microRNA information: hsa-miR-330-3p

SectionIDlink
Mature name: hsa-miR-330-3pmiRbase
Accession: MIMAT0000751miRbase
Precursor name: hsa-mir-330 miRbase
Precursor accession: MI0000803miRbase
Symbol: MIR330HGNC
RefSeq ID: NR_029886GenBank
Sequence: GCAAAGCACACGGCCUGCAGAGA



Reported expression in cancers: hsa-miR-330-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-330-3p

esophageal cancerupregulation"MicroRNA 330 3p functions as an oncogene in human ......"26045986Microarray; qPCR
hsa-miR-330-3p

glioblastomaderegulation"In this work the expression of 19 microRNAs miR-7 ......"24412053qPCR
hsa-miR-330-3p

lung squamous cell cancerupregulation"miR 330 3p controls cell proliferation by targetin ......"25935837



Reported cancer pathway affected by hsa-miR-330-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-330-3p

colorectal cancercell cycle pathway; Apoptosis pathway"miR 330 regulates the proliferation of colorectal ......"23337504
hsa-miR-330-3p

glioblastomacell cycle pathway; Apoptosis pathway"MicroRNA 330 is an oncogenic factor in glioblastom ......"23029364
hsa-miR-330-3p

glioblastomaPI3K/Akt signaling pathway; Apoptosis pathway"MiR 330 mediated regulation of SH3GL2 expression e ......"24736727
hsa-miR-330-3p

lung squamous cell cancercell cycle pathway"miR 330 3p controls cell proliferation by targetin ......"25935837Luciferase
hsa-miR-330-3p

prostate cancerApoptosis pathway"MicroRNA 330 acts as tumor suppressor and induces ......"19597470Luciferase



Reported cancer prognosis affected by hsa-miR-330-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-330-3p

colorectal cancerprogression"miR 330 regulates the proliferation of colorectal ......"23337504
hsa-miR-330-3p

esophageal cancerpoor survival"MicroRNA 330 3p functions as an oncogene in human ......"26045986Luciferase
hsa-miR-330-3p

glioblastomamalignant trasformation; cell migration; poor survival; tumor size; progression"MiR 330 mediated regulation of SH3GL2 expression e ......"24736727
hsa-miR-330-3p

lung squamous cell cancerdrug resistance; metastasis"miR 330 3p controls cell proliferation by targetin ......"25935837Luciferase
hsa-miR-330-3p

prostate cancermotility"microRNA 330 inhibits cell motility by downregulat ......"23670210Luciferase



Reported gene related to hsa-miR-330-3p

miRNAcancergenereportingPUBMED
hsa-miR-330-3p

glioblastomaSH3GL2"MiR 330 mediated regulation of SH3GL2 expression e ......"24736727
hsa-miR-330-3p

glioblastomaSH3GL2"MicroRNA 330 is an oncogenic factor in glioblastom ......"23029364
hsa-miR-330-3p

colorectal cancerCDC42"miR 330 regulates the proliferation of colorectal ......"23337504
hsa-miR-330-3p

prostate cancerE2F1"MicroRNA 330 acts as tumor suppressor and induces ......"19597470
hsa-miR-330-3p

lung squamous cell cancerEGR2"Luciferase activity assay and real-time RT-PCR ana ......"25935837
hsa-miR-330-3p

colorectal cancerITGA5"MicroRNA 330 5p negatively regulates ITGA5 express ......"27633518
hsa-miR-330-3p

esophageal cancerPDCD4"The luciferase assay confirmed that miR-330-3p dir ......"26045986
hsa-miR-330-3p

prostate cancerSP1"microRNA 330 inhibits cell motility by downregulat ......"23670210



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-330-3p
NCS1
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; STAD
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.335; TCGA COAD -0.169; TCGA ESCA -0.346; TCGA HNSC -0.126; TCGA KIRC -0.29; TCGA LUAD -0.176; TCGA LUSC -0.175; TCGA SARC -0.379; TCGA STAD -0.51
hsa-miR-330-3p
RAI2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; THCA; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.36; TCGA BRCA -0.229; TCGA CESC -0.423; TCGA COAD -0.335; TCGA ESCA -0.411; TCGA KIRP -0.244; TCGA THCA -0.132; TCGA STAD -0.442; TCGA UCEC -0.335
hsa-miR-330-3p
BNC2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.785; TCGA BRCA -0.195; TCGA CESC -0.307; TCGA COAD -0.317; TCGA ESCA -0.559; TCGA PAAD -0.323; TCGA SARC -0.142; TCGA STAD -0.634; TCGA UCEC -0.624
hsa-miR-330-3p
TRIM3
9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.09; TCGA CESC -0.142; TCGA HNSC -0.127; TCGA LIHC -0.069; TCGA PRAD -0.163; TCGA SARC -0.119; TCGA STAD -0.094; TCGA UCEC -0.123
hsa-miR-330-3p
FAM114A1
9 cancers: BLCA; BRCA; ESCA; LIHC; LUSC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.135; TCGA BRCA -0.067; TCGA ESCA -0.109; TCGA LIHC -0.177; TCGA LUSC -0.092; TCGA PAAD -0.161; TCGA SARC -0.212; TCGA STAD -0.13; TCGA UCEC -0.212
hsa-miR-330-3p
ZCCHC24
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.427; TCGA BRCA -0.204; TCGA CESC -0.137; TCGA COAD -0.237; TCGA ESCA -0.315; TCGA LIHC -0.108; TCGA PAAD -0.144; TCGA SARC -0.075; TCGA STAD -0.502; TCGA UCEC -0.313
hsa-miR-330-3p
CAV2
9 cancers: BLCA; BRCA; ESCA; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.262; TCGA BRCA -0.167; TCGA ESCA -0.222; TCGA LUSC -0.303; TCGA PAAD -0.236; TCGA SARC -0.326; TCGA THCA -0.211; TCGA STAD -0.375; TCGA UCEC -0.23
hsa-miR-330-3p
DPYSL3
11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUAD; PAAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.736; TCGA BRCA -0.129; TCGA CESC -0.285; TCGA ESCA -0.432; TCGA LGG -0.13; TCGA LUAD -0.139; TCGA PAAD -0.169; TCGA SARC -0.391; TCGA THCA -0.185; TCGA STAD -0.596; TCGA UCEC -0.594
hsa-miR-330-3p
CCDC50
9 cancers: BLCA; BRCA; ESCA; KIRP; LGG; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.154; TCGA BRCA -0.058; TCGA ESCA -0.182; TCGA KIRP -0.125; TCGA LGG -0.095; TCGA PAAD -0.092; TCGA SARC -0.106; TCGA STAD -0.242; TCGA UCEC -0.103
hsa-miR-330-3p
SAP30L
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.099; TCGA BRCA -0.083; TCGA CESC -0.104; TCGA COAD -0.101; TCGA ESCA -0.149; TCGA KIRC -0.076; TCGA LIHC -0.18; TCGA LUSC -0.067; TCGA SARC -0.089; TCGA STAD -0.15; TCGA UCEC -0.165
hsa-miR-330-3p
DNM3
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; STAD; UCEC
MirTarget
TCGA BLCA -0.22; TCGA BRCA -0.102; TCGA CESC -0.259; TCGA COAD -0.332; TCGA ESCA -0.227; TCGA HNSC -0.131; TCGA KIRC -0.202; TCGA STAD -0.139; TCGA UCEC -0.249
hsa-miR-330-3p
MYH3
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; PITA
TCGA BLCA -0.433; TCGA BRCA -0.106; TCGA CESC -0.231; TCGA ESCA -0.36; TCGA HNSC -0.302; TCGA KIRP -0.43; TCGA LGG -0.076; TCGA LIHC -0.329; TCGA LUAD -0.202; TCGA LUSC -0.156; TCGA SARC -0.27; TCGA STAD -0.255; TCGA UCEC -0.11
hsa-miR-330-3p
ACVR1
9 cancers: BLCA; BRCA; CESC; ESCA; LUSC; SARC; THCA; STAD; UCEC
MirTarget; PITA
TCGA BLCA -0.175; TCGA BRCA -0.107; TCGA CESC -0.072; TCGA ESCA -0.129; TCGA LUSC -0.111; TCGA SARC -0.123; TCGA THCA -0.154; TCGA STAD -0.133; TCGA UCEC -0.158
hsa-miR-330-3p
CTGF
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.643; TCGA BRCA -0.168; TCGA CESC -0.266; TCGA ESCA -0.429; TCGA HNSC -0.156; TCGA KIRC -0.16; TCGA LGG -0.087; TCGA STAD -0.227; TCGA UCEC -0.338
hsa-miR-330-3p
TNC
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.823; TCGA BRCA -0.109; TCGA COAD -0.305; TCGA ESCA -0.442; TCGA LUAD -0.311; TCGA PAAD -0.267; TCGA SARC -0.337; TCGA THCA -0.463; TCGA STAD -0.525
hsa-miR-330-3p
CREB5
10 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LUAD; LUSC; THCA; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.5; TCGA BRCA -0.138; TCGA CESC -0.275; TCGA ESCA -0.361; TCGA KIRP -0.335; TCGA LUAD -0.16; TCGA LUSC -0.422; TCGA THCA -0.405; TCGA STAD -0.426; TCGA UCEC -0.206
hsa-miR-330-3p
ESR1
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; SARC; THCA; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.293; TCGA BRCA -0.229; TCGA CESC -0.398; TCGA ESCA -0.273; TCGA KIRC -0.143; TCGA SARC -0.486; TCGA THCA -0.185; TCGA STAD -0.271; TCGA UCEC -0.408
hsa-miR-330-3p
ENAH
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; PAAD; SARC; THCA; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.192; TCGA BRCA -0.061; TCGA COAD -0.145; TCGA ESCA -0.211; TCGA LGG -0.109; TCGA PAAD -0.15; TCGA SARC -0.151; TCGA THCA -0.118; TCGA STAD -0.283; TCGA UCEC -0.098
hsa-miR-330-3p
PTPRD
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; STAD; UCEC
PITA; mirMAP
TCGA BLCA -0.779; TCGA BRCA -0.145; TCGA CESC -0.288; TCGA HNSC -0.293; TCGA KIRC -0.317; TCGA KIRP -0.234; TCGA LUSC -0.518; TCGA STAD -0.272; TCGA UCEC -0.487
hsa-miR-330-3p
GLIS3
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; OV; SARC; UCEC
PITA; miRNATAP
TCGA BLCA -0.305; TCGA BRCA -0.102; TCGA CESC -0.371; TCGA ESCA -0.473; TCGA KIRC -0.224; TCGA KIRP -0.238; TCGA OV -0.192; TCGA SARC -0.346; TCGA UCEC -0.149
hsa-miR-330-3p
TCF4
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUSC; STAD; UCEC
PITA; mirMAP
TCGA BLCA -0.345; TCGA BRCA -0.118; TCGA CESC -0.149; TCGA COAD -0.178; TCGA ESCA -0.206; TCGA LGG -0.071; TCGA LUSC -0.177; TCGA STAD -0.211; TCGA UCEC -0.253
hsa-miR-330-3p
PDE5A
9 cancers: BLCA; BRCA; CESC; ESCA; LGG; SARC; THCA; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.331; TCGA BRCA -0.124; TCGA CESC -0.285; TCGA ESCA -0.48; TCGA LGG -0.081; TCGA SARC -0.321; TCGA THCA -0.438; TCGA STAD -0.522; TCGA UCEC -0.347
hsa-miR-330-3p
SNAI2
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUSC; PAAD; UCEC
PITA
TCGA BLCA -0.244; TCGA BRCA -0.132; TCGA COAD -0.227; TCGA HNSC -0.13; TCGA LGG -0.069; TCGA LIHC -0.197; TCGA LUSC -0.269; TCGA PAAD -0.283; TCGA UCEC -0.318
hsa-miR-330-3p
PLS3
11 cancers: BLCA; BRCA; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.105; TCGA KIRC -0.225; TCGA LIHC -0.082; TCGA LUAD -0.104; TCGA LUSC -0.094; TCGA PAAD -0.199; TCGA SARC -0.226; TCGA THCA -0.089; TCGA STAD -0.104; TCGA UCEC -0.179
hsa-miR-330-3p
MAP1B
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; OV; SARC; STAD; UCEC
PITA; mirMAP
TCGA BLCA -0.572; TCGA BRCA -0.121; TCGA CESC -0.346; TCGA COAD -0.206; TCGA ESCA -0.52; TCGA LUSC -0.44; TCGA OV -0.177; TCGA SARC -0.351; TCGA STAD -0.599; TCGA UCEC -0.254
hsa-miR-330-3p
ARHGEF10
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; OV; PAAD; SARC; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.271; TCGA BRCA -0.087; TCGA COAD -0.159; TCGA ESCA -0.219; TCGA KIRP -0.128; TCGA OV -0.131; TCGA PAAD -0.137; TCGA SARC -0.232; TCGA STAD -0.2; TCGA UCEC -0.231
hsa-miR-330-3p
SULF1
9 cancers: BLCA; CESC; COAD; ESCA; LUAD; PAAD; SARC; STAD; UCEC
PITA
TCGA BLCA -0.801; TCGA CESC -0.198; TCGA COAD -0.286; TCGA ESCA -0.425; TCGA LUAD -0.212; TCGA PAAD -0.482; TCGA SARC -0.284; TCGA STAD -0.198; TCGA UCEC -0.177
hsa-miR-330-3p
ABHD4
10 cancers: BLCA; CESC; ESCA; KIRC; LGG; LIHC; LUSC; PAAD; SARC; UCEC
PITA; miRNATAP
TCGA BLCA -0.101; TCGA CESC -0.107; TCGA ESCA -0.177; TCGA KIRC -0.15; TCGA LGG -0.107; TCGA LIHC -0.11; TCGA LUSC -0.166; TCGA PAAD -0.131; TCGA SARC -0.237; TCGA UCEC -0.078
hsa-miR-330-3p
PTGER3
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.898; TCGA BRCA -0.312; TCGA CESC -0.385; TCGA COAD -0.335; TCGA ESCA -0.607; TCGA KIRC -0.644; TCGA SARC -0.638; TCGA STAD -0.432; TCGA UCEC -0.829
hsa-miR-330-3p
TOM1
9 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA
mirMAP; miRNATAP
TCGA BLCA -0.187; TCGA HNSC -0.17; TCGA KIRC -0.088; TCGA KIRP -0.064; TCGA LIHC -0.115; TCGA LUAD -0.06; TCGA PAAD -0.098; TCGA PRAD -0.133; TCGA THCA -0.097
hsa-miR-330-3p
COL1A1
9 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUAD; PAAD; THCA; UCEC
mirMAP
TCGA BLCA -0.675; TCGA BRCA -0.119; TCGA CESC -0.269; TCGA ESCA -0.369; TCGA LGG -0.294; TCGA LUAD -0.315; TCGA PAAD -0.591; TCGA THCA -0.401; TCGA UCEC -0.18
hsa-miR-330-3p
NT5DC3
9 cancers: BLCA; CESC; ESCA; LIHC; LUAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.288; TCGA CESC -0.14; TCGA ESCA -0.246; TCGA LIHC -0.13; TCGA LUAD -0.104; TCGA SARC -0.42; TCGA THCA -0.15; TCGA STAD -0.29; TCGA UCEC -0.186
hsa-miR-330-3p
RAPGEF5
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.245; TCGA BRCA -0.078; TCGA CESC -0.1; TCGA ESCA -0.119; TCGA KIRP -0.139; TCGA LUSC -0.152; TCGA SARC -0.235; TCGA STAD -0.131; TCGA UCEC -0.132
hsa-miR-330-3p
FGF2
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.408; TCGA BRCA -0.19; TCGA COAD -0.255; TCGA ESCA -0.498; TCGA LIHC -0.239; TCGA SARC -0.162; TCGA THCA -0.183; TCGA STAD -0.443; TCGA UCEC -0.396
hsa-miR-330-3p
PRICKLE1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.622; TCGA BRCA -0.069; TCGA CESC -0.206; TCGA COAD -0.281; TCGA ESCA -0.249; TCGA KIRC -0.151; TCGA KIRP -0.309; TCGA THCA -0.278; TCGA STAD -0.308; TCGA UCEC -0.307
hsa-miR-330-3p
ST8SIA2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.347; TCGA BRCA -0.301; TCGA CESC -0.299; TCGA ESCA -0.501; TCGA HNSC -0.217; TCGA KIRC -0.577; TCGA LGG -0.122; TCGA LUSC -0.329; TCGA PAAD -0.409; TCGA STAD -0.315
hsa-miR-330-3p
RHBDL3
9 cancers: BLCA; CESC; KIRC; LIHC; LUSC; OV; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.391; TCGA CESC -0.54; TCGA KIRC -0.234; TCGA LIHC -0.761; TCGA LUSC -0.457; TCGA OV -0.247; TCGA SARC -0.348; TCGA STAD -0.295; TCGA UCEC -0.32
hsa-miR-330-3p
SMAD4
9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; OV; STAD; UCEC
mirMAP
TCGA BLCA -0.059; TCGA CESC -0.086; TCGA ESCA -0.142; TCGA KIRC -0.073; TCGA KIRP -0.055; TCGA LGG -0.073; TCGA OV -0.065; TCGA STAD -0.118; TCGA UCEC -0.151
hsa-miR-330-3p
PDGFC
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; OV; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.513; TCGA BRCA -0.204; TCGA CESC -0.173; TCGA COAD -0.211; TCGA ESCA -0.248; TCGA KIRP -0.116; TCGA LGG -0.133; TCGA OV -0.091; TCGA PAAD -0.395; TCGA SARC -0.169; TCGA THCA -0.076; TCGA STAD -0.275; TCGA UCEC -0.166
hsa-miR-330-3p
CYP2U1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.133; TCGA BRCA -0.096; TCGA CESC -0.217; TCGA COAD -0.173; TCGA ESCA -0.289; TCGA KIRC -0.112; TCGA LGG -0.072; TCGA LIHC -0.124; TCGA SARC -0.128; TCGA STAD -0.262; TCGA UCEC -0.194
hsa-miR-330-3p
FZD7
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.208; TCGA BRCA -0.076; TCGA CESC -0.279; TCGA ESCA -0.312; TCGA KIRC -0.308; TCGA LUSC -0.428; TCGA OV -0.121; TCGA PAAD -0.288; TCGA STAD -0.305; TCGA UCEC -0.209
hsa-miR-330-3p
PLXDC1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.33; TCGA BRCA -0.1; TCGA CESC -0.216; TCGA COAD -0.167; TCGA ESCA -0.161; TCGA LUAD -0.204; TCGA THCA -0.143; TCGA STAD -0.129; TCGA UCEC -0.264
hsa-miR-330-3p
TUB
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.425; TCGA BRCA -0.096; TCGA CESC -0.238; TCGA COAD -0.374; TCGA ESCA -0.517; TCGA KIRC -0.326; TCGA LUSC -0.181; TCGA STAD -0.5; TCGA UCEC -0.364
hsa-miR-330-3p
PYGO1
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; OV; STAD; UCEC
mirMAP
TCGA BLCA -0.406; TCGA BRCA -0.156; TCGA CESC -0.236; TCGA ESCA -0.343; TCGA KIRC -0.567; TCGA LGG -0.08; TCGA OV -0.237; TCGA STAD -0.631; TCGA UCEC -0.322
hsa-miR-330-3p
KLF11
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.109; TCGA BRCA -0.073; TCGA CESC -0.076; TCGA ESCA -0.117; TCGA KIRC -0.068; TCGA KIRP -0.06; TCGA LIHC -0.1; TCGA SARC -0.106; TCGA STAD -0.176; TCGA UCEC -0.155
hsa-miR-330-3p
RGMB
9 cancers: BLCA; BRCA; CESC; ESCA; LGG; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.082; TCGA BRCA -0.107; TCGA CESC -0.165; TCGA ESCA -0.303; TCGA LGG -0.106; TCGA LIHC -0.176; TCGA SARC -0.122; TCGA STAD -0.433; TCGA UCEC -0.185
hsa-miR-330-3p
CACNB4
9 cancers: BLCA; BRCA; CESC; KIRC; LIHC; LUSC; OV; STAD; UCEC
mirMAP
TCGA BLCA -0.283; TCGA BRCA -0.171; TCGA CESC -0.349; TCGA KIRC -0.489; TCGA LIHC -0.292; TCGA LUSC -0.23; TCGA OV -0.194; TCGA STAD -0.328; TCGA UCEC -0.254
hsa-miR-330-3p
ITGA1
9 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.389; TCGA BRCA -0.118; TCGA COAD -0.198; TCGA ESCA -0.263; TCGA LGG -0.087; TCGA LIHC -0.111; TCGA SARC -0.274; TCGA STAD -0.42; TCGA UCEC -0.231
hsa-miR-330-3p
UBE2QL1
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.52; TCGA COAD -0.281; TCGA ESCA -0.472; TCGA HNSC -0.266; TCGA KIRC -0.468; TCGA LIHC -0.268; TCGA THCA -0.216; TCGA STAD -0.327; TCGA UCEC -0.186
hsa-miR-330-3p
KCTD7
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.125; TCGA BRCA -0.052; TCGA CESC -0.124; TCGA COAD -0.173; TCGA ESCA -0.183; TCGA KIRP -0.103; TCGA LUAD -0.11; TCGA LUSC -0.13; TCGA STAD -0.32; TCGA UCEC -0.181
hsa-miR-330-3p
PCYT1B
9 cancers: BLCA; BRCA; CESC; ESCA; LUSC; OV; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.368; TCGA BRCA -0.178; TCGA CESC -0.546; TCGA ESCA -0.63; TCGA LUSC -0.513; TCGA OV -0.194; TCGA SARC -0.429; TCGA STAD -0.496; TCGA UCEC -0.296
hsa-miR-330-3p
RNF180
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; STAD; UCEC
miRNATAP
TCGA BLCA -0.342; TCGA BRCA -0.225; TCGA CESC -0.261; TCGA COAD -0.273; TCGA ESCA -0.401; TCGA KIRC -0.293; TCGA LGG -0.119; TCGA STAD -0.518; TCGA UCEC -0.307
hsa-miR-330-3p
KANK2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.392; TCGA BRCA -0.151; TCGA CESC -0.201; TCGA COAD -0.159; TCGA ESCA -0.353; TCGA LGG -0.063; TCGA PAAD -0.213; TCGA SARC -0.367; TCGA THCA -0.2; TCGA STAD -0.512; TCGA UCEC -0.342
hsa-miR-330-3p
ILK
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.257; TCGA CESC -0.077; TCGA COAD -0.061; TCGA ESCA -0.094; TCGA HNSC -0.111; TCGA PAAD -0.174; TCGA SARC -0.29; TCGA STAD -0.253; TCGA UCEC -0.133
hsa-miR-330-3p
MXRA8
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.536; TCGA BRCA -0.162; TCGA CESC -0.201; TCGA COAD -0.228; TCGA ESCA -0.308; TCGA HNSC -0.163; TCGA PAAD -0.389; TCGA THCA -0.436; TCGA STAD -0.259; TCGA UCEC -0.325
hsa-miR-330-3p
IL17RD
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.346; TCGA BRCA -0.101; TCGA CESC -0.239; TCGA COAD -0.315; TCGA ESCA -0.236; TCGA KIRC -0.19; TCGA KIRP -0.187; TCGA LGG -0.092; TCGA LUAD -0.134; TCGA PAAD -0.195; TCGA THCA -0.371; TCGA STAD -0.445; TCGA UCEC -0.306
hsa-miR-330-3p
PLEKHH2
9 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.257; TCGA BRCA -0.207; TCGA CESC -0.436; TCGA COAD -0.35; TCGA KIRP -0.625; TCGA LGG -0.166; TCGA SARC -0.26; TCGA STAD -0.398; TCGA UCEC -0.535
hsa-miR-330-3p
JMY
9 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; SARC; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BRCA -0.056; TCGA CESC -0.145; TCGA ESCA -0.231; TCGA KIRC -0.305; TCGA KIRP -0.07; TCGA LIHC -0.141; TCGA SARC -0.117; TCGA STAD -0.227; TCGA UCEC -0.116
hsa-miR-330-3p
COL24A1
9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA BRCA -0.093; TCGA CESC -0.245; TCGA COAD -0.355; TCGA ESCA -0.412; TCGA KIRC -0.326; TCGA LUAD -0.266; TCGA LUSC -0.243; TCGA THCA -0.282; TCGA STAD -0.439
hsa-miR-330-3p
MAPK10
9 cancers: BRCA; CESC; COAD; ESCA; KIRC; OV; SARC; STAD; UCEC
PITA; miRNATAP
TCGA BRCA -0.241; TCGA CESC -0.227; TCGA COAD -0.375; TCGA ESCA -0.359; TCGA KIRC -0.231; TCGA OV -0.38; TCGA SARC -0.408; TCGA STAD -0.517; TCGA UCEC -0.331
hsa-miR-330-3p
CIRBP
11 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.079; TCGA CESC -0.118; TCGA HNSC -0.132; TCGA KIRP -0.102; TCGA LGG -0.07; TCGA LIHC -0.076; TCGA LUAD -0.071; TCGA LUSC -0.12; TCGA PRAD -0.175; TCGA STAD -0.163; TCGA UCEC -0.128
hsa-miR-330-3p
MEGF9
10 cancers: BRCA; CESC; ESCA; KIRC; LIHC; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.155; TCGA CESC -0.251; TCGA ESCA -0.212; TCGA KIRC -0.191; TCGA LIHC -0.125; TCGA LUSC -0.305; TCGA SARC -0.138; TCGA THCA -0.221; TCGA STAD -0.133; TCGA UCEC -0.136
hsa-miR-330-3p
MKLN1
9 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUSC; STAD; UCEC
mirMAP
TCGA BRCA -0.051; TCGA COAD -0.065; TCGA ESCA -0.126; TCGA KIRC -0.103; TCGA LGG -0.084; TCGA LIHC -0.094; TCGA LUSC -0.091; TCGA STAD -0.084; TCGA UCEC -0.059
hsa-miR-330-3p
GOLGA1
9 cancers: BRCA; ESCA; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.052; TCGA ESCA -0.103; TCGA LGG -0.059; TCGA LIHC -0.106; TCGA LUAD -0.05; TCGA LUSC -0.124; TCGA SARC -0.159; TCGA STAD -0.1; TCGA UCEC -0.062
hsa-miR-330-3p
DST
9 cancers: BRCA; ESCA; KIRC; LIHC; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.229; TCGA ESCA -0.251; TCGA KIRC -0.098; TCGA LIHC -0.102; TCGA LUSC -0.219; TCGA SARC -0.329; TCGA THCA -0.163; TCGA STAD -0.367; TCGA UCEC -0.194
hsa-miR-330-3p
PKD1L2
9 cancers: BRCA; ESCA; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.184; TCGA ESCA -0.479; TCGA LUAD -0.273; TCGA LUSC -0.342; TCGA OV -0.197; TCGA PAAD -0.371; TCGA SARC -0.739; TCGA THCA -0.297; TCGA STAD -0.417
hsa-miR-330-3p
ADCY6
10 cancers: BRCA; CESC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; THCA; UCEC
mirMAP
TCGA BRCA -0.083; TCGA CESC -0.196; TCGA KIRC -0.149; TCGA KIRP -0.118; TCGA LIHC -0.099; TCGA LUAD -0.079; TCGA OV -0.074; TCGA PRAD -0.125; TCGA THCA -0.082; TCGA UCEC -0.093
hsa-miR-330-3p
LRP2BP
10 cancers: CESC; HNSC; KIRP; LGG; LIHC; OV; PRAD; SARC; STAD; UCEC
MirTarget; PITA
TCGA CESC -0.188; TCGA HNSC -0.098; TCGA KIRP -0.226; TCGA LGG -0.092; TCGA LIHC -0.112; TCGA OV -0.225; TCGA PRAD -0.103; TCGA SARC -0.154; TCGA STAD -0.233; TCGA UCEC -0.131
hsa-miR-330-3p
DCUN1D4
9 cancers: CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; SARC; STAD
PITA; mirMAP; miRNATAP
TCGA CESC -0.053; TCGA COAD -0.072; TCGA ESCA -0.117; TCGA HNSC -0.063; TCGA KIRP -0.05; TCGA LIHC -0.153; TCGA LUAD -0.065; TCGA SARC -0.154; TCGA STAD -0.143
hsa-miR-330-3p
ING4
10 cancers: CESC; HNSC; KIRP; LGG; LIHC; LUAD; OV; PRAD; THCA; STAD
PITA; miRNATAP
TCGA CESC -0.156; TCGA HNSC -0.152; TCGA KIRP -0.128; TCGA LGG -0.054; TCGA LIHC -0.122; TCGA LUAD -0.061; TCGA OV -0.193; TCGA PRAD -0.127; TCGA THCA -0.077; TCGA STAD -0.132
hsa-miR-330-3p
VGLL4
9 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; UCEC
mirMAP
TCGA CESC -0.101; TCGA HNSC -0.068; TCGA KIRC -0.078; TCGA KIRP -0.207; TCGA LGG -0.076; TCGA LUSC -0.143; TCGA OV -0.068; TCGA PAAD -0.226; TCGA UCEC -0.076
hsa-miR-330-3p
ADAMTS13
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; UCEC
mirMAP
TCGA CESC -0.233; TCGA ESCA -0.242; TCGA HNSC -0.316; TCGA KIRC -0.228; TCGA KIRP -0.397; TCGA LUAD -0.41; TCGA LUSC -0.308; TCGA PRAD -0.238; TCGA UCEC -0.124
hsa-miR-330-3p
ZNF621
9 cancers: CESC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA CESC -0.113; TCGA KIRC -0.089; TCGA KIRP -0.148; TCGA LIHC -0.075; TCGA LUAD -0.061; TCGA LUSC -0.098; TCGA SARC -0.098; TCGA STAD -0.078; TCGA UCEC -0.062
hsa-miR-330-3p
ULK1
9 cancers: CESC; ESCA; HNSC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA CESC -0.095; TCGA ESCA -0.187; TCGA HNSC -0.117; TCGA KIRP -0.082; TCGA LUAD -0.144; TCGA PRAD -0.091; TCGA SARC -0.113; TCGA STAD -0.129; TCGA UCEC -0.053
hsa-miR-330-3p
WDR90
10 cancers: CESC; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; THCA
miRNATAP
TCGA CESC -0.076; TCGA HNSC -0.079; TCGA KIRP -0.208; TCGA LGG -0.123; TCGA LUAD -0.329; TCGA OV -0.113; TCGA PAAD -0.127; TCGA PRAD -0.189; TCGA SARC -0.145; TCGA THCA -0.117
hsa-miR-330-3p
BFSP1
9 cancers: HNSC; KIRC; KIRP; LUSC; OV; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.235; TCGA KIRC -0.163; TCGA KIRP -0.406; TCGA LUSC -0.351; TCGA OV -0.183; TCGA PAAD -0.183; TCGA SARC -0.128; TCGA STAD -0.159; TCGA UCEC -0.101





Enriched cancer pathways of putative targets