microRNA information: hsa-miR-320c

SectionIDlink
Mature name: hsa-miR-320cmiRbase
Accession: MIMAT0005793miRbase
Precursor name: hsa-mir-320c-1 miRbase
Precursor accession: MI0003778miRbase
Symbol: MIR320C1HGNC
RefSeq ID: NR_031565GenBank
Sequence: AAAAGCUGGGUUGAGAGGGU



Reported expression in cancers: hsa-miR-320c

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-320c

bladder cancerdownregulation"Previous miRNA microarray analysis illustrated tha ......"25178497Microarray; qPCR



Reported cancer pathway affected by hsa-miR-320c

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-320c

bladder cancercell cycle pathway"Previous miRNA microarray analysis illustrated tha ......"25178497Flow cytometry; Colony formation; Transwell assay; Western blot; Luciferase



Reported cancer prognosis affected by hsa-miR-320c

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-320c

bladder cancermotility"Previous miRNA microarray analysis illustrated tha ......"25178497Flow cytometry; Colony formation; Transwell assay; Western blot; Luciferase
hsa-miR-320c

pancreatic cancerdrug resistance"miR 320c regulates gemcitabine resistance in pancr ......"23799850



Reported gene related to hsa-miR-320c

miRNAcancergenereportingPUBMED
hsa-miR-320c

bladder cancerCDK6"In addition we identified CDK6 a cell cycle regula ......"25178497
hsa-miR-320c

pancreatic cancerSMARCC1"miR 320c regulates gemcitabine resistance in pancr ......"23799850



Expression profile in cancer corhorts: