microRNA information: hsa-miR-329-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-329-3p | miRbase |
| Accession: | MIMAT0001629 | miRbase |
| Precursor name: | hsa-mir-329-1 | miRbase |
| Precursor accession: | MI0001725 | miRbase |
| Symbol: | MIR329-1 | HGNC |
| RefSeq ID: | NR_029967 | GenBank |
| Sequence: | AACACACCUGGUUAACCUCUUU |
Reported expression in cancers: hsa-miR-329-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-329-3p | breast cancer | downregulation | "Here we provide experimental evidence that miR-362 ......" | 26337669 | |
| hsa-miR-329-3p | gastric cancer | downregulation | "MiR-329 was previously reported to act as a tumor ......" | 25654811 | |
| hsa-miR-329-3p | lung squamous cell cancer | upregulation | "Hsa miR 329 exerts tumor suppressor function throu ......" | 26909600 | |
| hsa-miR-329-3p | pancreatic cancer | deregulation | "To illustrate the pathogenic mechanisms we looked ......" | 26885689 |
Reported cancer pathway affected by hsa-miR-329-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-329-3p | lung squamous cell cancer | Apoptosis pathway | "Hsa miR 329 exerts tumor suppressor function throu ......" | 26909600 | Colony formation |
| hsa-miR-329-3p | pancreatic cancer | Apoptosis pathway | "mir 329 restricts tumor growth by targeting grb2 i ......" | 26885689 |
Reported cancer prognosis affected by hsa-miR-329-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-329-3p | breast cancer | progression | "Here we provide experimental evidence that miR-362 ......" | 26337669 | |
| hsa-miR-329-3p | gastric cancer | metastasis | "MiR-329 was previously reported to act as a tumor ......" | 25654811 | |
| hsa-miR-329-3p | pancreatic cancer | poor survival; staging | "mir 329 restricts tumor growth by targeting grb2 i ......" | 26885689 |
Reported gene related to hsa-miR-329-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-329-3p | breast cancer | BCAR1 | "miR-362-3p and miR-329 inhibited cellular prolifer ......" | 26337669 |
| hsa-miR-329-3p | lung squamous cell cancer | BCL2 | "In addition miR-329 promoted NSCLC cell apoptosis ......" | 26909600 |
| hsa-miR-329-3p | lung squamous cell cancer | CASP3 | "In addition miR-329 promoted NSCLC cell apoptosis ......" | 26909600 |
| hsa-miR-329-3p | pancreatic cancer | F2 | "Also more advanced pT stage cases were observed in ......" | 26885689 |
| hsa-miR-329-3p | pancreatic cancer | GRB2 | "mir 329 restricts tumor growth by targeting grb2 i ......" | 26885689 |
| hsa-miR-329-3p | lung squamous cell cancer | MMP7 | "Moreover miR-329 inhibited cellular migration and ......" | 26909600 |
| hsa-miR-329-3p | lung squamous cell cancer | MMP9 | "Moreover miR-329 inhibited cellular migration and ......" | 26909600 |
| hsa-miR-329-3p | gastric cancer | TIAM1 | "We identified T lymphoma invasion and metastasis 1 ......" | 25654811 |