microRNA information: hsa-miR-32-3p

SectionIDlink
Mature name: hsa-miR-32-3pmiRbase
Accession: MIMAT0004505miRbase
Precursor name: hsa-mir-32 miRbase
Precursor accession: MI0000090miRbase
Symbol: MIR32HGNC
RefSeq ID: NR_029506GenBank
Sequence: CAAUUUAGUGUGUGUGAUAUUU



Reported expression in cancers: hsa-miR-32-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-32-3p

breast cancerupregulation"The aim of the present study was to investigate th ......"26276160
hsa-miR-32-3p

colorectal cancerupregulation"MiR-32 has been shown to be upregulated in CRC ......"23617834
hsa-miR-32-3p

lung cancerderegulation"The expression of 319 miRNAs was evaluated by Exiq ......"20818338Microarray
hsa-miR-32-3p

lung squamous cell cancerdownregulation"Expression of miR 32 in human non small cell lung ......"25755781qPCR
hsa-miR-32-3p

lung squamous cell cancerdownregulation"MicroRNA-32 miR-32 is dysregulated in certain huma ......"26229485Reverse transcription PCR; qPCR



Reported cancer pathway affected by hsa-miR-32-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-32-3p

colorectal cancerApoptosis pathway"MicroRNA 32 miR 32 regulates phosphatase and tensi ......"23617834Luciferase
hsa-miR-32-3p

colorectal cancerApoptosis pathway"Oridonin triggers apoptosis in colorectal carcinom ......"26054686MTT assay; Western blot
hsa-miR-32-3p

liver cancerPI3K/Akt signaling pathway"MiR 32 induces cell proliferation migration and in ......"25647261Luciferase
hsa-miR-32-3p

lung squamous cell cancerApoptosis pathway"miR 32 functions as a tumor suppressor and directl ......"26229485Luciferase
hsa-miR-32-3p

lung squamous cell cancerEpithelial mesenchymal transition pathway"miR 32 inhibits proliferation epithelial mesenchym ......"27042117Western blot; Luciferase
hsa-miR-32-3p

prostate cancerApoptosis pathway"Androgen regulated miR 32 targets BTG2 and is over ......"22266859Western blot; Luciferase
hsa-miR-32-3p

prostate cancerApoptosis pathway"microRNA 32 induces radioresistance by targeting D ......"26622795



Reported cancer prognosis affected by hsa-miR-32-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-32-3p

breast cancerprogression"MiR 32 contributed to cell proliferation of human ......"26276160Luciferase
hsa-miR-32-3p

colorectal cancertumorigenesis"MicroRNA 32 miR 32 regulates phosphatase and tensi ......"23617834Luciferase
hsa-miR-32-3p

colorectal cancertumorigenesis; metastasis; poor survival; worse prognosis"The relationship between and clinical significance ......"24123284Western blot
hsa-miR-32-3p

gastric cancerstaging"miR-32 miR-182 and miR-143 dysregulated expression ......"21874264
hsa-miR-32-3p

gastric cancertumorigenesis"MiR 32 promotes gastric carcinoma tumorigenesis by ......"26471298
hsa-miR-32-3p

lung squamous cell cancerprogression; poor survival; worse prognosis; staging; metastasis"Expression of miR 32 in human non small cell lung ......"25755781
hsa-miR-32-3p

lung squamous cell cancerprogression; tumorigenesis; worse prognosis; staging; metastasis; poor survival"miR 32 functions as a tumor suppressor and directl ......"26229485Luciferase
hsa-miR-32-3p

lung squamous cell cancermetastasis"miR 32 inhibits proliferation epithelial mesenchym ......"27042117Western blot; Luciferase
hsa-miR-32-3p

prostate cancerdifferentiation"Importantly targeting the PCa androgens/AR signals ......"25817444
hsa-miR-32-3p

prostate cancerdrug resistance; poor survival"microRNA 32 induces radioresistance by targeting D ......"26622795



Reported gene related to hsa-miR-32-3p

miRNAcancergenereportingPUBMED
hsa-miR-32-3p

colorectal cancerPTEN"In this study we determined the levels of the corr ......"24123284
hsa-miR-32-3p

colorectal cancerPTEN"MicroRNA 32 miR 32 regulates phosphatase and tensi ......"23617834
hsa-miR-32-3p

liver cancerPTEN"MiR 32 induces cell proliferation migration and in ......"25647261
hsa-miR-32-3p

lung squamous cell cancerSOX9"miR 32 functions as a tumor suppressor and directl ......"26229485
hsa-miR-32-3p

sarcomaSOX9"MicroRNA 32 inhibits osteosarcoma cell proliferati ......"24989927
hsa-miR-32-3p

colorectal cancerTNS1"The relationship between and clinical significance ......"24123284
hsa-miR-32-3p

colorectal cancerTNS1"MicroRNA 32 miR 32 regulates phosphatase and tensi ......"23617834
hsa-miR-32-3p

lung squamous cell cancerAURKA"Tanshinones suppress AURKA through up regulation o ......"26036635
hsa-miR-32-3p

prostate cancerBTG2"Androgen regulated miR 32 targets BTG2 and is over ......"22266859
hsa-miR-32-3p

prostate cancerDAB2IP"microRNA 32 induces radioresistance by targeting D ......"26622795
hsa-miR-32-3p

gastric cancerKLF4"We also identified Kruppel-like factor 4 KLF4 as a ......"26471298
hsa-miR-32-3p

prostate cancerMCM7"Consistent with these findings tumors expressed th ......"18676839
hsa-miR-32-3p

breast cancerPHLPP2"MiR 32 contributed to cell proliferation of human ......"26276160
hsa-miR-32-3p

gastric cancerSGCB"microRNA 32 inhibits the proliferation and invasio ......"24348862
hsa-miR-32-3p

prostate cancerTMEM245"Consistent with these findings tumors expressed th ......"18676839
hsa-miR-32-3p

lung squamous cell cancerTWIST1"miR 32 inhibits proliferation epithelial mesenchym ......"27042117



Expression profile in cancer corhorts: