microRNA information: hsa-miR-30e-3p

SectionIDlink
Mature name: hsa-miR-30e-3pmiRbase
Accession: MIMAT0000693miRbase
Precursor name: hsa-mir-30e miRbase
Precursor accession: MI0000749miRbase
Symbol: MIR30EHGNC
RefSeq ID: NR_029846GenBank
Sequence: CUUUCAGUCGGAUGUUUACAGC



Reported expression in cancers: hsa-miR-30e-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-30e-3p

breast cancerderegulation"We selected 18 miRNAs with predicted roles in brea ......"27012041
hsa-miR-30e-3p

lung squamous cell cancerdownregulation"Aberrant expression of various microRNAs miRNA has ......"24945821qPCR
hsa-miR-30e-3p

sarcomaderegulation"Expression profiles of 741 miRNAs were evaluated u ......"26299703qPCR



Reported cancer pathway affected by hsa-miR-30e-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-30e-3p

NANA"NA ......"NANA
hsa-miR-30e-3p

" ......"



Reported cancer prognosis affected by hsa-miR-30e-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-30e-3p

breast cancerstaging"We selected 18 miRNAs with predicted roles in brea ......"27012041
hsa-miR-30e-3p

esophageal cancerpoor survival"In this study we selected 10 miRNAs and analyzed t ......"20309880
hsa-miR-30e-3p

lung squamous cell cancerpoor survival; staging"Five selected miRNAs let-7f miR-20b miR-30e-3p miR ......"20595154
hsa-miR-30e-3p

lung squamous cell cancerdifferentiation"Aberrant expression of various microRNAs miRNA has ......"24945821
hsa-miR-30e-3p

lymphomapoor survival"A subset of these miRNAs was associated with outco ......"23725219
hsa-miR-30e-3p

ovarian cancerpoor survival"We measured the expression of nine miRNAs miR-181d ......"22925189
hsa-miR-30e-3p

pancreatic cancerstaging"Using Affymetrix microarrays we established a glob ......"26807325
hsa-miR-30e-3p

thyroid cancermalignant trasformation"We found that miR-146-5p miR-221-5p miR-222-3p miR ......"27586203



Reported gene related to hsa-miR-30e-3p

miRNAcancergenereportingPUBMED
hsa-miR-30e-3p

gastric cancerATG5"33' Diindolylmethane induces anti human gastric ca ......"27372603



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-30e-3p
SERPINE2
10 cancers: BLCA; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; THCA
miRNAWalker2 validate
TCGA BLCA -0.809; TCGA COAD -0.57; TCGA HNSC -0.585; TCGA KIRC -0.322; TCGA LGG -0.19; TCGA LIHC -0.554; TCGA LUAD -0.177; TCGA LUSC -0.272; TCGA OV -0.375; TCGA THCA -0.525
hsa-miR-30e-3p
COL1A2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.906; TCGA BRCA -0.437; TCGA CESC -0.437; TCGA COAD -1.048; TCGA ESCA -0.712; TCGA HNSC -0.712; TCGA KIRC -1.093; TCGA KIRP -0.322; TCGA LIHC -0.281; TCGA LUAD -0.395; TCGA OV -0.553; TCGA PRAD -0.308; TCGA SARC -0.435; TCGA THCA -0.929; TCGA STAD -0.348; TCGA UCEC -0.321
hsa-miR-30e-3p
LRP8
9 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; STAD
MirTarget
TCGA BLCA -0.293; TCGA ESCA -0.438; TCGA HNSC -0.245; TCGA KIRC -0.511; TCGA KIRP -0.364; TCGA LGG -0.217; TCGA LIHC -0.526; TCGA LUSC -0.544; TCGA STAD -0.509
hsa-miR-30e-3p
CD109
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; OV; SARC; THCA; STAD
MirTarget
TCGA BLCA -1.125; TCGA COAD -0.622; TCGA ESCA -0.509; TCGA HNSC -0.322; TCGA KIRC -0.5; TCGA LIHC -0.294; TCGA LUSC -0.583; TCGA OV -0.337; TCGA SARC -0.511; TCGA THCA -1.11; TCGA STAD -0.44
hsa-miR-30e-3p
MBOAT2
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; THCA; UCEC
MirTarget; mirMAP
TCGA BLCA -0.324; TCGA CESC -0.237; TCGA ESCA -0.393; TCGA HNSC -0.485; TCGA KIRP -0.215; TCGA LGG -0.106; TCGA LUSC -0.312; TCGA PAAD -0.466; TCGA THCA -0.793; TCGA UCEC -0.29
hsa-miR-30e-3p
BMP8A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; STAD
MirTarget
TCGA BLCA -0.331; TCGA BRCA -0.533; TCGA CESC -0.273; TCGA COAD -0.353; TCGA ESCA -0.282; TCGA HNSC -0.442; TCGA KIRC -0.731; TCGA LIHC -0.318; TCGA LUAD -0.463; TCGA LUSC -0.279; TCGA PRAD -0.144; TCGA STAD -0.497
hsa-miR-30e-3p
CALU
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.408; TCGA CESC -0.123; TCGA COAD -0.262; TCGA ESCA -0.151; TCGA HNSC -0.248; TCGA KIRC -0.34; TCGA KIRP -0.168; TCGA LUSC -0.223; TCGA SARC -0.371; TCGA STAD -0.139; TCGA UCEC -0.212
hsa-miR-30e-3p
RALA
10 cancers: BLCA; ESCA; HNSC; LGG; LIHC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.149; TCGA ESCA -0.23; TCGA HNSC -0.163; TCGA LGG -0.053; TCGA LIHC -0.132; TCGA PAAD -0.126; TCGA PRAD -0.095; TCGA THCA -0.075; TCGA STAD -0.111; TCGA UCEC -0.195
hsa-miR-30e-3p
FAM26E
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; OV; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.635; TCGA CESC -0.332; TCGA COAD -0.791; TCGA ESCA -0.456; TCGA HNSC -0.454; TCGA OV -0.308; TCGA PRAD -0.209; TCGA STAD -0.264; TCGA UCEC -0.35
hsa-miR-30e-3p
CLTC
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; OV; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.072; TCGA BRCA -0.113; TCGA CESC -0.146; TCGA ESCA -0.219; TCGA HNSC -0.127; TCGA LUSC -0.075; TCGA OV -0.074; TCGA SARC -0.086; TCGA STAD -0.107; TCGA UCEC -0.101
hsa-miR-30e-3p
RELT
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA
MirTarget
TCGA BLCA -0.219; TCGA BRCA -0.346; TCGA ESCA -0.317; TCGA HNSC -0.136; TCGA KIRC -0.929; TCGA KIRP -0.168; TCGA LGG -0.063; TCGA LIHC -0.157; TCGA LUAD -0.16; TCGA LUSC -0.128; TCGA OV -0.152; TCGA THCA -0.588
hsa-miR-30e-3p
F2RL2
9 cancers: BLCA; ESCA; HNSC; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.553; TCGA ESCA -0.835; TCGA HNSC -0.419; TCGA LUSC -0.705; TCGA OV -0.521; TCGA PRAD -0.59; TCGA THCA -0.995; TCGA STAD -0.386; TCGA UCEC -0.283
hsa-miR-30e-3p
CNIH4
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.074; TCGA BRCA -0.159; TCGA ESCA -0.176; TCGA HNSC -0.171; TCGA KIRP -0.093; TCGA LIHC -0.451; TCGA LUSC -0.205; TCGA PAAD -0.256; TCGA PRAD -0.071; TCGA THCA -0.164; TCGA STAD -0.161
hsa-miR-30e-3p
KLK10
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA BLCA -1.37; TCGA COAD -0.808; TCGA ESCA -0.819; TCGA HNSC -0.85; TCGA KIRC -0.89; TCGA LUAD -0.519; TCGA LUSC -0.531; TCGA THCA -2.584; TCGA STAD -0.68
hsa-miR-30e-3p
GNA12
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; SARC; THCA
MirTarget
TCGA BLCA -0.269; TCGA CESC -0.162; TCGA COAD -0.181; TCGA HNSC -0.292; TCGA KIRC -0.21; TCGA LGG -0.054; TCGA LIHC -0.112; TCGA SARC -0.113; TCGA THCA -0.058
hsa-miR-30e-3p
PICALM
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; OV; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.084; TCGA CESC -0.139; TCGA ESCA -0.153; TCGA HNSC -0.077; TCGA KIRP -0.088; TCGA OV -0.081; TCGA THCA -0.095; TCGA STAD -0.2; TCGA UCEC -0.14
hsa-miR-30e-3p
ANLN
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.322; TCGA BRCA -0.256; TCGA ESCA -0.492; TCGA HNSC -0.244; TCGA KIRC -0.955; TCGA KIRP -0.556; TCGA LIHC -0.77; TCGA LUAD -0.402; TCGA LUSC -0.754; TCGA PRAD -0.498; TCGA SARC -0.467; TCGA THCA -0.508; TCGA STAD -0.457
hsa-miR-30e-3p
ADA
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA
MirTarget
TCGA BLCA -0.714; TCGA BRCA -0.219; TCGA HNSC -0.453; TCGA KIRC -1.203; TCGA KIRP -0.283; TCGA LGG -0.441; TCGA LIHC -0.404; TCGA LUAD -0.343; TCGA LUSC -0.477; TCGA THCA -0.192
hsa-miR-30e-3p
PHLDA1
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; UCEC
MirTarget
TCGA BLCA -0.303; TCGA CESC -0.31; TCGA HNSC -0.296; TCGA KIRC -0.335; TCGA KIRP -0.578; TCGA LGG -0.64; TCGA LUAD -0.196; TCGA OV -0.418; TCGA PAAD -0.22; TCGA UCEC -0.374
hsa-miR-30e-3p
DTL
14 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.174; TCGA BRCA -0.495; TCGA ESCA -0.305; TCGA KIRC -0.551; TCGA KIRP -0.594; TCGA LGG -0.584; TCGA LIHC -0.62; TCGA LUAD -0.339; TCGA LUSC -0.528; TCGA PRAD -0.225; TCGA SARC -0.248; TCGA THCA -0.272; TCGA STAD -0.274; TCGA UCEC -0.214
hsa-miR-30e-3p
ANTXR2
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.526; TCGA CESC -0.247; TCGA ESCA -0.304; TCGA HNSC -0.196; TCGA KIRC -0.227; TCGA OV -0.399; TCGA SARC -0.262; TCGA THCA -0.196; TCGA STAD -0.292; TCGA UCEC -0.484
hsa-miR-30e-3p
SEC61B
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD
MirTarget
TCGA BLCA -0.108; TCGA BRCA -0.263; TCGA ESCA -0.145; TCGA HNSC -0.16; TCGA KIRC -0.157; TCGA LIHC -0.128; TCGA LUAD -0.164; TCGA LUSC -0.24; TCGA OV -0.096; TCGA PAAD -0.169; TCGA PRAD -0.142
hsa-miR-30e-3p
GREM1
11 cancers: BLCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.872; TCGA COAD -1.31; TCGA HNSC -0.582; TCGA LUAD -0.691; TCGA LUSC -0.737; TCGA OV -0.566; TCGA PRAD -0.473; TCGA SARC -1.316; TCGA THCA -0.849; TCGA STAD -0.624; TCGA UCEC -0.887
hsa-miR-30e-3p
HMGA2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA; STAD
MirTarget
TCGA BLCA -1.741; TCGA BRCA -0.227; TCGA CESC -0.491; TCGA ESCA -0.885; TCGA HNSC -1.378; TCGA KIRC -1.497; TCGA KIRP -0.989; TCGA LIHC -0.766; TCGA LUSC -1.059; TCGA THCA -2.429; TCGA STAD -0.483
hsa-miR-30e-3p
TCP11L1
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.456; TCGA CESC -0.131; TCGA ESCA -0.163; TCGA HNSC -0.26; TCGA KIRC -0.198; TCGA KIRP -0.108; TCGA LGG -0.069; TCGA LUSC -0.111; TCGA SARC -0.142; TCGA THCA -0.245; TCGA STAD -0.169
hsa-miR-30e-3p
PGM3
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; THCA; STAD
mirMAP
TCGA BLCA -0.084; TCGA CESC -0.177; TCGA ESCA -0.199; TCGA HNSC -0.132; TCGA KIRP -0.106; TCGA LGG -0.155; TCGA LUAD -0.096; TCGA LUSC -0.151; TCGA THCA -0.07; TCGA STAD -0.164
hsa-miR-30e-3p
GPRC5A
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.36; TCGA BRCA -0.712; TCGA COAD -0.29; TCGA ESCA -0.692; TCGA KIRP -0.889; TCGA OV -0.396; TCGA SARC -0.412; TCGA THCA -0.225; TCGA STAD -0.364; TCGA UCEC -0.46
hsa-miR-30e-3p
CD44
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.791; TCGA CESC -0.195; TCGA ESCA -0.432; TCGA HNSC -0.359; TCGA KIRC -0.955; TCGA KIRP -0.623; TCGA LIHC -0.333; TCGA LUSC -0.236; TCGA OV -0.23; TCGA SARC -0.365; TCGA THCA -0.335; TCGA UCEC -0.288
hsa-miR-30e-3p
HES2
9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; OV; THCA; STAD
mirMAP
TCGA BLCA -1.339; TCGA BRCA -0.256; TCGA ESCA -0.727; TCGA HNSC -0.634; TCGA LIHC -0.735; TCGA LUSC -0.522; TCGA OV -0.365; TCGA THCA -1.702; TCGA STAD -0.882
hsa-miR-30e-3p
SEC14L2
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.51; TCGA CESC -0.278; TCGA COAD -0.3; TCGA ESCA -0.434; TCGA HNSC -0.58; TCGA KIRC -0.423; TCGA LUAD -0.349; TCGA LUSC -0.506; TCGA OV -0.204; TCGA PAAD -0.282; TCGA SARC -0.361; TCGA THCA -0.444; TCGA UCEC -0.155
hsa-miR-30e-3p
DRP2
10 cancers: BLCA; BRCA; ESCA; LGG; LUAD; LUSC; OV; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.41; TCGA BRCA -0.495; TCGA ESCA -0.398; TCGA LGG -0.457; TCGA LUAD -0.869; TCGA LUSC -0.44; TCGA OV -0.431; TCGA SARC -0.689; TCGA STAD -0.341; TCGA UCEC -0.312
hsa-miR-30e-3p
COL1A1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -1.088; TCGA BRCA -0.766; TCGA CESC -0.479; TCGA COAD -1.091; TCGA ESCA -0.872; TCGA HNSC -0.919; TCGA KIRC -1.582; TCGA KIRP -0.551; TCGA LIHC -0.436; TCGA LUAD -0.555; TCGA LUSC -0.478; TCGA OV -0.701; TCGA PRAD -0.592; TCGA THCA -1.627; TCGA STAD -0.383; TCGA UCEC -0.231
hsa-miR-30e-3p
NCAPG
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.17; TCGA BRCA -0.424; TCGA HNSC -0.193; TCGA KIRC -0.779; TCGA KIRP -0.512; TCGA LGG -0.555; TCGA LIHC -0.942; TCGA LUAD -0.503; TCGA LUSC -0.631; TCGA PRAD -0.439; TCGA THCA -0.387; TCGA STAD -0.19
hsa-miR-30e-3p
NT5DC3
10 cancers: BLCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.338; TCGA KIRC -0.554; TCGA KIRP -0.498; TCGA LIHC -0.18; TCGA LUAD -0.268; TCGA LUSC -0.184; TCGA PAAD -0.349; TCGA SARC -0.336; TCGA STAD -0.658; TCGA UCEC -0.236
hsa-miR-30e-3p
POLR3G
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.407; TCGA ESCA -0.33; TCGA HNSC -0.317; TCGA KIRC -0.406; TCGA KIRP -0.167; TCGA LGG -0.126; TCGA LUAD -0.149; TCGA LUSC -0.353; TCGA PAAD -0.273; TCGA STAD -0.498; TCGA UCEC -0.151
hsa-miR-30e-3p
ACTR3
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.155; TCGA ESCA -0.167; TCGA HNSC -0.145; TCGA KIRC -0.15; TCGA KIRP -0.148; TCGA LUAD -0.067; TCGA LUSC -0.245; TCGA SARC -0.149; TCGA THCA -0.084; TCGA UCEC -0.215
hsa-miR-30e-3p
ENY2
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; UCEC
mirMAP
TCGA BLCA -0.132; TCGA BRCA -0.223; TCGA ESCA -0.224; TCGA HNSC -0.264; TCGA KIRC -0.136; TCGA LIHC -0.37; TCGA LUAD -0.142; TCGA LUSC -0.242; TCGA OV -0.182; TCGA PRAD -0.176; TCGA UCEC -0.213
hsa-miR-30e-3p
EFR3A
9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; OV; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.149; TCGA CESC -0.092; TCGA ESCA -0.268; TCGA HNSC -0.108; TCGA LUSC -0.109; TCGA OV -0.139; TCGA THCA -0.143; TCGA STAD -0.129; TCGA UCEC -0.275
hsa-miR-30e-3p
NAV1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; UCEC
mirMAP
TCGA BLCA -0.412; TCGA BRCA -0.156; TCGA CESC -0.207; TCGA ESCA -0.382; TCGA HNSC -0.405; TCGA KIRC -0.433; TCGA KIRP -0.141; TCGA LGG -0.375; TCGA LUAD -0.455; TCGA LUSC -0.529; TCGA THCA -0.19; TCGA UCEC -0.197
hsa-miR-30e-3p
ALDH1L2
9 cancers: BLCA; COAD; HNSC; KIRC; LGG; LUAD; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.913; TCGA COAD -0.411; TCGA HNSC -0.316; TCGA KIRC -0.331; TCGA LGG -0.443; TCGA LUAD -0.438; TCGA LUSC -0.338; TCGA STAD -0.338; TCGA UCEC -0.256
hsa-miR-30e-3p
PI15
11 cancers: BLCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.842; TCGA COAD -0.555; TCGA HNSC -0.408; TCGA KIRC -1.194; TCGA LIHC -0.652; TCGA LUAD -0.553; TCGA LUSC -0.369; TCGA SARC -0.683; TCGA THCA -0.73; TCGA STAD -0.633; TCGA UCEC -0.554
hsa-miR-30e-3p
ENTPD1
10 cancers: BLCA; COAD; KIRC; KIRP; LIHC; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.254; TCGA COAD -0.265; TCGA KIRC -0.192; TCGA KIRP -0.133; TCGA LIHC -0.199; TCGA OV -0.084; TCGA SARC -0.265; TCGA THCA -0.575; TCGA STAD -0.163; TCGA UCEC -0.235
hsa-miR-30e-3p
ITGAV
9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.34; TCGA CESC -0.139; TCGA ESCA -0.308; TCGA HNSC -0.211; TCGA LUSC -0.247; TCGA SARC -0.262; TCGA THCA -0.194; TCGA STAD -0.257; TCGA UCEC -0.359
hsa-miR-30e-3p
GLIPR1
10 cancers: BLCA; ESCA; HNSC; KIRC; LIHC; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.712; TCGA ESCA -0.291; TCGA HNSC -0.376; TCGA KIRC -0.605; TCGA LIHC -0.158; TCGA OV -0.243; TCGA SARC -0.466; TCGA THCA -0.336; TCGA STAD -0.223; TCGA UCEC -0.316
hsa-miR-30e-3p
NAA30
9 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.075; TCGA CESC -0.09; TCGA ESCA -0.121; TCGA HNSC -0.134; TCGA LGG -0.083; TCGA LUAD -0.129; TCGA LUSC -0.167; TCGA STAD -0.152; TCGA UCEC -0.204
hsa-miR-30e-3p
ABL2
13 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.175; TCGA ESCA -0.251; TCGA HNSC -0.262; TCGA KIRC -0.379; TCGA KIRP -0.202; TCGA LGG -0.168; TCGA LIHC -0.191; TCGA LUAD -0.174; TCGA LUSC -0.191; TCGA SARC -0.149; TCGA THCA -0.184; TCGA STAD -0.285; TCGA UCEC -0.09
hsa-miR-30e-3p
OSBPL10
10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; PAAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.305; TCGA CESC -0.252; TCGA ESCA -0.272; TCGA HNSC -0.15; TCGA LIHC -0.205; TCGA LUAD -0.205; TCGA PAAD -0.171; TCGA SARC -0.569; TCGA THCA -0.421; TCGA UCEC -0.179
hsa-miR-30e-3p
TPBG
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; SARC; THCA
mirMAP
TCGA BLCA -0.473; TCGA BRCA -0.371; TCGA CESC -0.24; TCGA ESCA -0.505; TCGA HNSC -0.454; TCGA KIRC -0.481; TCGA KIRP -0.45; TCGA LUAD -0.158; TCGA LUSC -0.538; TCGA OV -0.488; TCGA SARC -0.301; TCGA THCA -0.373
hsa-miR-30e-3p
PRSS23
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; OV; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.408; TCGA BRCA -0.373; TCGA CESC -0.346; TCGA HNSC -0.597; TCGA KIRC -0.38; TCGA KIRP -0.348; TCGA OV -0.337; TCGA SARC -0.43; TCGA THCA -1.08; TCGA UCEC -0.412
hsa-miR-30e-3p
KCNE4
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; OV; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.715; TCGA BRCA -0.563; TCGA COAD -0.808; TCGA HNSC -0.359; TCGA KIRC -0.537; TCGA LUAD -0.311; TCGA OV -0.576; TCGA PRAD -0.409; TCGA SARC -0.483; TCGA UCEC -0.442
hsa-miR-30e-3p
SPOCK1
12 cancers: BLCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.739; TCGA COAD -1.667; TCGA HNSC -0.61; TCGA KIRP -0.36; TCGA LIHC -0.764; TCGA LUAD -0.621; TCGA LUSC -0.68; TCGA OV -0.512; TCGA SARC -0.472; TCGA THCA -0.956; TCGA STAD -0.756; TCGA UCEC -0.403
hsa-miR-30e-3p
PLXDC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.497; TCGA BRCA -0.142; TCGA CESC -0.279; TCGA COAD -0.363; TCGA ESCA -0.353; TCGA HNSC -0.231; TCGA KIRC -0.952; TCGA KIRP -0.267; TCGA LIHC -0.8; TCGA LUAD -0.231; TCGA OV -0.403; TCGA PRAD -0.382; TCGA THCA -0.608; TCGA STAD -0.159; TCGA UCEC -0.184
hsa-miR-30e-3p
PGM2L1
10 cancers: BLCA; ESCA; KIRC; KIRP; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.401; TCGA ESCA -0.473; TCGA KIRC -0.394; TCGA KIRP -0.174; TCGA OV -0.348; TCGA PRAD -0.262; TCGA SARC -0.335; TCGA THCA -0.443; TCGA STAD -0.418; TCGA UCEC -0.214
hsa-miR-30e-3p
PAPPA
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; OV; THCA; UCEC
mirMAP
TCGA BLCA -0.342; TCGA CESC -0.439; TCGA COAD -0.51; TCGA ESCA -0.734; TCGA HNSC -0.348; TCGA LGG -0.39; TCGA OV -0.378; TCGA THCA -0.557; TCGA UCEC -0.638
hsa-miR-30e-3p
PTTG1IP
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; OV; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BLCA -0.114; TCGA BRCA -0.085; TCGA CESC -0.112; TCGA KIRC -0.235; TCGA KIRP -0.137; TCGA OV -0.13; TCGA PAAD -0.264; TCGA PRAD -0.052; TCGA THCA -0.157; TCGA UCEC -0.172
hsa-miR-30e-3p
CYP27C1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; STAD
mirMAP
TCGA BLCA -0.947; TCGA CESC -0.433; TCGA COAD -0.947; TCGA ESCA -0.611; TCGA HNSC -1.003; TCGA LGG -0.289; TCGA LUAD -0.723; TCGA LUSC -0.403; TCGA STAD -0.419
hsa-miR-30e-3p
NTNG2
9 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; OV; THCA
mirMAP
TCGA BLCA -0.608; TCGA BRCA -0.376; TCGA COAD -0.632; TCGA KIRC -1.034; TCGA LGG -0.402; TCGA LIHC -0.412; TCGA LUAD -0.616; TCGA OV -0.519; TCGA THCA -0.445
hsa-miR-30e-3p
DACT3
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; OV; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.731; TCGA BRCA -0.198; TCGA COAD -1.223; TCGA HNSC -0.182; TCGA KIRC -0.448; TCGA OV -0.442; TCGA SARC -0.462; TCGA THCA -0.124; TCGA UCEC -0.492
hsa-miR-30e-3p
COL5A2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.925; TCGA BRCA -0.372; TCGA CESC -0.274; TCGA COAD -0.865; TCGA ESCA -0.712; TCGA HNSC -0.859; TCGA KIRC -0.982; TCGA KIRP -0.404; TCGA LUAD -0.463; TCGA LUSC -0.32; TCGA OV -0.648; TCGA PRAD -0.405; TCGA SARC -0.35; TCGA THCA -0.562; TCGA STAD -0.449; TCGA UCEC -0.45
hsa-miR-30e-3p
GNL1
9 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LIHC; PAAD; THCA; UCEC
mirMAP
TCGA BLCA -0.076; TCGA BRCA -0.22; TCGA HNSC -0.07; TCGA KIRC -0.176; TCGA LGG -0.067; TCGA LIHC -0.184; TCGA PAAD -0.132; TCGA THCA -0.105; TCGA UCEC -0.095
hsa-miR-30e-3p
MNT
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA
MirTarget
TCGA BRCA -0.116; TCGA CESC -0.106; TCGA HNSC -0.105; TCGA KIRC -0.213; TCGA KIRP -0.122; TCGA LIHC -0.149; TCGA LUAD -0.077; TCGA LUSC -0.084; TCGA PAAD -0.217; TCGA SARC -0.086; TCGA THCA -0.143
hsa-miR-30e-3p
LPGAT1
9 cancers: BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.1; TCGA KIRC -0.213; TCGA KIRP -0.247; TCGA LIHC -0.193; TCGA LUAD -0.179; TCGA LUSC -0.209; TCGA SARC -0.106; TCGA STAD -0.432; TCGA UCEC -0.281
hsa-miR-30e-3p
NUP62CL
9 cancers: BRCA; ESCA; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD
MirTarget
TCGA BRCA -0.203; TCGA ESCA -0.612; TCGA KIRP -0.266; TCGA LUAD -0.161; TCGA LUSC -0.596; TCGA OV -0.227; TCGA PAAD -0.399; TCGA PRAD -0.207; TCGA STAD -0.439
hsa-miR-30e-3p
CACYBP
9 cancers: BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.156; TCGA ESCA -0.156; TCGA LIHC -0.347; TCGA LUAD -0.09; TCGA LUSC -0.312; TCGA PAAD -0.236; TCGA PRAD -0.109; TCGA STAD -0.18; TCGA UCEC -0.266
hsa-miR-30e-3p
LUC7L3
10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BRCA -0.08; TCGA ESCA -0.171; TCGA KIRC -0.285; TCGA KIRP -0.183; TCGA LGG -0.231; TCGA LIHC -0.125; TCGA LUAD -0.146; TCGA LUSC -0.242; TCGA STAD -0.44; TCGA UCEC -0.141
hsa-miR-30e-3p
DONSON
11 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BRCA -0.11; TCGA KIRC -0.617; TCGA KIRP -0.327; TCGA LGG -0.103; TCGA LIHC -0.154; TCGA LUAD -0.209; TCGA LUSC -0.36; TCGA PAAD -0.107; TCGA PRAD -0.298; TCGA SARC -0.268; TCGA THCA -0.28
hsa-miR-30e-3p
CNPY2
9 cancers: BRCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; THCA
MirTarget
TCGA BRCA -0.33; TCGA HNSC -0.13; TCGA KIRC -0.288; TCGA LGG -0.1; TCGA LIHC -0.211; TCGA LUAD -0.171; TCGA LUSC -0.204; TCGA PAAD -0.318; TCGA THCA -0.052
hsa-miR-30e-3p
ATG12
12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; THCA; UCEC
MirTarget
TCGA BRCA -0.084; TCGA CESC -0.088; TCGA ESCA -0.139; TCGA HNSC -0.165; TCGA KIRC -0.391; TCGA KIRP -0.12; TCGA LGG -0.14; TCGA LUSC -0.084; TCGA OV -0.119; TCGA PAAD -0.105; TCGA THCA -0.068; TCGA UCEC -0.152
hsa-miR-30e-3p
COL24A1
9 cancers: BRCA; CESC; COAD; HNSC; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.454; TCGA CESC -0.268; TCGA COAD -1.027; TCGA HNSC -0.452; TCGA LUSC -0.259; TCGA PRAD -0.221; TCGA THCA -0.905; TCGA STAD -0.485; TCGA UCEC -0.304
hsa-miR-30e-3p
RNF149
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC
MirTarget
TCGA BRCA -0.11; TCGA ESCA -0.261; TCGA HNSC -0.331; TCGA KIRC -0.485; TCGA KIRP -0.17; TCGA LIHC -0.091; TCGA LUAD -0.066; TCGA LUSC -0.169; TCGA OV -0.062; TCGA THCA -0.224; TCGA UCEC -0.217
hsa-miR-30e-3p
FAM104A
12 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA
MirTarget
TCGA BRCA -0.124; TCGA ESCA -0.092; TCGA HNSC -0.147; TCGA KIRC -0.26; TCGA KIRP -0.129; TCGA LGG -0.134; TCGA LIHC -0.126; TCGA LUAD -0.142; TCGA LUSC -0.159; TCGA OV -0.077; TCGA PAAD -0.167; TCGA THCA -0.057
hsa-miR-30e-3p
DEPDC1
9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; STAD
mirMAP
TCGA BRCA -0.252; TCGA HNSC -0.139; TCGA KIRC -0.679; TCGA KIRP -0.533; TCGA LIHC -0.593; TCGA LUAD -0.445; TCGA LUSC -0.69; TCGA SARC -0.287; TCGA STAD -0.319
hsa-miR-30e-3p
HELLS
9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.143; TCGA KIRP -0.444; TCGA LGG -0.619; TCGA LIHC -0.528; TCGA LUAD -0.321; TCGA LUSC -0.653; TCGA THCA -0.344; TCGA STAD -0.442; TCGA UCEC -0.164
hsa-miR-30e-3p
UNC13A
9 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; THCA; UCEC
mirMAP
TCGA BRCA -0.231; TCGA KIRC -0.903; TCGA KIRP -0.664; TCGA LGG -0.513; TCGA LIHC -0.741; TCGA LUAD -0.504; TCGA PRAD -0.314; TCGA THCA -0.273; TCGA UCEC -0.532
hsa-miR-30e-3p
SEPT8
10 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUAD; OV; PRAD; THCA
mirMAP
TCGA BRCA -0.091; TCGA CESC -0.111; TCGA ESCA -0.119; TCGA KIRC -0.112; TCGA LGG -0.119; TCGA LIHC -0.189; TCGA LUAD -0.126; TCGA OV -0.205; TCGA PRAD -0.123; TCGA THCA -0.21
hsa-miR-30e-3p
GATAD2A
9 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; THCA
mirMAP
TCGA BRCA -0.1; TCGA CESC -0.076; TCGA ESCA -0.13; TCGA HNSC -0.186; TCGA LGG -0.057; TCGA LUAD -0.078; TCGA LUSC -0.128; TCGA PRAD -0.179; TCGA THCA -0.167
hsa-miR-30e-3p
TANC2
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; THCA
mirMAP
TCGA BRCA -0.255; TCGA CESC -0.212; TCGA ESCA -0.36; TCGA HNSC -0.37; TCGA KIRC -0.24; TCGA KIRP -0.218; TCGA LGG -0.093; TCGA LUAD -0.144; TCGA OV -0.275; TCGA PAAD -0.262; TCGA THCA -0.36
hsa-miR-30e-3p
FAM111B
11 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.236; TCGA ESCA -0.283; TCGA KIRC -0.416; TCGA KIRP -0.488; TCGA LGG -0.54; TCGA LIHC -0.431; TCGA LUAD -0.223; TCGA LUSC -0.297; TCGA SARC -0.345; TCGA THCA -0.725; TCGA STAD -0.361
hsa-miR-30e-3p
ZNF250
9 cancers: CESC; COAD; HNSC; KIRP; LGG; LIHC; OV; PRAD; STAD
mirMAP
TCGA CESC -0.104; TCGA COAD -0.209; TCGA HNSC -0.09; TCGA KIRP -0.168; TCGA LGG -0.162; TCGA LIHC -0.266; TCGA OV -0.118; TCGA PRAD -0.122; TCGA STAD -0.187
hsa-miR-30e-3p
CBFB
10 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; THCA; STAD; UCEC
MirTarget
TCGA ESCA -0.214; TCGA HNSC -0.058; TCGA KIRC -0.377; TCGA KIRP -0.161; TCGA LGG -0.121; TCGA LIHC -0.095; TCGA LUSC -0.204; TCGA THCA -0.226; TCGA STAD -0.355; TCGA UCEC -0.17
hsa-miR-30e-3p
OTUD6B
10 cancers: ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC
MirTarget
TCGA ESCA -0.201; TCGA HNSC -0.134; TCGA KIRP -0.088; TCGA LGG -0.112; TCGA LIHC -0.216; TCGA LUAD -0.136; TCGA LUSC -0.246; TCGA OV -0.085; TCGA STAD -0.38; TCGA UCEC -0.339
hsa-miR-30e-3p
UBA6
9 cancers: ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA ESCA -0.166; TCGA HNSC -0.145; TCGA KIRC -0.127; TCGA LUAD -0.085; TCGA LUSC -0.186; TCGA PAAD -0.12; TCGA THCA -0.08; TCGA STAD -0.334; TCGA UCEC -0.096
hsa-miR-30e-3p
TSN
9 cancers: ESCA; HNSC; KIRP; LGG; LIHC; LUSC; THCA; STAD; UCEC
mirMAP
TCGA ESCA -0.146; TCGA HNSC -0.07; TCGA KIRP -0.069; TCGA LGG -0.12; TCGA LIHC -0.086; TCGA LUSC -0.142; TCGA THCA -0.15; TCGA STAD -0.178; TCGA UCEC -0.233





Enriched cancer pathways of putative targets