; TCGA SARC -0.052; TCGA STAD -0.142; TCGA UCEC -0.053
hsa-miR-30a-5p
ZBTB6
9 cancers: COAD; HNSC; LGG; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA COAD -0.095; TCGA HNSC -0.058; TCGA LGG -0.199; TCGA LUSC -0.056; TCGA OV -0.06; TCGA PAAD -0.107; TCGA PRAD -0.161; TCGA STAD -0.068; TCGA UCEC -0.092
hsa-miR-30a-5p
MESDC2
9 cancers: COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA COAD -0.261; TCGA KIRC -0.106; TCGA KIRP -0.122; TCGA LIHC -0.094; TCGA LUAD -0.058; TCGA LUSC -0.073; TCGA PAAD -0.069; TCGA STAD -0.081; TCGA UCEC -0.07
hsa-miR-30a-5p
METTL2B
9 cancers: COAD; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA COAD -0.098; TCGA LGG -0.094; TCGA LIHC -0.067; TCGA LUAD -0.148; TCGA LUSC -0.121; TCGA PAAD -0.092; TCGA PRAD -0.134; TCGA SARC -0.069; TCGA STAD -0.142
hsa-miR-30a-5p
PIK3R2
11 cancers: COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA COAD -0.206; TCGA ESCA -0.137; TCGA HNSC -0.08; TCGA KIRP -0.087; TCGA LGG -0.422; TCGA LIHC -0.145; TCGA LUSC -0.257; TCGA PAAD -0.146; TCGA THCA -0.225; TCGA STAD -0.254; TCGA UCEC -0.094
hsa-miR-30a-5p
SAP30
9 cancers: COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; UCEC
miRNATAP
TCGA COAD -0.297; TCGA KIRC -0.704; TCGA KIRP -0.232; TCGA LIHC -0.128; TCGA LUAD -0.165; TCGA LUSC -0.137; TCGA OV -0.118; TCGA PAAD -0.098; TCGA UCEC -0.137
hsa-miR-30a-5p
FUBP3
9 cancers: COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA COAD -0.064; TCGA ESCA -0.076; TCGA HNSC -0.124; TCGA LGG -0.064; TCGA LUAD -0.077; TCGA LUSC -0.107; TCGA PAAD -0.13; TCGA PRAD -0.108; TCGA STAD -0.086
hsa-miR-30a-5p
CHST1
10 cancers: ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; THCA; UCEC
MirTarget
TCGA ESCA -0.333; TCGA HNSC -0.196; TCGA KIRC -0.714; TCGA KIRP -0.456; TCGA LUAD -0.202; TCGA LUSC -0.172; TCGA OV -0.215; TCGA PRAD -0.124; TCGA THCA -0.333; TCGA UCEC -0.185
hsa-miR-30a-5p
GNPDA1
9 cancers: ESCA; HNSC; KIRP; LIHC; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA ESCA -0.099; TCGA HNSC -0.087; TCGA KIRP -0.231; TCGA LIHC -0.091; TCGA LUSC -0.136; TCGA PRAD -0.122; TCGA THCA -0.072; TCGA STAD -0.14; TCGA UCEC -0.077
hsa-miR-30a-5p
ACTN1
9 cancers: ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; UCEC
miRNATAP
TCGA ESCA -0.118; TCGA HNSC -0.233; TCGA KIRC -0.615; TCGA KIRP -0.31; TCGA LUAD -0.072; TCGA LUSC -0.108; TCGA PRAD -0.16; TCGA THCA -0.525; TCGA UCEC -0.092
hsa-miR-30a-5p
SOX12
10 cancers: ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA ESCA -0.193; TCGA HNSC -0.17; TCGA KIRC -0.306; TCGA LGG -0.468; TCGA LIHC -0.269; TCGA LUAD -0.27; TCGA LUSC -0.393; TCGA PAAD -0.172; TCGA SARC -0.121; TCGA STAD -0.128
hsa-miR-30a-5p
UBE2R2
10 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD
miRNATAP
TCGA ESCA -0.071; TCGA HNSC -0.072; TCGA KIRC -0.125; TCGA KIRP -0.053; TCGA LGG -0.189; TCGA LIHC -0.078; TCGA LUAD -0.122; TCGA LUSC -0.104; TCGA SARC -0.089; TCGA STAD -0.05
hsa-miR-30a-5p
GALNT2
9 cancers: HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.138; TCGA KIRC -0.68; TCGA KIRP -0.365; TCGA LIHC -0.081; TCGA LUAD -0.088; TCGA LUSC -0.137; TCGA PRAD -0.129; TCGA THCA -0.144; TCGA UCEC -0.061





Enriched cancer pathways of putative targets