microRNA information: hsa-miR-328-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-328-3p | miRbase |
| Accession: | MIMAT0000752 | miRbase |
| Precursor name: | hsa-mir-328 | miRbase |
| Precursor accession: | MI0000804 | miRbase |
| Symbol: | MIR328 | HGNC |
| RefSeq ID: | NR_029887 | GenBank |
| Sequence: | CUGGCCCUCUCUGCCCUUCCGU |
Reported expression in cancers: hsa-miR-328-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-328-3p | acute myeloid leukemia | downregulation | "Low expression of circulating microRNA 328 is asso ......" | 26185105 | qPCR |
| hsa-miR-328-3p | cervical and endocervical cancer | downregulation | "In this study we aimed to determine the expression ......" | 27181358 | |
| hsa-miR-328-3p | colorectal cancer | downregulation | "MiRNA microarray analysis identified miR-328 as a ......" | 22453125 | Microarray |
| hsa-miR-328-3p | lung cancer | deregulation | "The expression of 319 miRNAs was evaluated by Exiq ......" | 20818338 | Microarray |
| hsa-miR-328-3p | melanoma | upregulation | "miR-328 is upregulated in blood cells of melanoma ......" | 25743834 | |
| hsa-miR-328-3p | sarcoma | upregulation | "Moreover a microRNA miR analysis showed that miR-3 ......" | 25605016 |
Reported cancer pathway affected by hsa-miR-328-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-328-3p | cervical and endocervical cancer | Wnt signaling pathway | "microRNA 328 inhibits cervical cancer cell prolife ......" | 27181358 | Colony formation; Luciferase |
| hsa-miR-328-3p | endometrial cancer | cell cycle pathway | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 | |
| hsa-miR-328-3p | esophageal cancer | Apoptosis pathway | "MiR 328 suppresses the survival of esophageal canc ......" | 26773497 | Luciferase; Western blot |
| hsa-miR-328-3p | glioblastoma | cell cycle pathway | "MiR 328 expression is decreased in high grade glio ......" | 23077581 | |
| hsa-miR-328-3p | sarcoma | MAPK signaling pathway | "Upregulation of miR 328 and inhibition of CREB DNA ......" | 25605016 |
Reported cancer prognosis affected by hsa-miR-328-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-328-3p | acute myeloid leukemia | worse prognosis; poor survival | "Low expression of circulating microRNA 328 is asso ......" | 26185105 | |
| hsa-miR-328-3p | breast cancer | drug resistance | "MicroRNA 328 negatively regulates the expression o ......" | 19270061 | Luciferase |
| hsa-miR-328-3p | breast cancer | drug resistance | "Breast cancer resistance protein BCRP/ABCG2 regula ......" | 21219875 | Flow cytometry |
| hsa-miR-328-3p | breast cancer | poor survival | "We performed survival analysis on a cohort of 466 ......" | 23589849 | |
| hsa-miR-328-3p | cervical and endocervical cancer | tumorigenesis | "microRNA 328 inhibits cervical cancer cell prolife ......" | 27181358 | Colony formation; Luciferase |
| hsa-miR-328-3p | colorectal cancer | drug resistance | "MicroRNA expression profiling identifies miR 328 r ......" | 22453125 | Luciferase |
| hsa-miR-328-3p | colorectal cancer | drug resistance | "On the other hand miR-222 targeting ADAM-17 a disi ......" | 23173124 | |
| hsa-miR-328-3p | endometrial cancer | staging | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 | |
| hsa-miR-328-3p | esophageal cancer | poor survival | "MiR 328 suppresses the survival of esophageal canc ......" | 26773497 | Luciferase; Western blot |
| hsa-miR-328-3p | glioblastoma | drug resistance | "ABCG2 which encodes an ATP-binding cassette transp ......" | 20885358 | Flow cytometry |
| hsa-miR-328-3p | glioblastoma | poor survival | "MiR 328 expression is decreased in high grade glio ......" | 23077581 | |
| hsa-miR-328-3p | liver cancer | motility; cell migration; progression | "MicroRNA 328 enhances cellular motility through po ......" | 26604785 | Transwell assay |
| hsa-miR-328-3p | lung cancer | metastasis | "MicroRNA 328 is associated with non small cell lun ......" | 21448905 | |
| hsa-miR-328-3p | lung squamous cell cancer | staging; metastasis; poor survival | "Up regulation of miR 328 3p sensitizes non small c ......" | 27530148 | Luciferase |
| hsa-miR-328-3p | sarcoma | motility; metastasis | "Upregulation of miR 328 and inhibition of CREB DNA ......" | 25605016 |
Reported gene related to hsa-miR-328-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-328-3p | breast cancer | ABCG2 | "Immunoblot analyses indicated that ABCG2 protein e ......" | 21219875 |
| hsa-miR-328-3p | breast cancer | ABCG2 | "To understand post-transcriptional regulation of A ......" | 19270061 |
| hsa-miR-328-3p | colorectal cancer | ABCG2 | "Furthermore luciferase reporter assay demonstrated ......" | 22453125 |
| hsa-miR-328-3p | sarcoma | CREB1 | "Upregulation of miR 328 and inhibition of CREB DNA ......" | 25605016 |
| hsa-miR-328-3p | acute myeloid leukemia | FRTS1 | "In addition low miR-328 expression was an independ ......" | 26185105 |
| hsa-miR-328-3p | breast cancer | KCNH2 | "Using computational prediction it was identified ......" | 25824027 |
| hsa-miR-328-3p | sarcoma | MAPK8 | "Mechanistic investigations found that JNK and p38 ......" | 25605016 |
| hsa-miR-328-3p | head and neck cancer | MAX | "In the protein-protein interaction PPI network the ......" | 27035560 |
| hsa-miR-328-3p | colorectal cancer | MMP16 | "Furthermore luciferase reporter assay demonstrated ......" | 22453125 |
| hsa-miR-328-3p | sarcoma | MMP2 | "Upregulation of miR 328 and inhibition of CREB DNA ......" | 25605016 |
| hsa-miR-328-3p | esophageal cancer | PLCE1 | "MiR 328 suppresses the survival of esophageal canc ......" | 26773497 |
| hsa-miR-328-3p | esophageal cancer | PLCL1 | "Dual-luciferase reporter assay confirmed that miR- ......" | 26773497 |
| hsa-miR-328-3p | liver cancer | PPFIA3 | "Interaction between microRNA miR-328 and PTPRJ pro ......" | 26604785 |
| hsa-miR-328-3p | lung cancer | PRKCA | "In summary miR-328 has a role in conferring migrat ......" | 21448905 |
| hsa-miR-328-3p | liver cancer | PTPRJ | "MicroRNA 328 enhances cellular motility through po ......" | 26604785 |
| hsa-miR-328-3p | cervical and endocervical cancer | TCF7L2 | "microRNA 328 inhibits cervical cancer cell prolife ......" | 27181358 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-328-3p | CD44 | 11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; OV; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.387; TCGA CESC -0.335; TCGA HNSC -0.142; TCGA KIRC -0.236; TCGA KIRP -0.435; TCGA LGG -0.206; TCGA OV -0.199; TCGA PAAD -0.198; TCGA SARC -0.239; TCGA STAD -0.137; TCGA UCEC -0.196 |
hsa-miR-328-3p | CDC42EP1 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; UCEC | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.333; TCGA BRCA -0.114; TCGA CESC -0.298; TCGA ESCA -0.281; TCGA HNSC -0.174; TCGA KIRC -0.251; TCGA KIRP -0.148; TCGA LUSC -0.177; TCGA PAAD -0.529; TCGA THCA -0.269; TCGA UCEC -0.176 |
hsa-miR-328-3p | DIAPH1 | 10 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUSC; PAAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.077; TCGA CESC -0.181; TCGA ESCA -0.267; TCGA HNSC -0.134; TCGA LGG -0.079; TCGA LUSC -0.085; TCGA PAAD -0.173; TCGA SARC -0.111; TCGA THCA -0.143; TCGA STAD -0.083 |
hsa-miR-328-3p | IRAK1 | 10 cancers: BLCA; CESC; ESCA; HNSC; LGG; LIHC; PAAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.085; TCGA CESC -0.106; TCGA ESCA -0.113; TCGA HNSC -0.059; TCGA LGG -0.129; TCGA LIHC -0.173; TCGA PAAD -0.136; TCGA SARC -0.144; TCGA THCA -0.17; TCGA UCEC -0.098 |
hsa-miR-328-3p | CLEC2B | 10 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUSC; PAAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.225; TCGA BRCA -0.06; TCGA CESC -0.514; TCGA KIRP -0.327; TCGA LGG -0.275; TCGA LUSC -0.197; TCGA PAAD -0.361; TCGA SARC -0.166; TCGA THCA -0.508; TCGA UCEC -0.352 |
hsa-miR-328-3p | ITGAV | 9 cancers: BLCA; COAD; LIHC; LUAD; OV; PAAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.184; TCGA COAD -0.13; TCGA LIHC -0.132; TCGA LUAD -0.128; TCGA OV -0.122; TCGA PAAD -0.25; TCGA SARC -0.141; TCGA THCA -0.218; TCGA UCEC -0.225 |
hsa-miR-328-3p | DSC2 | 9 cancers: BLCA; CESC; COAD; HNSC; LUAD; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.287; TCGA CESC -0.581; TCGA COAD -0.222; TCGA HNSC -0.387; TCGA LUAD -0.093; TCGA PAAD -0.332; TCGA PRAD -0.177; TCGA THCA -0.616; TCGA STAD -0.188 |
hsa-miR-328-3p | FAM109B | 9 cancers: BRCA; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BRCA -0.106; TCGA KIRC -0.202; TCGA KIRP -0.174; TCGA LIHC -0.195; TCGA PAAD -0.399; TCGA PRAD -0.086; TCGA SARC -0.082; TCGA THCA -0.282; TCGA UCEC -0.12 |
hsa-miR-328-3p | HNRNPF | 11 cancers: CESC; COAD; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; UCEC | miRNAWalker2 validate | TCGA CESC -0.102; TCGA COAD -0.092; TCGA HNSC -0.063; TCGA KIRP -0.064; TCGA LGG -0.136; TCGA LUAD -0.087; TCGA OV -0.071; TCGA PAAD -0.169; TCGA PRAD -0.113; TCGA THCA -0.087; TCGA UCEC -0.097 |
hsa-miR-328-3p | YWHAQ | 9 cancers: CESC; COAD; HNSC; LIHC; LUAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.063; TCGA COAD -0.143; TCGA HNSC -0.141; TCGA LIHC -0.118; TCGA LUAD -0.067; TCGA PRAD -0.072; TCGA THCA -0.064; TCGA STAD -0.056; TCGA UCEC -0.053 |
hsa-miR-328-3p | PGM2 | 12 cancers: CESC; COAD; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA CESC -0.283; TCGA COAD -0.127; TCGA ESCA -0.133; TCGA HNSC -0.157; TCGA LGG -0.135; TCGA LUAD -0.071; TCGA PAAD -0.225; TCGA PRAD -0.077; TCGA SARC -0.08; TCGA THCA -0.096; TCGA STAD -0.099; TCGA UCEC -0.111 |
hsa-miR-328-3p | YWHAZ | 10 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; THCA; STAD; UCEC | MirTarget | TCGA CESC -0.133; TCGA COAD -0.136; TCGA ESCA -0.141; TCGA HNSC -0.159; TCGA LIHC -0.185; TCGA LUAD -0.124; TCGA PAAD -0.225; TCGA THCA -0.112; TCGA STAD -0.093; TCGA UCEC -0.089 |
hsa-miR-328-3p | SLC2A1 | 9 cancers: CESC; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; SARC; THCA | MirTarget | TCGA CESC -0.346; TCGA HNSC -0.184; TCGA KIRC -0.244; TCGA KIRP -0.184; TCGA LIHC -0.266; TCGA LUAD -0.154; TCGA PAAD -0.489; TCGA SARC -0.217; TCGA THCA -0.163 |
hsa-miR-328-3p | RPL5 | 9 cancers: COAD; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA COAD -0.129; TCGA HNSC -0.091; TCGA KIRC -0.169; TCGA LGG -0.134; TCGA LUAD -0.089; TCGA LUSC -0.068; TCGA PRAD -0.089; TCGA STAD -0.133; TCGA UCEC -0.087 |
hsa-miR-328-3p | RALA | 10 cancers: COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA COAD -0.069; TCGA ESCA -0.188; TCGA HNSC -0.093; TCGA LGG -0.096; TCGA LIHC -0.092; TCGA LUSC -0.107; TCGA PAAD -0.19; TCGA THCA -0.156; TCGA STAD -0.067; TCGA UCEC -0.065 |
hsa-miR-328-3p | ETV6 | 9 cancers: KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA KIRC -0.116; TCGA KIRP -0.066; TCGA LGG -0.137; TCGA LIHC -0.084; TCGA PAAD -0.196; TCGA PRAD -0.078; TCGA SARC -0.093; TCGA THCA -0.126; TCGA STAD -0.071 |
Enriched cancer pathways of putative targets