microRNA information: hsa-miR-339-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-339-3p | miRbase |
| Accession: | MIMAT0004702 | miRbase |
| Precursor name: | hsa-mir-339 | miRbase |
| Precursor accession: | MI0000815 | miRbase |
| Symbol: | MIR339 | HGNC |
| RefSeq ID: | NR_029898 | GenBank |
| Sequence: | UGAGCGCCUCGACGACAGAGCCG |
Reported expression in cancers: hsa-miR-339-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-339-3p | acute myeloid leukemia | deregulation | "TaqMan miRNA microarray was performed to identify ......" | 23391324 | Microarray; qPCR |
| hsa-miR-339-3p | colorectal cancer | downregulation | "miR 339 3p inhibits proliferation and metastasis o ......" | 26722251 | qPCR |
Reported cancer pathway affected by hsa-miR-339-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-339-3p | colorectal cancer | p53 signaling pathway | "MicroRNA 339 5p inhibits colorectal tumorigenesis ......" | 25193859 |
Reported cancer prognosis affected by hsa-miR-339-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-339-3p | B cell lymphoma | poor survival | "Comprehensive miRNA sequence analysis reveals surv ......" | 25723320 | |
| hsa-miR-339-3p | breast cancer | worse prognosis; cell migration | "MiR 339 5p inhibits breast cancer cell migration a ......" | 20932331 | |
| hsa-miR-339-3p | colorectal cancer | metastasis | "MiR 339 5p regulates the growth colony formation a ......" | 23696794 | Colony formation |
| hsa-miR-339-3p | colorectal cancer | tumorigenesis | "MicroRNA 339 5p inhibits colorectal tumorigenesis ......" | 25193859 | |
| hsa-miR-339-3p | colorectal cancer | metastasis; differentiation | "miR 339 3p inhibits proliferation and metastasis o ......" | 26722251 | |
| hsa-miR-339-3p | liver cancer | worse prognosis | "Effects of miR 339 5p on invasion and prognosis of ......" | 26186881 | |
| hsa-miR-339-3p | lung squamous cell cancer | staging; metastasis; cell migration | "miR 339 5p inhibits cell migration and invasion in ......" | 25009651 | |
| hsa-miR-339-3p | melanoma | poor survival | "miR 339 3p Is a Tumor Suppressor in Melanoma; Here ......" | 27197185 | RNAi |
| hsa-miR-339-3p | ovarian cancer | drug resistance | "Of these 10 miRNAs miR-193a-5p miR-375 miR-339-3p ......" | 26485143 |
Reported gene related to hsa-miR-339-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-339-3p | breast cancer | BCL6 | "Prolactin Inhibits BCL6 Expression in Breast Cance ......" | 27066093 |
| hsa-miR-339-3p | ovarian cancer | BCL6 | "miR 339 5p inhibits migration and invasion in ovar ......" | 26553360 |
| hsa-miR-339-3p | breast cancer | PRL | "Prolactin Inhibits BCL6 Expression in Breast Cance ......" | 27066093 |
| hsa-miR-339-3p | colorectal cancer | PRL | "MiR 339 5p regulates the growth colony formation a ......" | 23696794 |
| hsa-miR-339-3p | colorectal cancer | PTP4A1 | "In addition the present study demonstrated that un ......" | 26722251 |
| hsa-miR-339-3p | colorectal cancer | PTP4A1 | "MiR 339 5p regulates the growth colony formation a ......" | 23696794 |
| hsa-miR-339-3p | colorectal cancer | DNMT3B | "MiR-339 and miR-766 have been predicted to target ......" | 27668319 |
| hsa-miR-339-3p | melanoma | MCL1 | "MCL1 was defined as a target for downregulation by ......" | 27197185 |
| hsa-miR-339-3p | ovarian cancer | NACC1 | "miR 339 5p inhibits migration and invasion in ovar ......" | 26553360 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-339-3p | LTBP3 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.245; TCGA BRCA -0.364; TCGA COAD -0.293; TCGA ESCA -0.205; TCGA KIRP -0.362; TCGA LGG -0.145; TCGA SARC -0.183; TCGA THCA -0.181; TCGA STAD -0.243 |
hsa-miR-339-3p | SPEG | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.864; TCGA BRCA -0.274; TCGA COAD -0.777; TCGA ESCA -0.962; TCGA HNSC -0.37; TCGA KIRP -0.262; TCGA LUAD -0.322; TCGA SARC -0.865; TCGA THCA -0.227; TCGA STAD -1.124; TCGA UCEC -0.448 |
hsa-miR-339-3p | USP25 | 9 cancers: CESC; ESCA; KIRC; KIRP; LIHC; PAAD; SARC; STAD; UCEC | PITA; miRNATAP | TCGA CESC -0.115; TCGA ESCA -0.165; TCGA KIRC -0.106; TCGA KIRP -0.13; TCGA LIHC -0.089; TCGA PAAD -0.146; TCGA SARC -0.127; TCGA STAD -0.215; TCGA UCEC -0.158 |
Enriched cancer pathways of putative targets