microRNA information: hsa-miR-30c-2-3p

SectionIDlink
Mature name: hsa-miR-30c-2-3pmiRbase
Accession: MIMAT0004550miRbase
Precursor name: hsa-mir-30c-2 miRbase
Precursor accession: MI0000254miRbase
Symbol: MIR30C2HGNC
RefSeq ID: NR_029598GenBank
Sequence: CUGGGAGAAGGCUGUUUACUCU



Reported expression in cancers: hsa-miR-30c-2-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-30c-2-3p

thyroid cancerdownregulation"We performed small RNA deep-sequencing of 3 PTC th ......"26487287RNA-Seq; qPCR



Reported cancer pathway affected by hsa-miR-30c-2-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-30c-2-3p

breast cancercell cycle pathway"MicroRNA 30c 2 3p negatively regulates NF κB sign ......"25732226RNAi



Reported cancer prognosis affected by hsa-miR-30c-2-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-30c-2-3p

breast cancerprogression"MicroRNA 30c 2 3p negatively regulates NF κB sign ......"25732226RNAi
hsa-miR-30c-2-3p

gastric cancerpoor survival; staging; metastasis; differentiation"Then we further investigated these GC specific miR ......"27173517
hsa-miR-30c-2-3p

thyroid cancermetastasis"We performed small RNA deep-sequencing of 3 PTC th ......"26487287



Reported gene related to hsa-miR-30c-2-3p

miRNAcancergenereportingPUBMED
hsa-miR-30c-2-3p

breast cancerCCNE1"RNA interference RNAi induced silencing of TRADD p ......"25732226
hsa-miR-30c-2-3p

breast cancerTRADD"RNA interference RNAi induced silencing of TRADD p ......"25732226



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-30c-2-3p
CHMP4C
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.18; TCGA CESC -0.148; TCGA COAD -0.152; TCGA ESCA -0.195; TCGA HNSC -0.115; TCGA LIHC -0.157; TCGA LUAD -0.169; TCGA LUSC -0.121; TCGA OV -0.106; TCGA THCA -0.059; TCGA STAD -0.495
hsa-miR-30c-2-3p
FDPS
12 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.054; TCGA BRCA -0.103; TCGA COAD -0.118; TCGA ESCA -0.09; TCGA LGG -0.116; TCGA LIHC -0.218; TCGA LUAD -0.079; TCGA LUSC -0.071; TCGA OV -0.064; TCGA PRAD -0.113; TCGA THCA -0.086; TCGA STAD -0.186
hsa-miR-30c-2-3p
NONO
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; STAD
miRNAWalker2 validate
TCGA BLCA -0.06; TCGA BRCA -0.051; TCGA COAD -0.132; TCGA KIRC -0.057; TCGA KIRP -0.068; TCGA LGG -0.2; TCGA LIHC -0.094; TCGA LUAD -0.081; TCGA LUSC -0.146; TCGA OV -0.053; TCGA STAD -0.12
hsa-miR-30c-2-3p
PDAP1
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD
miRNAWalker2 validate
TCGA BLCA -0.082; TCGA CESC -0.053; TCGA COAD -0.09; TCGA HNSC -0.064; TCGA KIRC -0.123; TCGA LIHC -0.075; TCGA LUAD -0.107; TCGA LUSC -0.165; TCGA PAAD -0.13; TCGA PRAD -0.081
hsa-miR-30c-2-3p
RNF220
10 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.057; TCGA COAD -0.1; TCGA ESCA -0.051; TCGA KIRC -0.058; TCGA LIHC -0.071; TCGA LUAD -0.055; TCGA LUSC -0.084; TCGA PAAD -0.124; TCGA THCA -0.099; TCGA STAD -0.083
hsa-miR-30c-2-3p
FAM117B
9 cancers: BLCA; CESC; COAD; ESCA; LGG; LUSC; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.119; TCGA CESC -0.196; TCGA COAD -0.131; TCGA ESCA -0.109; TCGA LGG -0.334; TCGA LUSC -0.306; TCGA SARC -0.109; TCGA THCA -0.101; TCGA STAD -0.181
hsa-miR-30c-2-3p
STAT1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA BLCA -0.126; TCGA BRCA -0.261; TCGA CESC -0.169; TCGA ESCA -0.19; TCGA HNSC -0.243; TCGA KIRC -0.245; TCGA KIRP -0.16; TCGA LIHC -0.131; TCGA LUAD -0.089; TCGA LUSC -0.105; TCGA THCA -0.624; TCGA STAD -0.251
hsa-miR-30c-2-3p
AP1G2
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.144; TCGA COAD -0.226; TCGA ESCA -0.157; TCGA HNSC -0.139; TCGA KIRC -0.112; TCGA KIRP -0.242; TCGA LIHC -0.213; TCGA LUAD -0.139; TCGA LUSC -0.136; TCGA SARC -0.161; TCGA THCA -0.203; TCGA STAD -0.298
hsa-miR-30c-2-3p
EFNA1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.114; TCGA CESC -0.105; TCGA COAD -0.318; TCGA ESCA -0.204; TCGA HNSC -0.167; TCGA KIRC -0.283; TCGA KIRP -0.155; TCGA LGG -0.127; TCGA LIHC -0.234; TCGA LUAD -0.097; TCGA OV -0.115; TCGA PAAD -0.227; TCGA THCA -0.154; TCGA STAD -0.152
hsa-miR-30c-2-3p
MPZL1
9 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; UCEC
MirTarget
TCGA BLCA -0.094; TCGA KIRC -0.303; TCGA KIRP -0.182; TCGA LGG -0.078; TCGA LIHC -0.105; TCGA LUAD -0.053; TCGA LUSC -0.063; TCGA THCA -0.156; TCGA UCEC -0.065
hsa-miR-30c-2-3p
TRIM29
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUSC; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.279; TCGA CESC -0.426; TCGA ESCA -0.645; TCGA HNSC -0.176; TCGA KIRP -0.406; TCGA LUSC -0.649; TCGA SARC -0.501; TCGA THCA -1.336; TCGA STAD -0.401
hsa-miR-30c-2-3p
MCM6
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.09; TCGA BRCA -0.184; TCGA COAD -0.187; TCGA KIRC -0.26; TCGA KIRP -0.263; TCGA LGG -0.199; TCGA LIHC -0.27; TCGA LUAD -0.239; TCGA LUSC -0.326; TCGA PRAD -0.127; TCGA THCA -0.277; TCGA STAD -0.316
hsa-miR-30c-2-3p
CASP2
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.096; TCGA BRCA -0.081; TCGA CESC -0.062; TCGA COAD -0.11; TCGA KIRC -0.181; TCGA LGG -0.12; TCGA LIHC -0.067; TCGA LUAD -0.084; TCGA LUSC -0.158; TCGA PRAD -0.093; TCGA STAD -0.252; TCGA UCEC -0.061
hsa-miR-30c-2-3p
MYPOP
9 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; THCA
MirTarget
TCGA BLCA -0.101; TCGA CESC -0.089; TCGA COAD -0.117; TCGA ESCA -0.07; TCGA LIHC -0.1; TCGA LUAD -0.151; TCGA LUSC -0.195; TCGA PAAD -0.124; TCGA THCA -0.078
hsa-miR-30c-2-3p
AURKA
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.19; TCGA BRCA -0.476; TCGA COAD -0.219; TCGA ESCA -0.17; TCGA HNSC -0.159; TCGA KIRC -0.501; TCGA KIRP -0.441; TCGA LGG -0.264; TCGA LIHC -0.482; TCGA LUAD -0.466; TCGA LUSC -0.561; TCGA PRAD -0.211; TCGA THCA -0.143; TCGA STAD -0.473
hsa-miR-30c-2-3p
CENPF
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.198; TCGA BRCA -0.38; TCGA COAD -0.173; TCGA ESCA -0.215; TCGA HNSC -0.073; TCGA KIRC -0.875; TCGA KIRP -0.856; TCGA LGG -0.38; TCGA LIHC -0.55; TCGA LUAD -0.522; TCGA LUSC -0.701; TCGA PRAD -0.349; TCGA THCA -0.615; TCGA STAD -0.586
hsa-miR-30c-2-3p
MYBL2
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.175; TCGA BRCA -0.599; TCGA COAD -0.156; TCGA ESCA -0.186; TCGA HNSC -0.242; TCGA KIRC -1.582; TCGA KIRP -1.225; TCGA LGG -0.556; TCGA LIHC -0.722; TCGA LUAD -0.713; TCGA LUSC -0.824; TCGA OV -0.124; TCGA PRAD -0.449; TCGA THCA -0.767; TCGA STAD -0.666
hsa-miR-30c-2-3p
PAK1
9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BLCA -0.083; TCGA COAD -0.092; TCGA ESCA -0.095; TCGA HNSC -0.076; TCGA LIHC -0.086; TCGA LUAD -0.154; TCGA LUSC -0.353; TCGA STAD -0.162; TCGA UCEC -0.08
hsa-miR-30c-2-3p
UBQLN2
9 cancers: BLCA; CESC; HNSC; KIRP; LGG; LUSC; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.104; TCGA CESC -0.055; TCGA HNSC -0.081; TCGA KIRP -0.073; TCGA LGG -0.129; TCGA LUSC -0.055; TCGA PAAD -0.105; TCGA SARC -0.077; TCGA THCA -0.075
hsa-miR-30c-2-3p
BLOC1S3
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC
MirTarget
TCGA BLCA -0.11; TCGA BRCA -0.095; TCGA COAD -0.099; TCGA ESCA -0.069; TCGA HNSC -0.132; TCGA KIRC -0.216; TCGA KIRP -0.146; TCGA LIHC -0.144; TCGA LUSC -0.084
hsa-miR-30c-2-3p
IQGAP3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.246; TCGA BRCA -0.403; TCGA CESC -0.074; TCGA COAD -0.289; TCGA ESCA -0.199; TCGA HNSC -0.136; TCGA KIRC -1.077; TCGA KIRP -0.885; TCGA LGG -0.322; TCGA LIHC -0.677; TCGA LUAD -0.585; TCGA LUSC -0.69; TCGA PRAD -0.233; TCGA THCA -1.078; TCGA STAD -0.619
hsa-miR-30c-2-3p
KLC2
10 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.105; TCGA COAD -0.147; TCGA ESCA -0.116; TCGA LGG -0.09; TCGA LIHC -0.11; TCGA LUAD -0.175; TCGA LUSC -0.197; TCGA PAAD -0.213; TCGA SARC -0.097; TCGA THCA -0.082
hsa-miR-30c-2-3p
FAM104A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD
MirTarget
TCGA BLCA -0.063; TCGA BRCA -0.063; TCGA CESC -0.052; TCGA COAD -0.096; TCGA ESCA -0.11; TCGA HNSC -0.059; TCGA KIRC -0.166; TCGA KIRP -0.219; TCGA LGG -0.121; TCGA LIHC -0.081; TCGA LUAD -0.114; TCGA LUSC -0.13; TCGA PAAD -0.137
hsa-miR-30c-2-3p
TCF3
15 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.078; TCGA COAD -0.123; TCGA ESCA -0.126; TCGA HNSC -0.083; TCGA KIRC -0.206; TCGA KIRP -0.115; TCGA LGG -0.146; TCGA LIHC -0.152; TCGA LUAD -0.191; TCGA LUSC -0.24; TCGA PAAD -0.098; TCGA PRAD -0.126; TCGA THCA -0.204; TCGA STAD -0.279; TCGA UCEC -0.104
hsa-miR-30c-2-3p
ATXN7L3
13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.099; TCGA COAD -0.057; TCGA ESCA -0.077; TCGA HNSC -0.082; TCGA KIRC -0.051; TCGA KIRP -0.12; TCGA LGG -0.05; TCGA LIHC -0.078; TCGA LUAD -0.125; TCGA LUSC -0.142; TCGA PAAD -0.083; TCGA THCA -0.061; TCGA STAD -0.1
hsa-miR-30c-2-3p
RAB3D
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA
mirMAP
TCGA BLCA -0.089; TCGA BRCA -0.088; TCGA COAD -0.204; TCGA ESCA -0.119; TCGA HNSC -0.145; TCGA KIRC -0.106; TCGA KIRP -0.101; TCGA LIHC -0.205; TCGA LUAD -0.095; TCGA LUSC -0.128; TCGA SARC -0.224; TCGA THCA -0.125
hsa-miR-30c-2-3p
C1orf159
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.122; TCGA CESC -0.052; TCGA COAD -0.266; TCGA ESCA -0.113; TCGA HNSC -0.142; TCGA KIRC -0.116; TCGA KIRP -0.114; TCGA LIHC -0.108; TCGA LUAD -0.201; TCGA LUSC -0.135; TCGA PRAD -0.08; TCGA THCA -0.112; TCGA STAD -0.178
hsa-miR-30c-2-3p
SORD
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.104; TCGA BRCA -0.081; TCGA COAD -0.237; TCGA ESCA -0.174; TCGA LUAD -0.105; TCGA LUSC -0.292; TCGA SARC -0.253; TCGA STAD -0.418; TCGA UCEC -0.125
hsa-miR-30c-2-3p
PML
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; OV; THCA; STAD
mirMAP
TCGA BLCA -0.088; TCGA BRCA -0.053; TCGA CESC -0.088; TCGA ESCA -0.103; TCGA HNSC -0.15; TCGA KIRC -0.373; TCGA KIRP -0.288; TCGA OV -0.092; TCGA THCA -0.235; TCGA STAD -0.087
hsa-miR-30c-2-3p
KIF26B
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.242; TCGA ESCA -0.216; TCGA HNSC -0.203; TCGA LUAD -0.418; TCGA LUSC -0.352; TCGA PRAD -0.236; TCGA STAD -0.246; TCGA UCEC -0.179
hsa-miR-30c-2-3p
RNF213
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.087; TCGA BRCA -0.145; TCGA ESCA -0.116; TCGA HNSC -0.112; TCGA KIRC -0.232; TCGA KIRP -0.369; TCGA LIHC -0.151; TCGA LUAD -0.101; TCGA PRAD -0.151; TCGA THCA -0.175; TCGA STAD -0.211
hsa-miR-30c-2-3p
BEND3
10 cancers: BLCA; BRCA; COAD; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.118; TCGA BRCA -0.183; TCGA COAD -0.248; TCGA LGG -0.231; TCGA LIHC -0.279; TCGA LUAD -0.105; TCGA LUSC -0.141; TCGA PAAD -0.118; TCGA THCA -0.087; TCGA STAD -0.294
hsa-miR-30c-2-3p
AP3S1
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA
miRNAWalker2 validate
TCGA BRCA -0.118; TCGA CESC -0.084; TCGA ESCA -0.153; TCGA HNSC -0.111; TCGA KIRC -0.434; TCGA KIRP -0.241; TCGA LIHC -0.102; TCGA LUAD -0.051; TCGA LUSC -0.086; TCGA PRAD -0.061; TCGA THCA -0.183
hsa-miR-30c-2-3p
MARCKSL1
11 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BRCA -0.056; TCGA COAD -0.159; TCGA KIRC -0.288; TCGA KIRP -0.215; TCGA LGG -0.202; TCGA LIHC -0.197; TCGA LUAD -0.26; TCGA LUSC -0.186; TCGA PAAD -0.247; TCGA STAD -0.385; TCGA UCEC -0.12
hsa-miR-30c-2-3p
TMED2
9 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD
MirTarget
TCGA BRCA -0.096; TCGA COAD -0.16; TCGA KIRC -0.186; TCGA KIRP -0.156; TCGA LGG -0.06; TCGA LIHC -0.053; TCGA LUAD -0.169; TCGA LUSC -0.117; TCGA STAD -0.148
hsa-miR-30c-2-3p
LPGAT1
10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.052; TCGA KIRC -0.286; TCGA KIRP -0.231; TCGA LGG -0.071; TCGA LIHC -0.108; TCGA LUAD -0.163; TCGA LUSC -0.098; TCGA PRAD -0.137; TCGA STAD -0.079; TCGA UCEC -0.069
hsa-miR-30c-2-3p
ATG9B
9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA
MirTarget
TCGA BRCA -0.2; TCGA CESC -0.217; TCGA HNSC -0.347; TCGA KIRC -0.613; TCGA KIRP -0.674; TCGA LUAD -0.308; TCGA LUSC -0.307; TCGA PAAD -0.574; TCGA THCA -0.773
hsa-miR-30c-2-3p
SFXN1
9 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD
MirTarget
TCGA BRCA -0.104; TCGA COAD -0.157; TCGA ESCA -0.105; TCGA HNSC -0.1; TCGA LGG -0.135; TCGA LUAD -0.231; TCGA LUSC -0.393; TCGA PAAD -0.19; TCGA STAD -0.312
hsa-miR-30c-2-3p
CARHSP1
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.061; TCGA CESC -0.091; TCGA COAD -0.131; TCGA ESCA -0.107; TCGA HNSC -0.18; TCGA KIRC -0.25; TCGA LGG -0.077; TCGA PRAD -0.129; TCGA THCA -0.154; TCGA STAD -0.103
hsa-miR-30c-2-3p
KIF2A
10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.087; TCGA KIRC -0.406; TCGA KIRP -0.186; TCGA LGG -0.132; TCGA LIHC -0.106; TCGA LUAD -0.056; TCGA LUSC -0.078; TCGA THCA -0.073; TCGA STAD -0.178; TCGA UCEC -0.056
hsa-miR-30c-2-3p
NAV1
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; UCEC
MirTarget
TCGA BRCA -0.058; TCGA ESCA -0.247; TCGA HNSC -0.183; TCGA KIRC -0.332; TCGA KIRP -0.333; TCGA LGG -0.216; TCGA LUAD -0.208; TCGA LUSC -0.272; TCGA THCA -0.137; TCGA UCEC -0.127
hsa-miR-30c-2-3p
CORO1C
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; SARC; THCA; UCEC
MirTarget
TCGA BRCA -0.115; TCGA CESC -0.062; TCGA ESCA -0.133; TCGA HNSC -0.117; TCGA KIRC -0.36; TCGA LGG -0.263; TCGA LUSC -0.061; TCGA SARC -0.186; TCGA THCA -0.318; TCGA UCEC -0.073
hsa-miR-30c-2-3p
NETO2
9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; STAD
MirTarget
TCGA BRCA -0.241; TCGA CESC -0.09; TCGA HNSC -0.263; TCGA KIRC -0.888; TCGA KIRP -0.817; TCGA LIHC -0.28; TCGA LUAD -0.214; TCGA LUSC -0.339; TCGA STAD -0.293
hsa-miR-30c-2-3p
CELSR3
14 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.321; TCGA CESC -0.113; TCGA HNSC -0.27; TCGA KIRC -0.428; TCGA KIRP -0.454; TCGA LGG -0.569; TCGA LIHC -0.501; TCGA LUAD -0.54; TCGA LUSC -0.354; TCGA PAAD -0.57; TCGA PRAD -0.551; TCGA SARC -0.302; TCGA THCA -0.382; TCGA STAD -0.332
hsa-miR-30c-2-3p
PPME1
10 cancers: BRCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BRCA -0.072; TCGA COAD -0.082; TCGA ESCA -0.178; TCGA KIRP -0.08; TCGA LGG -0.137; TCGA LUAD -0.171; TCGA LUSC -0.256; TCGA PAAD -0.076; TCGA STAD -0.117; TCGA UCEC -0.096
hsa-miR-30c-2-3p
TRIM62
9 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; UCEC
MirTarget
TCGA BRCA -0.061; TCGA CESC -0.107; TCGA ESCA -0.102; TCGA HNSC -0.07; TCGA KIRP -0.137; TCGA LGG -0.108; TCGA LUSC -0.071; TCGA PAAD -0.115; TCGA UCEC -0.054
hsa-miR-30c-2-3p
DNM1L
9 cancers: BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC
MirTarget
TCGA BRCA -0.07; TCGA COAD -0.07; TCGA HNSC -0.06; TCGA LGG -0.071; TCGA LIHC -0.056; TCGA LUAD -0.093; TCGA LUSC -0.172; TCGA PAAD -0.106; TCGA SARC -0.061
hsa-miR-30c-2-3p
PRSS27
10 cancers: BRCA; CESC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BRCA -0.125; TCGA CESC -0.502; TCGA KIRC -0.154; TCGA LGG -0.091; TCGA LUAD -0.237; TCGA LUSC -0.3; TCGA PRAD -0.507; TCGA SARC -0.345; TCGA THCA -0.242; TCGA UCEC -0.12
hsa-miR-30c-2-3p
EIF4A1
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA BRCA -0.065; TCGA COAD -0.147; TCGA ESCA -0.085; TCGA HNSC -0.104; TCGA KIRC -0.26; TCGA KIRP -0.167; TCGA LGG -0.157; TCGA LIHC -0.084; TCGA LUAD -0.051; TCGA LUSC -0.107; TCGA THCA -0.193; TCGA STAD -0.219
hsa-miR-30c-2-3p
SLC16A1
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.077; TCGA CESC -0.156; TCGA ESCA -0.201; TCGA HNSC -0.27; TCGA KIRC -0.688; TCGA KIRP -0.338; TCGA LUSC -0.459; TCGA SARC -0.082; TCGA THCA -0.21; TCGA STAD -0.189
hsa-miR-30c-2-3p
E2F2
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.387; TCGA CESC -0.208; TCGA COAD -0.285; TCGA ESCA -0.192; TCGA HNSC -0.073; TCGA KIRC -0.948; TCGA KIRP -0.73; TCGA LGG -0.531; TCGA LIHC -0.414; TCGA LUAD -0.403; TCGA LUSC -0.531; TCGA PRAD -0.145; TCGA THCA -0.479; TCGA STAD -0.65
hsa-miR-30c-2-3p
ANAPC7
12 cancers: BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
MirTarget
TCGA BRCA -0.057; TCGA CESC -0.066; TCGA COAD -0.094; TCGA ESCA -0.118; TCGA KIRP -0.103; TCGA LGG -0.056; TCGA LIHC -0.159; TCGA LUAD -0.129; TCGA LUSC -0.213; TCGA PAAD -0.123; TCGA SARC -0.071; TCGA STAD -0.092
hsa-miR-30c-2-3p
KIF21B
9 cancers: BRCA; KIRC; KIRP; LGG; LIHC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.078; TCGA KIRC -0.751; TCGA KIRP -0.506; TCGA LGG -0.266; TCGA LIHC -0.227; TCGA PRAD -0.401; TCGA THCA -0.583; TCGA STAD -0.238; TCGA UCEC -0.086
hsa-miR-30c-2-3p
POLR2F
9 cancers: COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; STAD
mirMAP
TCGA COAD -0.216; TCGA HNSC -0.067; TCGA KIRP -0.076; TCGA LGG -0.281; TCGA LIHC -0.096; TCGA LUAD -0.105; TCGA LUSC -0.139; TCGA OV -0.082; TCGA STAD -0.104
hsa-miR-30c-2-3p
ARHGDIA
9 cancers: COAD; ESCA; HNSC; KIRC; KIRP; PAAD; THCA; STAD; UCEC
mirMAP
TCGA COAD -0.145; TCGA ESCA -0.092; TCGA HNSC -0.081; TCGA KIRC -0.112; TCGA KIRP -0.119; TCGA PAAD -0.115; TCGA THCA -0.094; TCGA STAD -0.11; TCGA UCEC -0.063





Enriched cancer pathways of putative targets