microRNA information: hsa-miR-323b-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-323b-3p | miRbase |
| Accession: | MIMAT0015050 | miRbase |
| Precursor name: | hsa-mir-323b | miRbase |
| Precursor accession: | MI0014206 | miRbase |
| Symbol: | MIR323B | HGNC |
| RefSeq ID: | NR_029969 | GenBank |
| Sequence: | CCCAAUACACGGUCGACCUCUU |
Reported expression in cancers: hsa-miR-323b-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-323b-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-323b-3p | " ......" |
Reported cancer pathway affected by hsa-miR-323b-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-323b-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-323b-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-323b-3p | prostate cancer | ADIPOQ | "MiR 323 Inhibits Prostate Cancer Vascularization T ......" | 26160610 |
| hsa-miR-323b-3p | prostate cancer | ADIPOR1 | "We analyzed the binding of miR-323 to the 3'UTR of ......" | 26160610 |
| hsa-miR-323b-3p | prostate cancer | VEGFA | "We modified miR-323 levels in PC cells and examine ......" | 26160610 |
Expression profile in cancer corhorts:
