microRNA information: hsa-miR-31-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-31-3p | miRbase |
Accession: | MIMAT0004504 | miRbase |
Precursor name: | hsa-mir-31 | miRbase |
Precursor accession: | MI0000089 | miRbase |
Symbol: | MIR31 | HGNC |
RefSeq ID: | NR_029505 | GenBank |
Sequence: | UGCUAUGCCAACAUAUUGCCAU |
Reported expression in cancers: hsa-miR-31-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-31-3p | bladder cancer | deregulation | "Decreased expression of microRNA 31 associates wit ......" | 23408039 | qPCR |
hsa-miR-31-3p | breast cancer | downregulation | "miR 31 and its host gene lncRNA LOC554202 are regu ......" | 22289355 | |
hsa-miR-31-3p | breast cancer | downregulation | "Recent studies have demonstrated miR-31 as a metas ......" | 27593563 | |
hsa-miR-31-3p | cervical and endocervical cancer | upregulation | "Quantitative RT-PCR was used to examine miR-31 exp ......" | 24793973 | qPCR |
hsa-miR-31-3p | chordoma | downregulation | "MicroRNA expression profiling reveals the potentia ......" | 23912551 | RNA-Seq; qPCR |
hsa-miR-31-3p | colon cancer | upregulation | "Although several studies have shown that microRNA- ......" | 21062447 | qPCR |
hsa-miR-31-3p | colon cancer | upregulation | "Aberrant expression of miR-31 has been found in va ......" | 23258531 | |
hsa-miR-31-3p | colorectal cancer | upregulation | "Clinicopathological significance of microRNA 31 14 ......" | 19242066 | qPCR |
hsa-miR-31-3p | colorectal cancer | upregulation | "Expression of miR 21 miR 31 miR 96 and miR 135b is ......" | 22844381 | qPCR |
hsa-miR-31-3p | colorectal cancer | upregulation | "MiR-31 was more upregulated in stages III and IV c ......" | 22868372 | |
hsa-miR-31-3p | colorectal cancer | upregulation | "Clinical relevance of microRNA miR 21 miR 31 miR 9 ......" | 23121918 | qPCR |
hsa-miR-31-3p | colorectal cancer | upregulation | "The oncogenic microRNAs miRNAs miR-21 and miR-31 n ......" | 23704278 | |
hsa-miR-31-3p | colorectal cancer | upregulation | "In an array analysis miR-31 and miR-135b were the ......" | 24691020 | |
hsa-miR-31-3p | colorectal cancer | upregulation | "miR-708 and miR-31 were found to be highly express ......" | 25202407 | |
hsa-miR-31-3p | colorectal cancer | upregulation | "In order to clarify the miRNA profile in CRC tissu ......" | 25421755 | Microarray |
hsa-miR-31-3p | colorectal cancer | upregulation | "The potential role of microRNA 31 expression in ea ......" | 26173758 | Reverse transcription PCR; qPCR; in situ hybridization |
hsa-miR-31-3p | esophageal cancer | upregulation | "The oncogenetic role of microRNA 31 as a potential ......" | 21658006 | Reverse transcription PCR |
hsa-miR-31-3p | esophageal cancer | upregulation | "Dysregulation of miR 31 and miR 21 induced by zinc ......" | 22689922 | |
hsa-miR-31-3p | esophageal cancer | upregulation | "In rats marked-ZD 3 mg Zn/kg diet induces a prolif ......" | 26918602 | |
hsa-miR-31-3p | gastric cancer | upregulation | "The most highly expressed miRNAs in non-tumorous t ......" | 19175831 | |
hsa-miR-31-3p | gastric cancer | downregulation | "The miRNA microarray analysis showed that miR-31 w ......" | 27174918 | Microarray |
hsa-miR-31-3p | glioblastoma | deregulation | "In this work the expression of 19 microRNAs miR-7 ......" | 24412053 | qPCR |
hsa-miR-31-3p | head and neck cancer | upregulation | "Initial screening and subsequent analysis identifi ......" | 20145132 | |
hsa-miR-31-3p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
hsa-miR-31-3p | liver cancer | downregulation | "MicroRNA 31 functions as a tumor suppressor by reg ......" | 25797269 | |
hsa-miR-31-3p | lung cancer | deregulation | "Microarray studies revealed alterations in the exp ......" | 19748927 | Microarray; Reverse transcription PCR |
hsa-miR-31-3p | lung cancer | deregulation | "Four up-regulated microRNAs miR-210 miR-21 miR-31 ......" | 22672859 | |
hsa-miR-31-3p | lung cancer | deregulation | "Using a recently published robust rank aggregation ......" | 23225545 | |
hsa-miR-31-3p | lung cancer | upregulation | "MicroRNA 31 predicts the presence of lymph node me ......" | 23946296 | RNA-Seq; qPCR |
hsa-miR-31-3p | lung cancer | downregulation | "Allelic imbalance in the miR 31 host gene locus in ......" | 24978700 | |
hsa-miR-31-3p | lung squamous cell cancer | deregulation | "Locked nucleic acids miRNA microarray expression p ......" | 20508945 | Microarray |
hsa-miR-31-3p | lymphoma | downregulation | "miR 31 and miR 17 5p levels change during transfor ......" | 26997445 | |
hsa-miR-31-3p | melanoma | downregulation | "The genomic region in chromosome 9p21 that encompa ......" | 22948084 | |
hsa-miR-31-3p | ovarian cancer | deregulation | "We found that in ovarian CAFs miR-31 and miR-214 w ......" | 23171795 | |
hsa-miR-31-3p | pancreatic cancer | downregulation | "Eighty-eight samples of ductal pancreatic adenocar ......" | 22850622 | qPCR |
hsa-miR-31-3p | prostate cancer | downregulation | "Thus downregulation of miR-205 and miR-31 has an i ......" | 21368878 | |
hsa-miR-31-3p | prostate cancer | downregulation | "We examined primary and metastatic prostate cancer ......" | 23233736 | |
hsa-miR-31-3p | sarcoma | upregulation | "Upregulation of microRNA 31 associates with a poor ......" | 25358615 | qPCR |
hsa-miR-31-3p | thyroid cancer | deregulation | "In this study we evaluated miRNA expression as a m ......" | 21537871 | Microarray |
hsa-miR-31-3p | thyroid cancer | deregulation | "Quantitative real-time PCR qRT-PCR was used to val ......" | 26380656 | qPCR |
Reported cancer pathway affected by hsa-miR-31-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-31-3p | T cell leukemia | Apoptosis pathway | "Polycomb mediated loss of miR 31 activates NIK dep ......" | 22264793 | |
hsa-miR-31-3p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "MiR 31 is an independent prognostic factor and fun ......" | 24793973 | Colony formation; Luciferase |
hsa-miR-31-3p | chordoma | cell cycle pathway; Apoptosis pathway | "In this study miR-31 anti-miR-140-3p anti-miR148a ......" | 27016303 | Cell Proliferation Assay |
hsa-miR-31-3p | colon cancer | cell cycle pathway; Apoptosis pathway | "Suppression of microRNA 31 increases sensitivity t ......" | 21062447 | Flow cytometry; Colony formation; MTT assay |
hsa-miR-31-3p | colorectal cancer | Ras signaling pathway | "MicroRNA 31 activates the RAS pathway and function ......" | 23322774 | Luciferase; Cell proliferation assay; Cell Proliferation Assay |
hsa-miR-31-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "Elevated microRNA 31 expression regulates colorect ......" | 24386467 | |
hsa-miR-31-3p | colorectal cancer | Apoptosis pathway | "We adopted a strategy of ectopic overexpression or ......" | 24462870 | RNAi; Western blot; Colony formation |
hsa-miR-31-3p | colorectal cancer | Apoptosis pathway | "Regulatory roles of microRNA 708 and microRNA 31 i ......" | 25202407 | |
hsa-miR-31-3p | gastric cancer | PI3K/Akt signaling pathway | "Upregulation of microRNA 31 targeting integrin α5 ......" | 26729197 | Luciferase; Western blot; Transwell assay |
hsa-miR-31-3p | gastric cancer | Apoptosis pathway | "Downregulated miR 31 level associates with poor pr ......" | 27174918 | Western blot; Luciferase |
hsa-miR-31-3p | glioblastoma | Apoptosis pathway | "Growth inhibitory and chemosensitizing effects of ......" | 26310668 | |
hsa-miR-31-3p | liver cancer | cell cycle pathway; Epithelial mesenchymal transition pathway | "MicroRNA 31 functions as a tumor suppressor by reg ......" | 25797269 | |
hsa-miR-31-3p | lung cancer | cell cycle pathway | "Reduced miR 31 and let 7 maintain the balance betw ......" | 22301433 | |
hsa-miR-31-3p | lung cancer | cell cycle pathway; Apoptosis pathway; MAPK signaling pathway | "A systematic analysis of predicted MiR 31 targets ......" | 24726065 | |
hsa-miR-31-3p | lung cancer | PI3K/Akt signaling pathway | "MicroRNA 31 inhibits lung adenocarcinoma stem like ......" | 26299665 | Western blot; Luciferase |
hsa-miR-31-3p | lung cancer | MAPK signaling pathway | "MicroRNA 31 initiates lung tumorigenesis and promo ......" | 26657862 | |
hsa-miR-31-3p | lung cancer | Apoptosis pathway | "BAP1 suppresses lung cancer progression and is inh ......" | 26885612 | |
hsa-miR-31-3p | lung cancer | Apoptosis pathway | "MiR 31 Functions as a Tumor Suppressor in Lung Ade ......" | 27215092 | Western blot; Luciferase; Flow cytometry |
hsa-miR-31-3p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 31 inhibits cisplatin induced apoptosis i ......" | 24099915 | Luciferase |
hsa-miR-31-3p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "Molecular profiling uncovers a p53 associated role ......" | 20179198 | |
hsa-miR-31-3p | prostate cancer | Apoptosis pathway | "Downregulation of miR 205 and miR 31 confers resis ......" | 21368878 | |
hsa-miR-31-3p | prostate cancer | cell cycle pathway | "Epigenetic repression of miR 31 disrupts androgen ......" | 23233736 | |
hsa-miR-31-3p | sarcoma | Apoptosis pathway | "Differentially expressed miRNAs in Ewing sarcoma c ......" | 24667836 | |
hsa-miR-31-3p | thyroid cancer | Apoptosis pathway | "miR 31 Reduces Cell Growth of Papillary Thyroid Ca ......" | 26731986 | Flow cytometry; MTT assay; Luciferase |
Reported cancer prognosis affected by hsa-miR-31-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-31-3p | T cell leukemia | drug resistance | "Polycomb mediated loss of miR 31 activates NIK dep ......" | 22264793 | |
hsa-miR-31-3p | bladder cancer | progression; worse prognosis; staging; recurrence | "Decreased expression of microRNA 31 associates wit ......" | 23408039 | |
hsa-miR-31-3p | bladder cancer | progression; recurrence | "MicroRNA 31 functions as a tumor suppressor and in ......" | 27050274 | |
hsa-miR-31-3p | breast cancer | poor survival | "To investigate the global expression profile of mi ......" | 18812439 | |
hsa-miR-31-3p | breast cancer | metastasis | "A pleiotropically acting microRNA miR 31 inhibits ......" | 19524507 | |
hsa-miR-31-3p | breast cancer | metastasis; progression; poor survival | "miR 31 and its host gene lncRNA LOC554202 are regu ......" | 22289355 | |
hsa-miR-31-3p | breast cancer | staging; metastasis; tumor size | "miR 155 and miR 31 are differentially expressed in ......" | 23162645 | |
hsa-miR-31-3p | breast cancer | staging; metastasis | "None of the investigated single miRNAs or miRNA cl ......" | 24196612 | |
hsa-miR-31-3p | breast cancer | cell migration | "The breast cancer oncogene EMSY represses transcri ......" | 24582497 | Colony formation |
hsa-miR-31-3p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
hsa-miR-31-3p | breast cancer | progression | "MicroRNA 31 controls G protein alpha 13 GNA13 expr ......" | 25889182 | Luciferase; Western blot; MTT assay |
hsa-miR-31-3p | breast cancer | metastasis; cell migration | "MiR 31 inhibits migration and invasion by targetin ......" | 27593563 | Luciferase |
hsa-miR-31-3p | breast cancer | poor survival | "In 5C 34 miRNAs of the DLK1-DIO3 locus and miR-31 ......" | 27659519 | |
hsa-miR-31-3p | cervical and endocervical cancer | staging; metastasis; poor survival; cell migration | "MiR 31 is an independent prognostic factor and fun ......" | 24793973 | Colony formation; Luciferase |
hsa-miR-31-3p | cervical and endocervical cancer | metastasis; progression | "miR 31 functions as an oncogene in cervical cancer ......" | 25894339 | |
hsa-miR-31-3p | cervical and endocervical cancer | drug resistance | "Seven differentially expressed miRNAs were selecte ......" | 27423381 | |
hsa-miR-31-3p | chordoma | progression; differentiation | "In this study miR-31 anti-miR-140-3p anti-miR148a ......" | 27016303 | Cell Proliferation Assay |
hsa-miR-31-3p | colon cancer | motility; metastasis | "miR 21 and miR 31 converge on TIAM1 to regulate mi ......" | 20826792 | Transwell assay |
hsa-miR-31-3p | colon cancer | staging; cell migration | "Suppression of microRNA 31 increases sensitivity t ......" | 21062447 | Flow cytometry; Colony formation; MTT assay |
hsa-miR-31-3p | colon cancer | tumorigenesis; poor survival | "The differential expressions of miR-9 miR-31 and m ......" | 23019418 | |
hsa-miR-31-3p | colon cancer | tumorigenesis | "The tumor suppressor gene RhoBTB1 is a novel targe ......" | 23258531 | Colony formation; RNAi |
hsa-miR-31-3p | colorectal cancer | staging | "Identification by Real time PCR of 13 mature micro ......" | 16854228 | |
hsa-miR-31-3p | colorectal cancer | staging; progression | "Clinicopathological significance of microRNA 31 14 ......" | 19242066 | |
hsa-miR-31-3p | colorectal cancer | staging | "ANN analysis identified three miRNAs miR-139-5p mi ......" | 21739196 | |
hsa-miR-31-3p | colorectal cancer | progression | "Expression of miR 21 miR 31 miR 96 and miR 135b is ......" | 22844381 | |
hsa-miR-31-3p | colorectal cancer | staging | "MiR-31 was more upregulated in stages III and IV c ......" | 22868372 | |
hsa-miR-31-3p | colorectal cancer | staging; differentiation | "Clinical relevance of microRNA miR 21 miR 31 miR 9 ......" | 23121918 | |
hsa-miR-31-3p | colorectal cancer | tumorigenesis | "MicroRNA 31 activates the RAS pathway and function ......" | 23322774 | Luciferase; Cell proliferation assay; Cell Proliferation Assay |
hsa-miR-31-3p | colorectal cancer | staging | "In the present study we measured the levels of fiv ......" | 23625654 | |
hsa-miR-31-3p | colorectal cancer | staging | "Genome-wide microarray analysis of miRNA expressio ......" | 23673725 | |
hsa-miR-31-3p | colorectal cancer | poor survival; worse prognosis | "Association of microRNA 31 with BRAF mutation colo ......" | 24242331 | |
hsa-miR-31-3p | colorectal cancer | progression; metastasis; tumorigenesis; worse prognosis | "Elevated microRNA 31 expression regulates colorect ......" | 24386467 | |
hsa-miR-31-3p | colorectal cancer | tumorigenesis | "MicroRNA 31 contributes to colorectal cancer devel ......" | 24521875 | Luciferase |
hsa-miR-31-3p | colorectal cancer | staging | "In an array analysis miR-31 and miR-135b were the ......" | 24691020 | |
hsa-miR-31-3p | colorectal cancer | progression; poor survival | "Hsa miR 31 3p expression is linked to progression ......" | 24771647 | |
hsa-miR-31-3p | colorectal cancer | progression; staging; tumorigenesis | "The potential role of microRNA 31 expression in ea ......" | 26173758 | |
hsa-miR-31-3p | colorectal cancer | progression | "MicroRNA expression profiling identifies miR 31 5p ......" | 26497852 | |
hsa-miR-31-3p | colorectal cancer | progression | "To identify the sequential alterations of miRNAs a ......" | 26692142 | |
hsa-miR-31-3p | colorectal cancer | worse prognosis; malignant trasformation; differentiation | "The relationship between EZH2 expression and micro ......" | 26871294 | |
hsa-miR-31-3p | colorectal cancer | progression | "Efficacy and Toxicity of Panitumumab After Progres ......" | 27630355 | |
hsa-miR-31-3p | endometrial cancer | malignant trasformation; recurrence; poor survival; worse prognosis | "microRNA 31 functions as an endometrial cancer onc ......" | 24779718 | Luciferase |
hsa-miR-31-3p | esophageal cancer | worse prognosis; poor survival | "The oncogenetic role of microRNA 31 as a potential ......" | 21658006 | Colony formation; Western blot; Luciferase |
hsa-miR-31-3p | esophageal cancer | worse prognosis; differentiation | "The aim of this study was to examine and determine ......" | 21882196 | |
hsa-miR-31-3p | esophageal cancer | poor survival | "When ESCC patients were grouped according to their ......" | 24039884 | |
hsa-miR-31-3p | esophageal cancer | progression | "SOX4 interacts with EZH2 and HDAC3 to suppress mic ......" | 25644061 | Western blot |
hsa-miR-31-3p | gastric cancer | tumorigenesis | "Down regulation of miR 31 expression in gastric ca ......" | 19598010 | |
hsa-miR-31-3p | gastric cancer | metastasis; cell migration | "Upregulation of microRNA 31 targeting integrin α5 ......" | 26729197 | Luciferase; Western blot; Transwell assay |
hsa-miR-31-3p | gastric cancer | malignant trasformation; worse prognosis; staging; metastasis; poor survival; differentiation; cell migration | "Downregulated miR 31 level associates with poor pr ......" | 27174918 | Western blot; Luciferase |
hsa-miR-31-3p | glioblastoma | poor survival | "Inhibition of two "risky" miRNAs miR-148a and miR- ......" | 25903473 | |
hsa-miR-31-3p | glioblastoma | poor survival | "Loss of tumor suppressive microRNA 31 enhances TRA ......" | 26164206 | |
hsa-miR-31-3p | head and neck cancer | poor survival | "miR 31 targets ARID1A and enhances the oncogenicit ......" | 27528032 | |
hsa-miR-31-3p | liver cancer | staging; worse prognosis | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | |
hsa-miR-31-3p | liver cancer | worse prognosis; tumorigenesis | "MicroRNA 31 functions as a tumor suppressor by reg ......" | 25797269 | |
hsa-miR-31-3p | liver cancer | staging | "We first evaluated a training cohort of 192 HCC pa ......" | 26657296 | |
hsa-miR-31-3p | lung cancer | malignant trasformation | "MicroRNA 31 functions as an oncogenic microRNA in ......" | 20237410 | |
hsa-miR-31-3p | lung cancer | tumorigenesis | "Cigarette smoke induces C/EBP β mediated activati ......" | 21048943 | Western blot; Luciferase |
hsa-miR-31-3p | lung cancer | differentiation | "Reduced miR 31 and let 7 maintain the balance betw ......" | 22301433 | |
hsa-miR-31-3p | lung cancer | metastasis; poor survival; cell migration; staging | "MicroRNA 31 predicts the presence of lymph node me ......" | 23946296 | |
hsa-miR-31-3p | lung cancer | progression; drug resistance; worse prognosis | "A systematic analysis of predicted MiR 31 targets ......" | 24726065 | |
hsa-miR-31-3p | lung cancer | tumorigenesis | "Allelic imbalance in the miR 31 host gene locus in ......" | 24978700 | |
hsa-miR-31-3p | lung cancer | poor survival | "Expression and significance of circulating microRN ......" | 25765717 | |
hsa-miR-31-3p | lung cancer | tumorigenesis; poor survival | "MicroRNA 31 initiates lung tumorigenesis and promo ......" | 26657862 | |
hsa-miR-31-3p | lung cancer | progression; tumorigenesis | "BAP1 suppresses lung cancer progression and is inh ......" | 26885612 | |
hsa-miR-31-3p | lung cancer | cell migration | "MiR 31 Functions as a Tumor Suppressor in Lung Ade ......" | 27215092 | Western blot; Luciferase; Flow cytometry |
hsa-miR-31-3p | lung cancer | poor survival; recurrence | "In the multivariate Cox regression analysis mir-14 ......" | 27695346 | |
hsa-miR-31-3p | lung squamous cell cancer | worse prognosis; poor survival | "A 5 microRNA signature for lung squamous cell carc ......" | 21890451 | |
hsa-miR-31-3p | lung squamous cell cancer | drug resistance | "MicroRNA 31 inhibits cisplatin induced apoptosis i ......" | 24099915 | Luciferase |
hsa-miR-31-3p | lung squamous cell cancer | metastasis | "The differentially expressed microRNAs associated ......" | 25628919 | |
hsa-miR-31-3p | lymphoma | progression | "miR 31 and miR 17 5p levels change during transfor ......" | 26997445 | |
hsa-miR-31-3p | melanoma | cell migration; progression; poor survival | "Genetic and epigenetic loss of microRNA 31 leads t ......" | 22948084 | |
hsa-miR-31-3p | melanoma | metastasis; progression | "In the present study we used mRNA array profiling ......" | 23056502 | |
hsa-miR-31-3p | ovarian cancer | staging; progression; worse prognosis | "Molecular profiling uncovers a p53 associated role ......" | 20179198 | |
hsa-miR-31-3p | ovarian cancer | worse prognosis; drug resistance | "We found that miR-31 was downregulated in KFr13Tx ......" | 23552883 | |
hsa-miR-31-3p | ovarian cancer | metastasis; drug resistance | "For example deficiencies of enzymes including Dice ......" | 24822185 | |
hsa-miR-31-3p | ovarian cancer | drug resistance | "P18/Stathmin1 is regulated by miR 31 in ovarian ca ......" | 25897432 | Luciferase |
hsa-miR-31-3p | ovarian cancer | poor survival; cell migration; metastasis | "MicroRNA 200c and microRNA 31 regulate proliferati ......" | 26260454 | Colony formation |
hsa-miR-31-3p | ovarian cancer | drug resistance | "Over expression of miR 31 or loss of KCNMA1 leads ......" | 26386726 | RNAi |
hsa-miR-31-3p | pancreatic cancer | cell migration | "Both inhibition and enhanced expression of miR 31 ......" | 22344632 | |
hsa-miR-31-3p | prostate cancer | drug resistance; staging | "Downregulation of miR 205 and miR 31 confers resis ......" | 21368878 | |
hsa-miR-31-3p | prostate cancer | progression | "Epigenetic repression of miR 31 disrupts androgen ......" | 23233736 | |
hsa-miR-31-3p | prostate cancer | progression; tumorigenesis | "Expression of 1205 human miRNAs and miRNA*s were e ......" | 25768283 | |
hsa-miR-31-3p | prostate cancer | cell migration | "Kaiso a transcriptional repressor promotes cell mi ......" | 26734997 | |
hsa-miR-31-3p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
hsa-miR-31-3p | sarcoma | malignant trasformation; worse prognosis; poor survival | "Upregulation of microRNA 31 associates with a poor ......" | 25358615 | |
hsa-miR-31-3p | thyroid cancer | metastasis; recurrence | "In this study we evaluated miRNA expression as a m ......" | 21537871 | |
hsa-miR-31-3p | thyroid cancer | malignant trasformation; progression | "miR 31 Reduces Cell Growth of Papillary Thyroid Ca ......" | 26731986 | Flow cytometry; MTT assay; Luciferase |
Reported gene related to hsa-miR-31-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-31-3p | colon cancer | E2F2 | "miR 31 promotes proliferation of colon cancer cell ......" | 25362258 |
hsa-miR-31-3p | gastric cancer | E2F2 | "Downregulated miR 31 level associates with poor pr ......" | 27174918 |
hsa-miR-31-3p | lymphoma | E2F2 | "Two pro-proliferative genes E2F2 and PI3KC2A were ......" | 26997445 |
hsa-miR-31-3p | ovarian cancer | E2F2 | "Functional overexpression of miR-31 the most under ......" | 20179198 |
hsa-miR-31-3p | colorectal cancer | KRAS | "High miR-31 expression was associated with BRAF an ......" | 24242331 |
hsa-miR-31-3p | colorectal cancer | KRAS | "Efficacy and Toxicity of Panitumumab After Progres ......" | 27630355 |
hsa-miR-31-3p | colorectal cancer | KRAS | "Hsa-miR-31-3p seems to be a new mCRC biomarker who ......" | 24771647 |
hsa-miR-31-3p | lung cancer | KRAS | "MicroRNA 31 initiates lung tumorigenesis and promo ......" | 26657862 |
hsa-miR-31-3p | colorectal cancer | BRAF | "We recently reported that microRNA-31 miR-31-5p ma ......" | 25472647 |
hsa-miR-31-3p | colorectal cancer | BRAF | "Association of microRNA 31 with BRAF mutation colo ......" | 24242331 |
hsa-miR-31-3p | colorectal cancer | BRAF | "MicroRNA-31 miR-31 plays an oncogenic role and is ......" | 26871294 |
hsa-miR-31-3p | colorectal cancer | EZH2 | "The relationship between EZH2 expression and micro ......" | 26871294 |
hsa-miR-31-3p | esophageal cancer | EZH2 | "Additionally miR-31 regulates EZH2 and HDAC3 indir ......" | 25644061 |
hsa-miR-31-3p | melanoma | EZH2 | "Genetic and epigenetic loss of microRNA 31 leads t ......" | 22948084 |
hsa-miR-31-3p | bladder cancer | ITGA5 | "These effects arising from miR-31 overexpression w ......" | 27050274 |
hsa-miR-31-3p | gastric cancer | ITGA5 | "To verify the hypothesis that upregulation of micr ......" | 26729197 |
hsa-miR-31-3p | prostate cancer | ITGA5 | "Both ITGA5 and RDX two target genes of hsa-mir-31 ......" | 23984644 |
hsa-miR-31-3p | cervical and endocervical cancer | ARID1A | "MiR 31 is an independent prognostic factor and fun ......" | 24793973 |
hsa-miR-31-3p | head and neck cancer | ARID1A | "miR 31 targets ARID1A and enhances the oncogenicit ......" | 27528032 |
hsa-miR-31-3p | breast cancer | C11ORF30 | "The breast cancer oncogene EMSY represses transcri ......" | 24582497 |
hsa-miR-31-3p | breast cancer | C11ORF30 | "A novel mechanism of regulation of the anti metast ......" | 25927669 |
hsa-miR-31-3p | colorectal cancer | CASR | "MicroRNA 31 contributes to colorectal cancer devel ......" | 24521875 |
hsa-miR-31-3p | head and neck cancer | CASR | "miR 31 ablates expression of the HIF regulatory fa ......" | 20145132 |
hsa-miR-31-3p | lung squamous cell cancer | DICER1 | "We then determined that the tumor suppressor DICER ......" | 21890451 |
hsa-miR-31-3p | prostate cancer | DICER1 | "These findings suggest possibilities that miR-200a ......" | 25768283 |
hsa-miR-31-3p | lung cancer | ELAVL1 | "MiR 31 Functions as a Tumor Suppressor in Lung Ade ......" | 27215092 |
hsa-miR-31-3p | thyroid cancer | ELAVL1 | "miR 31 Reduces Cell Growth of Papillary Thyroid Ca ......" | 26731986 |
hsa-miR-31-3p | bladder cancer | ITGA9 | "MicroRNA 31 functions as a tumor suppressor and in ......" | 27050274 |
hsa-miR-31-3p | gastric cancer | ITGA9 | "Upregulation of microRNA 31 targeting integrin α5 ......" | 26729197 |
hsa-miR-31-3p | endometrial cancer | LATS2 | "MIR31 significantly suppressed the luciferase acti ......" | 24779718 |
hsa-miR-31-3p | lung cancer | LATS2 | "These targets included the tumor-suppressive genes ......" | 20237410 |
hsa-miR-31-3p | esophageal cancer | PPP2R2A | "In ZD esophagus and tongue oncogenic miR-31 and mi ......" | 22689922 |
hsa-miR-31-3p | lung cancer | PPP2R2A | "These targets included the tumor-suppressive genes ......" | 20237410 |
hsa-miR-31-3p | breast cancer | SATB2 | "MiR 31 inhibits migration and invasion by targetin ......" | 27593563 |
hsa-miR-31-3p | colorectal cancer | SATB2 | "Elevated microRNA 31 expression regulates colorect ......" | 24386467 |
hsa-miR-31-3p | esophageal cancer | TP53 | "We demonstrated that miR-31 only exerted tumor-sup ......" | 25568668 |
hsa-miR-31-3p | ovarian cancer | TP53 | "Molecular profiling uncovers a p53 associated role ......" | 20179198 |
hsa-miR-31-3p | lung squamous cell cancer | ABCB9 | "MicroRNA 31 inhibits cisplatin induced apoptosis i ......" | 24099915 |
hsa-miR-31-3p | ovarian cancer | AFF1 | "Meanwhile miR-31 gain-of-function led to the down- ......" | 26260454 |
hsa-miR-31-3p | colon cancer | AKT1 | "We present compelling evidence that TIAM1 a guanid ......" | 20826792 |
hsa-miR-31-3p | prostate cancer | AR | "Epigenetic repression of miR 31 disrupts androgen ......" | 23233736 |
hsa-miR-31-3p | lung cancer | BAP1 | "BAP1 suppresses lung cancer progression and is inh ......" | 26885612 |
hsa-miR-31-3p | prostate cancer | BCL2L2 | "By downregulating Bcl-w and E2F6 miR-205 and miR-3 ......" | 21368878 |
hsa-miR-31-3p | glioblastoma | CASP3 | "The enforced expression of miR-31 significantly re ......" | 26310668 |
hsa-miR-31-3p | glioblastoma | CASP9 | "The enforced expression of miR-31 significantly re ......" | 26310668 |
hsa-miR-31-3p | liver cancer | CDK2 | "Additional study evidenced miR-31 directly to supp ......" | 25797269 |
hsa-miR-31-3p | colorectal cancer | CDKN2B | "In addition the CDKN2B protein levels were signifi ......" | 25202407 |
hsa-miR-31-3p | chordoma | CHDM | "In this study miR-31 anti-miR-140-3p anti-miR148a ......" | 27016303 |
hsa-miR-31-3p | esophageal cancer | CYLD | "We demonstrate that miR-31 is significantly decrea ......" | 25644061 |
hsa-miR-31-3p | lung cancer | CYP2B6 | "We identified 27 hub genes by the final integrativ ......" | 24726065 |
hsa-miR-31-3p | lung cancer | DACT3 | "Over-expression of miR-31 markedly diminished Dkk- ......" | 21048943 |
hsa-miR-31-3p | lung cancer | DKK1 | "CLIP and reporter assays demonstrated direct inter ......" | 21048943 |
hsa-miR-31-3p | prostate cancer | E2F6 | "By downregulating Bcl-w and E2F6 miR-205 and miR-3 ......" | 21368878 |
hsa-miR-31-3p | breast cancer | EGF | "The tissue and plasma levels of miR-155 and miR-31 ......" | 23162645 |
hsa-miR-31-3p | colorectal cancer | EGFR | "Association of MicroRNA 31 5p with Clinical Effica ......" | 25472647 |
hsa-miR-31-3p | breast cancer | ESR1 | "miR 155 and miR 31 are differentially expressed in ......" | 23162645 |
hsa-miR-31-3p | breast cancer | GNA13 | "MicroRNA 31 controls G protein alpha 13 GNA13 expr ......" | 25889182 |
hsa-miR-31-3p | breast cancer | GNB2 | "MicroRNA 31 controls G protein alpha 13 GNA13 expr ......" | 25889182 |
hsa-miR-31-3p | liver cancer | HDAC2 | "Additional study evidenced miR-31 directly to supp ......" | 25797269 |
hsa-miR-31-3p | esophageal cancer | HDAC3 | "Additionally miR-31 regulates EZH2 and HDAC3 indir ......" | 25644061 |
hsa-miR-31-3p | colorectal cancer | HIF1AN | "MicroRNA 31 contributes to colorectal cancer devel ......" | 24521875 |
hsa-miR-31-3p | ovarian cancer | KCNMA1 | "Over expression of miR 31 or loss of KCNMA1 leads ......" | 26386726 |
hsa-miR-31-3p | ovarian cancer | KNG1 | "Our data show that miR-31 is increased whilst pota ......" | 26386726 |
hsa-miR-31-3p | lung cancer | MET | "Also MET proto-oncogene has been determined to be ......" | 26299665 |
hsa-miR-31-3p | pancreatic cancer | MIA | "Quite unexpectedly both the inhibition of miR-31 i ......" | 22344632 |
hsa-miR-31-3p | colorectal cancer | MTDH | "Targeted downregulation of AEG-1 might improve the ......" | 24462870 |
hsa-miR-31-3p | lymphoma | MYC | "Changes in miR-17-5p and miR-31 were not correlate ......" | 26997445 |
hsa-miR-31-3p | T cell leukemia | NFASC | "Polycomb mediated loss of miR 31 activates NIK dep ......" | 22264793 |
hsa-miR-31-3p | lung cancer | NINL | "In addition miR-31 targets analysis were integrate ......" | 24726065 |
hsa-miR-31-3p | breast cancer | NUP214 | "The recent publication by Viré et al in Molecular ......" | 25927669 |
hsa-miR-31-3p | esophageal cancer | PDCD4 | "In ZD esophagus and tongue oncogenic miR-31 and mi ......" | 22689922 |
hsa-miR-31-3p | colon cancer | PDLIM5 | "Consistent with this overexpression of either miR- ......" | 20826792 |
hsa-miR-31-3p | cervical and endocervical cancer | PDXP | "In the present study we measured the expression le ......" | 25894339 |
hsa-miR-31-3p | breast cancer | PGR | "miR 155 and miR 31 are differentially expressed in ......" | 23162645 |
hsa-miR-31-3p | colorectal cancer | RASA1 | "MicroRNA 31 activates the RAS pathway and function ......" | 23322774 |
hsa-miR-31-3p | prostate cancer | RDX | "Both ITGA5 and RDX two target genes of hsa-mir-31 ......" | 23984644 |
hsa-miR-31-3p | breast cancer | RHOA | "miR-31 exerts its metastasis-suppressor activity b ......" | 22289355 |
hsa-miR-31-3p | colon cancer | RHOBTB1 | "The tumor suppressor gene RhoBTB1 is a novel targe ......" | 23258531 |
hsa-miR-31-3p | esophageal cancer | SOX4 | "We analyzed the reciprocal expression regulation o ......" | 25644061 |
hsa-miR-31-3p | glioblastoma | STAT3 | "For this purpose the human GBM cell lines U251 and ......" | 26310668 |
hsa-miR-31-3p | ovarian cancer | STMN1 | "Screening miRNA profiles from KF/KF-TX cellular se ......" | 25897432 |
hsa-miR-31-3p | colon cancer | TIAM1 | "miR 21 and miR 31 converge on TIAM1 to regulate mi ......" | 20826792 |
hsa-miR-31-3p | lung squamous cell cancer | TIMM8A | "However the possible role of miR-31 in cisplatin D ......" | 24099915 |
hsa-miR-31-3p | glioblastoma | TRADD | "We show that miR-31 inhibits NF-κB signaling by t ......" | 26164206 |
hsa-miR-31-3p | lung cancer | VEGFA | "Inhibition of miR-31 and overexpression of HuR res ......" | 27215092 |
hsa-miR-31-3p | breast cancer | WASF3 | "miR-31 exerts its metastasis-suppressor activity b ......" | 22289355 |
hsa-miR-31-3p | endometrial cancer | YAP1 | "MIR31 significantly suppressed the luciferase acti ......" | 24779718 |
Expression profile in cancer corhorts: