microRNA information: hsa-miR-33a-5p

SectionIDlink
Mature name: hsa-miR-33a-5pmiRbase
Accession: MIMAT0000091miRbase
Precursor name: hsa-mir-33a miRbase
Precursor accession: MI0000091miRbase
Symbol: MIR33AHGNC
RefSeq ID: NR_029507GenBank
Sequence: GUGCAUUGUAGUUGCAUUGCA



Reported expression in cancers: hsa-miR-33a-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-33a-5p

bladder cancerupregulation"Samples were analyzed with a miRNA array containin ......"22863868Microarray
hsa-miR-33a-5p

breast cancerdownregulation"Although miR-33a was recently reported to play an ......"26507842
hsa-miR-33a-5p

liver cancerderegulation"In this study we investigated whether miR-33a down ......"27460728qPCR
hsa-miR-33a-5p

lung cancerdownregulation"The changes of EMT-related proteins were analyzed ......"22325218Microarray; qPCR
hsa-miR-33a-5p

sarcomadownregulation"In the present study high-throughput deep sequenci ......"26622808RNA-Seq; Reverse transcription PCR



Reported cancer pathway affected by hsa-miR-33a-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-33a-5p

lung cancercell cycle pathway"TFAP2C promotes lung tumorigenesis and aggressiven ......"27593936
hsa-miR-33a-5p

pancreatic cancerApoptosis pathway"miR 33a suppresses the nuclear translocation of β ......"26113407
hsa-miR-33a-5p

sarcomaApoptosis pathway"miR 33a is up regulated in chemoresistant osteosar ......"24468065Luciferase



Reported cancer prognosis affected by hsa-miR-33a-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-33a-5p

B cell lymphomastaging; drug resistance"In the discovery phase real-time polymerase chain ......"24858372
hsa-miR-33a-5p

bladder cancerstaging"Samples were analyzed with a miRNA array containin ......"22863868
hsa-miR-33a-5p

breast cancermetastasis; progression"MiR 33a suppresses breast cancer cell proliferatio ......"26507842
hsa-miR-33a-5p

breast cancerpoor survival"MiR 33a Decreases High Density Lipoprotein Induced ......"27055396
hsa-miR-33a-5p

liver cancermalignant trasformation"Using gene expression microarrays and high-through ......"26646011
hsa-miR-33a-5p

liver cancercell migration"MicroRNA 33a 3p suppresses cell migration and inva ......"27285759
hsa-miR-33a-5p

lung cancermetastasis; worse prognosis"MicroRNA 33a functions as a bone metastasis suppre ......"23458685Luciferase
hsa-miR-33a-5p

lung cancertumorigenesis"TFAP2C promotes lung tumorigenesis and aggressiven ......"27593936
hsa-miR-33a-5p

melanomametastasis; tumorigenesis"miR 33a functions as a tumor suppressor in melanom ......"25891797
hsa-miR-33a-5p

pancreatic cancerpoor survival; drug resistance"MicroRNA 33a mediated downregulation of Pim 3 kina ......"25971209
hsa-miR-33a-5p

pancreatic cancerdrug resistance"miR 33a suppresses the nuclear translocation of β ......"26113407
hsa-miR-33a-5p

sarcomadrug resistance; staging"miR 33a is up regulated in chemoresistant osteosar ......"24468065Luciferase



Reported gene related to hsa-miR-33a-5p

miRNAcancergenereportingPUBMED
hsa-miR-33a-5p

cervical and endocervical cancerTWIST1"MicroRNA 33a regulates the invasion of cervical ca ......"26541838
hsa-miR-33a-5p

liver cancerTWIST1"Then we further studied the regulative effects of ......"27460728
hsa-miR-33a-5p

sarcomaTWIST1"In Saos-2 cells treated with cisplatin inhibition ......"24468065
hsa-miR-33a-5p

breast cancerADAM9"MiR 33a suppresses breast cancer cell proliferatio ......"26507842
hsa-miR-33a-5p

liver cancerCDH1"Both HepG2 and BEL-7402 cells with miR-33a overexp ......"27460728
hsa-miR-33a-5p

liver cancerCDH2"Both HepG2 and BEL-7402 cells with miR-33a overexp ......"27460728
hsa-miR-33a-5p

pancreatic cancerGEM"Moreover gemcitabine GEM treatment enhanced β-cat ......"26113407
hsa-miR-33a-5p

breast cancerHSD11B1"We hypothesized that variations in miR-33a express ......"27055396
hsa-miR-33a-5p

pancreatic cancerLITAF"Hence detection of plasma miR-33a may be a simple ......"25971209
hsa-miR-33a-5p

liver cancerPBX3"MicroRNA 33a 3p suppresses cell migration and inva ......"27285759
hsa-miR-33a-5p

pancreatic cancerPIM1"MicroRNA 33a mediated downregulation of Pim 3 kina ......"25971209
hsa-miR-33a-5p

pancreatic cancerPIM3"MicroRNA 33a mediated downregulation of Pim 3 kina ......"25971209
hsa-miR-33a-5p

lung cancerPTH"MicroRNA 33a functions as a bone metastasis suppre ......"23458685
hsa-miR-33a-5p

lung cancerPTHLH"We have found that miR-33a which is downregulated ......"23458685
hsa-miR-33a-5p

breast cancerROS1"MiR 33a suppresses breast cancer cell proliferatio ......"26507842
hsa-miR-33a-5p

lung cancerTFAP2C"TFAP2C promotes lung tumorigenesis and aggressiven ......"27593936
hsa-miR-33a-5p

lung cancerTNFRSF11B"miR-33a overexpression also reduces the inhibitory ......"23458685



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-33a-5p
ABCA1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.103; TCGA BRCA -0.082; TCGA CESC -0.209; TCGA COAD -0.212; TCGA ESCA -0.134; TCGA HNSC -0.179; TCGA KIRC -0.303; TCGA KIRP -0.091; TCGA LGG -0.221; TCGA LUAD -0.168; TCGA LUSC -0.121; TCGA PAAD -0.285; TCGA PRAD -0.072; TCGA THCA -0.232; TCGA STAD -0.168; TCGA UCEC -0.144
hsa-miR-33a-5p
AKAP11
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.056; TCGA BRCA -0.052; TCGA CESC -0.121; TCGA ESCA -0.131; TCGA HNSC -0.064; TCGA LIHC -0.078; TCGA LUAD -0.097; TCGA LUSC -0.113; TCGA PRAD -0.09; TCGA STAD -0.102; TCGA UCEC -0.119
hsa-miR-33a-5p
ANKRD29
11 cancers: BLCA; BRCA; COAD; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.584; TCGA BRCA -0.321; TCGA COAD -0.29; TCGA KIRP -0.178; TCGA LIHC -0.219; TCGA LUAD -0.228; TCGA LUSC -0.294; TCGA PRAD -0.1; TCGA SARC -0.293; TCGA STAD -0.236; TCGA UCEC -0.257
hsa-miR-33a-5p
CRY2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.158; TCGA BRCA -0.178; TCGA CESC -0.077; TCGA ESCA -0.133; TCGA HNSC -0.146; TCGA LUAD -0.088; TCGA LUSC -0.169; TCGA SARC -0.136; TCGA THCA -0.072; TCGA STAD -0.109; TCGA UCEC -0.09
hsa-miR-33a-5p
FBXO30
10 cancers: BLCA; COAD; ESCA; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.078; TCGA COAD -0.061; TCGA ESCA -0.09; TCGA LGG -0.092; TCGA PAAD -0.12; TCGA PRAD -0.086; TCGA SARC -0.109; TCGA THCA -0.091; TCGA STAD -0.183; TCGA UCEC -0.087
hsa-miR-33a-5p
FOXP1
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.108; TCGA BRCA -0.088; TCGA ESCA -0.231; TCGA HNSC -0.15; TCGA LUAD -0.118; TCGA LUSC -0.24; TCGA SARC -0.097; TCGA STAD -0.111; TCGA UCEC -0.093
hsa-miR-33a-5p
KLF9
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.414; TCGA BRCA -0.183; TCGA CESC -0.112; TCGA COAD -0.217; TCGA ESCA -0.414; TCGA HNSC -0.189; TCGA LUAD -0.158; TCGA LUSC -0.347; TCGA PAAD -0.197; TCGA SARC -0.18; TCGA STAD -0.292; TCGA UCEC -0.227
hsa-miR-33a-5p
PTHLH
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.23; TCGA BRCA -0.212; TCGA COAD -0.407; TCGA KIRC -0.636; TCGA LIHC -0.239; TCGA PAAD -0.4; TCGA PRAD -0.083; TCGA THCA -0.103; TCGA STAD -0.194
hsa-miR-33a-5p
RUNDC3B
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.18; TCGA BRCA -0.259; TCGA CESC -0.337; TCGA ESCA -0.399; TCGA HNSC -0.143; TCGA KIRP -0.2; TCGA LUAD -0.134; TCGA LUSC -0.3; TCGA PRAD -0.107; TCGA SARC -0.132; TCGA STAD -0.239; TCGA UCEC -0.263
hsa-miR-33a-5p
TRIM23
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.05; TCGA BRCA -0.07; TCGA CESC -0.087; TCGA COAD -0.068; TCGA ESCA -0.068; TCGA HNSC -0.079; TCGA LUAD -0.068; TCGA LUSC -0.099; TCGA PAAD -0.094; TCGA PRAD -0.065; TCGA SARC -0.067; TCGA STAD -0.137; TCGA UCEC -0.116
hsa-miR-33a-5p
CACNA1C
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.457; TCGA BRCA -0.183; TCGA CESC -0.421; TCGA COAD -0.192; TCGA ESCA -0.507; TCGA HNSC -0.252; TCGA KIRC -0.134; TCGA LIHC -0.278; TCGA LUAD -0.185; TCGA LUSC -0.407; TCGA PRAD -0.169; TCGA SARC -0.229; TCGA STAD -0.401; TCGA UCEC -0.289
hsa-miR-33a-5p
MLXIP
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.128; TCGA CESC -0.096; TCGA ESCA -0.133; TCGA HNSC -0.084; TCGA LUAD -0.091; TCGA LUSC -0.068; TCGA SARC -0.086; TCGA THCA -0.117; TCGA STAD -0.063
hsa-miR-33a-5p
MMP16
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.26; TCGA BRCA -0.157; TCGA CESC -0.271; TCGA COAD -0.326; TCGA ESCA -0.392; TCGA HNSC -0.384; TCGA KIRC -0.283; TCGA LIHC -0.211; TCGA LUSC -0.243; TCGA PAAD -0.468; TCGA PRAD -0.19; TCGA STAD -0.324; TCGA UCEC -0.194
hsa-miR-33a-5p
PCDH18
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.297; TCGA BRCA -0.16; TCGA CESC -0.323; TCGA COAD -0.22; TCGA ESCA -0.36; TCGA HNSC -0.336; TCGA LGG -0.112; TCGA LIHC -0.118; TCGA LUAD -0.137; TCGA LUSC -0.209; TCGA PAAD -0.439; TCGA PRAD -0.175; TCGA STAD -0.171; TCGA UCEC -0.138
hsa-miR-33a-5p
CCL5
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC
MirTarget
TCGA BLCA -0.27; TCGA CESC -0.184; TCGA COAD -0.204; TCGA ESCA -0.196; TCGA HNSC -0.229; TCGA KIRC -0.398; TCGA LUAD -0.107; TCGA LUSC -0.438; TCGA PAAD -0.297; TCGA PRAD -0.075; TCGA SARC -0.294
hsa-miR-33a-5p
FAM46C
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC
MirTarget
TCGA BLCA -0.19; TCGA BRCA -0.083; TCGA CESC -0.259; TCGA ESCA -0.369; TCGA HNSC -0.187; TCGA LGG -0.185; TCGA LUAD -0.13; TCGA LUSC -0.416; TCGA PRAD -0.092; TCGA SARC -0.205
hsa-miR-33a-5p
RIC3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.397; TCGA BRCA -0.258; TCGA CESC -0.242; TCGA COAD -0.651; TCGA HNSC -0.202; TCGA KIRP -0.172; TCGA LUSC -0.256; TCGA PRAD -0.075; TCGA THCA -0.069; TCGA STAD -0.429; TCGA UCEC -0.259
hsa-miR-33a-5p
SETD7
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.105; TCGA BRCA -0.063; TCGA ESCA -0.068; TCGA HNSC -0.09; TCGA KIRC -0.134; TCGA LUAD -0.083; TCGA LUSC -0.055; TCGA PAAD -0.188; TCGA SARC -0.124; TCGA STAD -0.151; TCGA UCEC -0.158
hsa-miR-33a-5p
PAM
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.196; TCGA CESC -0.154; TCGA COAD -0.208; TCGA ESCA -0.18; TCGA HNSC -0.177; TCGA KIRC -0.14; TCGA LIHC -0.21; TCGA LUSC -0.18; TCGA PAAD -0.164; TCGA PRAD -0.113; TCGA SARC -0.093; TCGA STAD -0.191; TCGA UCEC -0.084
hsa-miR-33a-5p
SAMD4A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.338; TCGA BRCA -0.104; TCGA CESC -0.207; TCGA COAD -0.249; TCGA ESCA -0.391; TCGA HNSC -0.219; TCGA KIRC -0.074; TCGA LGG -0.108; TCGA LUAD -0.099; TCGA LUSC -0.393; TCGA PAAD -0.303; TCGA PRAD -0.091; TCGA SARC -0.164; TCGA STAD -0.298; TCGA UCEC -0.193
hsa-miR-33a-5p
VCAN
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; SARC; STAD
MirTarget
TCGA BLCA -0.363; TCGA CESC -0.327; TCGA COAD -0.351; TCGA ESCA -0.286; TCGA HNSC -0.349; TCGA KIRC -0.409; TCGA KIRP -0.545; TCGA LGG -0.147; TCGA LIHC -0.334; TCGA LUSC -0.195; TCGA PAAD -0.58; TCGA SARC -0.139; TCGA STAD -0.107
hsa-miR-33a-5p
IRS1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.105; TCGA BRCA -0.199; TCGA COAD -0.122; TCGA ESCA -0.109; TCGA HNSC -0.228; TCGA LUAD -0.098; TCGA PAAD -0.206; TCGA PRAD -0.105; TCGA SARC -0.145; TCGA THCA -0.132; TCGA STAD -0.102; TCGA UCEC -0.168
hsa-miR-33a-5p
SNRK
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.07; TCGA CESC -0.094; TCGA COAD -0.096; TCGA ESCA -0.187; TCGA HNSC -0.065; TCGA LUAD -0.143; TCGA LUSC -0.187; TCGA PAAD -0.099; TCGA SARC -0.081; TCGA THCA -0.07; TCGA STAD -0.117; TCGA UCEC -0.121
hsa-miR-33a-5p
B3GALT2
9 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.322; TCGA BRCA -0.144; TCGA HNSC -0.163; TCGA LIHC -0.206; TCGA LUAD -0.232; TCGA LUSC -0.348; TCGA PRAD -0.28; TCGA SARC -0.333; TCGA STAD -0.107
hsa-miR-33a-5p
PRICKLE2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.39; TCGA BRCA -0.203; TCGA CESC -0.209; TCGA COAD -0.316; TCGA ESCA -0.356; TCGA HNSC -0.135; TCGA LUAD -0.148; TCGA LUSC -0.303; TCGA PAAD -0.363; TCGA PRAD -0.187; TCGA SARC -0.115; TCGA THCA -0.104; TCGA STAD -0.425; TCGA UCEC -0.264
hsa-miR-33a-5p
SSBP2
11 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.148; TCGA BRCA -0.07; TCGA COAD -0.281; TCGA KIRC -0.066; TCGA LIHC -0.321; TCGA LUAD -0.074; TCGA PAAD -0.117; TCGA PRAD -0.056; TCGA SARC -0.083; TCGA STAD -0.247; TCGA UCEC -0.107
hsa-miR-33a-5p
ARID5B
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.183; TCGA BRCA -0.138; TCGA CESC -0.125; TCGA ESCA -0.123; TCGA HNSC -0.087; TCGA LUAD -0.111; TCGA LUSC -0.061; TCGA PAAD -0.256; TCGA PRAD -0.06; TCGA SARC -0.101; TCGA THCA -0.139; TCGA STAD -0.116; TCGA UCEC -0.147
hsa-miR-33a-5p
CPEB3
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.115; TCGA BRCA -0.098; TCGA CESC -0.133; TCGA ESCA -0.128; TCGA HNSC -0.085; TCGA LUAD -0.132; TCGA LUSC -0.161; TCGA SARC -0.093; TCGA STAD -0.086; TCGA UCEC -0.118
hsa-miR-33a-5p
GRIA3
9 cancers: BLCA; BRCA; CESC; HNSC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.434; TCGA BRCA -0.164; TCGA CESC -0.227; TCGA HNSC -0.191; TCGA LUSC -0.179; TCGA PRAD -0.221; TCGA SARC -0.37; TCGA STAD -0.208; TCGA UCEC -0.204
hsa-miR-33a-5p
TRPC6
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.12; TCGA BRCA -0.111; TCGA CESC -0.291; TCGA COAD -0.298; TCGA ESCA -0.386; TCGA HNSC -0.076; TCGA LIHC -0.275; TCGA LUAD -0.213; TCGA LUSC -0.336; TCGA PAAD -0.299; TCGA PRAD -0.186; TCGA THCA -0.108; TCGA STAD -0.136; TCGA UCEC -0.114
hsa-miR-33a-5p
PDGFRA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.397; TCGA BRCA -0.153; TCGA CESC -0.401; TCGA COAD -0.272; TCGA ESCA -0.387; TCGA HNSC -0.295; TCGA LUAD -0.207; TCGA LUSC -0.334; TCGA PAAD -0.511; TCGA PRAD -0.177; TCGA STAD -0.114; TCGA UCEC -0.178
hsa-miR-33a-5p
SDC3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.19; TCGA BRCA -0.065; TCGA CESC -0.162; TCGA COAD -0.103; TCGA ESCA -0.125; TCGA HNSC -0.199; TCGA KIRC -0.139; TCGA KIRP -0.119; TCGA LIHC -0.093; TCGA LUSC -0.179; TCGA PAAD -0.114; TCGA PRAD -0.059; TCGA STAD -0.18
hsa-miR-33a-5p
CAMK4
9 cancers: BLCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.172; TCGA COAD -0.229; TCGA HNSC -0.146; TCGA KIRC -0.142; TCGA LUAD -0.095; TCGA LUSC -0.136; TCGA PAAD -0.25; TCGA PRAD -0.162; TCGA STAD -0.12
hsa-miR-33a-5p
DYRK3
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.164; TCGA CESC -0.086; TCGA COAD -0.167; TCGA HNSC -0.058; TCGA KIRC -0.131; TCGA LIHC -0.116; TCGA LUSC -0.214; TCGA PAAD -0.09; TCGA PRAD -0.077; TCGA THCA -0.093; TCGA STAD -0.064; TCGA UCEC -0.142
hsa-miR-33a-5p
EGFLAM
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.109; TCGA BRCA -0.177; TCGA CESC -0.21; TCGA COAD -0.164; TCGA ESCA -0.153; TCGA HNSC -0.132; TCGA KIRC -0.131; TCGA PAAD -0.206; TCGA PRAD -0.105; TCGA STAD -0.099
hsa-miR-33a-5p
BACH1
10 cancers: BLCA; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget
TCGA BLCA -0.055; TCGA COAD -0.065; TCGA HNSC -0.112; TCGA KIRC -0.086; TCGA LGG -0.07; TCGA LUAD -0.067; TCGA LUSC -0.086; TCGA PAAD -0.137; TCGA PRAD -0.07; TCGA UCEC -0.117
hsa-miR-33a-5p
CCL18
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD
MirTarget
TCGA BLCA -0.384; TCGA COAD -0.529; TCGA ESCA -0.391; TCGA HNSC -0.298; TCGA KIRC -0.617; TCGA KIRP -0.719; TCGA LGG -0.208; TCGA LUSC -0.461; TCGA PAAD -0.438
hsa-miR-33a-5p
PTGFRN
9 cancers: BLCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.09; TCGA HNSC -0.066; TCGA KIRC -0.105; TCGA KIRP -0.23; TCGA PAAD -0.28; TCGA PRAD -0.072; TCGA SARC -0.211; TCGA THCA -0.052; TCGA STAD -0.112
hsa-miR-33a-5p
STON1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.411; TCGA BRCA -0.071; TCGA CESC -0.173; TCGA COAD -0.467; TCGA ESCA -0.304; TCGA HNSC -0.095; TCGA LGG -0.226; TCGA LIHC -0.264; TCGA LUAD -0.178; TCGA LUSC -0.086; TCGA PAAD -0.481; TCGA PRAD -0.121; TCGA SARC -0.14; TCGA THCA -0.223; TCGA UCEC -0.314
hsa-miR-33a-5p
CDON
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.287; TCGA BRCA -0.145; TCGA CESC -0.15; TCGA COAD -0.167; TCGA ESCA -0.25; TCGA KIRC -0.302; TCGA LGG -0.092; TCGA LUAD -0.085; TCGA PAAD -0.284; TCGA THCA -0.215; TCGA STAD -0.363; TCGA UCEC -0.162
hsa-miR-33a-5p
RORA
10 cancers: BLCA; BRCA; COAD; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.176; TCGA BRCA -0.091; TCGA COAD -0.261; TCGA KIRC -0.162; TCGA LUAD -0.159; TCGA PAAD -0.217; TCGA PRAD -0.052; TCGA SARC -0.094; TCGA STAD -0.228; TCGA UCEC -0.162
hsa-miR-33a-5p
ST6GAL1
9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.268; TCGA CESC -0.246; TCGA ESCA -0.213; TCGA HNSC -0.19; TCGA LUSC -0.279; TCGA PRAD -0.119; TCGA SARC -0.244; TCGA THCA -0.173; TCGA UCEC -0.117
hsa-miR-33a-5p
ACACB
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.355; TCGA BRCA -0.371; TCGA CESC -0.101; TCGA ESCA -0.423; TCGA HNSC -0.139; TCGA LUAD -0.141; TCGA LUSC -0.221; TCGA PRAD -0.098; TCGA SARC -0.149; TCGA THCA -0.098; TCGA STAD -0.245
hsa-miR-33a-5p
ITGA8
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.495; TCGA BRCA -0.214; TCGA CESC -0.491; TCGA COAD -0.317; TCGA ESCA -0.93; TCGA HNSC -0.305; TCGA LIHC -0.322; TCGA LUAD -0.363; TCGA LUSC -0.773; TCGA PAAD -0.464; TCGA PRAD -0.276; TCGA SARC -0.344; TCGA STAD -0.3; TCGA UCEC -0.27
hsa-miR-33a-5p
PGR
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.396; TCGA BRCA -0.502; TCGA CESC -0.555; TCGA COAD -0.509; TCGA ESCA -0.614; TCGA HNSC -0.444; TCGA LIHC -0.273; TCGA LUAD -0.259; TCGA LUSC -0.58; TCGA PAAD -0.423; TCGA PRAD -0.247; TCGA SARC -0.371; TCGA STAD -0.468; TCGA UCEC -0.217
hsa-miR-33a-5p
IRAK3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.264; TCGA BRCA -0.157; TCGA COAD -0.239; TCGA ESCA -0.374; TCGA HNSC -0.158; TCGA KIRC -0.181; TCGA LIHC -0.168; TCGA LUAD -0.129; TCGA LUSC -0.418; TCGA PAAD -0.242; TCGA PRAD -0.165; TCGA STAD -0.102; TCGA UCEC -0.234
hsa-miR-33a-5p
KLHL4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.453; TCGA BRCA -0.196; TCGA COAD -0.493; TCGA ESCA -0.254; TCGA HNSC -0.338; TCGA LIHC -0.128; TCGA LUAD -0.236; TCGA LUSC -0.431; TCGA PAAD -0.57; TCGA PRAD -0.172; TCGA STAD -0.439; TCGA UCEC -0.317
hsa-miR-33a-5p
KANK1
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.1; TCGA BRCA -0.065; TCGA ESCA -0.128; TCGA HNSC -0.12; TCGA LUAD -0.089; TCGA PRAD -0.107; TCGA SARC -0.236; TCGA STAD -0.124; TCGA UCEC -0.104
hsa-miR-33a-5p
ASPA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.492; TCGA BRCA -0.371; TCGA CESC -0.466; TCGA COAD -0.43; TCGA ESCA -0.726; TCGA LUAD -0.307; TCGA LUSC -0.67; TCGA PAAD -0.405; TCGA PRAD -0.312; TCGA SARC -0.486; TCGA STAD -0.315; TCGA UCEC -0.239
hsa-miR-33a-5p
PPARGC1A
10 cancers: BLCA; BRCA; ESCA; HNSC; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.477; TCGA BRCA -0.102; TCGA ESCA -0.312; TCGA HNSC -0.455; TCGA LUSC -0.255; TCGA PRAD -0.273; TCGA SARC -0.524; TCGA THCA -0.151; TCGA STAD -0.214; TCGA UCEC -0.317
hsa-miR-33a-5p
TSPAN11
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.334; TCGA BRCA -0.197; TCGA CESC -0.229; TCGA COAD -0.273; TCGA ESCA -0.379; TCGA HNSC -0.255; TCGA LUAD -0.175; TCGA LUSC -0.353; TCGA PAAD -0.294; TCGA PRAD -0.189; TCGA STAD -0.17
hsa-miR-33a-5p
EYA4
9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.255; TCGA BRCA -0.157; TCGA COAD -0.353; TCGA HNSC -0.323; TCGA LUAD -0.167; TCGA LUSC -0.314; TCGA PAAD -0.493; TCGA PRAD -0.221; TCGA STAD -0.252
hsa-miR-33a-5p
CHST3
9 cancers: BLCA; COAD; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.212; TCGA COAD -0.314; TCGA HNSC -0.058; TCGA KIRP -0.099; TCGA LIHC -0.147; TCGA LUAD -0.149; TCGA PAAD -0.256; TCGA PRAD -0.139; TCGA STAD -0.218
hsa-miR-33a-5p
ZNF831
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.42; TCGA BRCA -0.133; TCGA CESC -0.304; TCGA COAD -0.324; TCGA ESCA -0.444; TCGA HNSC -0.267; TCGA KIRC -0.361; TCGA LUAD -0.152; TCGA LUSC -0.525; TCGA PAAD -0.304; TCGA PRAD -0.125; TCGA SARC -0.299; TCGA UCEC -0.15
hsa-miR-33a-5p
GIMAP6
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.302; TCGA BRCA -0.166; TCGA CESC -0.354; TCGA COAD -0.323; TCGA ESCA -0.396; TCGA HNSC -0.299; TCGA KIRC -0.121; TCGA LIHC -0.149; TCGA LUAD -0.202; TCGA LUSC -0.556; TCGA PAAD -0.285; TCGA PRAD -0.084; TCGA SARC -0.154; TCGA STAD -0.136; TCGA UCEC -0.271
hsa-miR-33a-5p
TMTC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.234; TCGA BRCA -0.219; TCGA CESC -0.214; TCGA COAD -0.378; TCGA ESCA -0.212; TCGA HNSC -0.12; TCGA LIHC -0.113; TCGA LUAD -0.193; TCGA PAAD -0.264; TCGA PRAD -0.163; TCGA STAD -0.355; TCGA UCEC -0.127
hsa-miR-33a-5p
IL6ST
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.242; TCGA BRCA -0.214; TCGA CESC -0.219; TCGA COAD -0.262; TCGA ESCA -0.323; TCGA HNSC -0.257; TCGA LUAD -0.275; TCGA LUSC -0.368; TCGA PAAD -0.334; TCGA PRAD -0.167; TCGA SARC -0.27; TCGA THCA -0.168; TCGA STAD -0.205; TCGA UCEC -0.146
hsa-miR-33a-5p
FAM129A
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.469; TCGA BRCA -0.175; TCGA COAD -0.404; TCGA ESCA -0.274; TCGA KIRC -0.123; TCGA LIHC -0.271; TCGA LUAD -0.134; TCGA PAAD -0.277; TCGA PRAD -0.091; TCGA SARC -0.365; TCGA STAD -0.404; TCGA UCEC -0.147
hsa-miR-33a-5p
DRAM1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.186; TCGA CESC -0.177; TCGA COAD -0.133; TCGA ESCA -0.178; TCGA HNSC -0.152; TCGA KIRC -0.163; TCGA KIRP -0.1; TCGA LUAD -0.169; TCGA LUSC -0.465; TCGA PAAD -0.186; TCGA PRAD -0.097; TCGA SARC -0.114
hsa-miR-33a-5p
ENTPD1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.233; TCGA CESC -0.144; TCGA COAD -0.173; TCGA ESCA -0.293; TCGA HNSC -0.102; TCGA KIRC -0.14; TCGA LIHC -0.145; TCGA LUAD -0.074; TCGA LUSC -0.231; TCGA PAAD -0.239; TCGA SARC -0.202; TCGA THCA -0.09; TCGA STAD -0.177; TCGA UCEC -0.147
hsa-miR-33a-5p
ASXL3
9 cancers: BLCA; BRCA; CESC; ESCA; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.317; TCGA BRCA -0.266; TCGA CESC -0.342; TCGA ESCA -0.349; TCGA LUSC -0.437; TCGA PRAD -0.228; TCGA THCA -0.266; TCGA STAD -0.284; TCGA UCEC -0.214
hsa-miR-33a-5p
RGS5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.323; TCGA BRCA -0.173; TCGA CESC -0.289; TCGA COAD -0.266; TCGA ESCA -0.502; TCGA HNSC -0.186; TCGA KIRC -0.436; TCGA LIHC -0.147; TCGA LUAD -0.217; TCGA LUSC -0.394; TCGA PAAD -0.16; TCGA STAD -0.298; TCGA UCEC -0.259
hsa-miR-33a-5p
OSBPL10
9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LIHC; LUSC; PRAD; SARC
mirMAP
TCGA BLCA -0.193; TCGA CESC -0.092; TCGA COAD -0.054; TCGA ESCA -0.192; TCGA KIRP -0.133; TCGA LIHC -0.12; TCGA LUSC -0.098; TCGA PRAD -0.117; TCGA SARC -0.248
hsa-miR-33a-5p
ITGA9
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.285; TCGA BRCA -0.101; TCGA CESC -0.404; TCGA COAD -0.221; TCGA ESCA -0.603; TCGA HNSC -0.365; TCGA LUAD -0.22; TCGA LUSC -0.495; TCGA PAAD -0.369; TCGA PRAD -0.215; TCGA SARC -0.105; TCGA THCA -0.091; TCGA STAD -0.296; TCGA UCEC -0.194
hsa-miR-33a-5p
PTPRG
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.113; TCGA BRCA -0.094; TCGA CESC -0.3; TCGA COAD -0.051; TCGA ESCA -0.303; TCGA HNSC -0.159; TCGA LIHC -0.2; TCGA LUAD -0.186; TCGA LUSC -0.17; TCGA PAAD -0.198; TCGA PRAD -0.089; TCGA THCA -0.112; TCGA STAD -0.088
hsa-miR-33a-5p
NTRK2
9 cancers: BLCA; BRCA; COAD; LUAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.447; TCGA BRCA -0.33; TCGA COAD -0.44; TCGA LUAD -0.163; TCGA PRAD -0.199; TCGA SARC -0.297; TCGA THCA -0.077; TCGA STAD -0.346; TCGA UCEC -0.3
hsa-miR-33a-5p
SCN2B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.616; TCGA BRCA -0.583; TCGA CESC -0.221; TCGA COAD -0.634; TCGA ESCA -0.392; TCGA HNSC -0.517; TCGA LUAD -0.321; TCGA LUSC -0.57; TCGA PAAD -0.602; TCGA PRAD -0.225; TCGA SARC -0.293; TCGA STAD -0.526; TCGA UCEC -0.272
hsa-miR-33a-5p
DLG2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.379; TCGA BRCA -0.214; TCGA CESC -0.296; TCGA COAD -0.512; TCGA ESCA -0.422; TCGA HNSC -0.27; TCGA LUAD -0.103; TCGA LUSC -0.413; TCGA PAAD -0.426; TCGA SARC -0.228; TCGA STAD -0.452; TCGA UCEC -0.181
hsa-miR-33a-5p
FER
10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.108; TCGA COAD -0.132; TCGA ESCA -0.152; TCGA HNSC -0.077; TCGA LUAD -0.074; TCGA LUSC -0.125; TCGA PAAD -0.172; TCGA PRAD -0.083; TCGA SARC -0.096; TCGA STAD -0.14
hsa-miR-33a-5p
WWC2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.152; TCGA BRCA -0.126; TCGA CESC -0.176; TCGA COAD -0.266; TCGA ESCA -0.163; TCGA HNSC -0.146; TCGA LUAD -0.156; TCGA LUSC -0.432; TCGA PAAD -0.298; TCGA PRAD -0.098; TCGA THCA -0.064; TCGA STAD -0.114; TCGA UCEC -0.117
hsa-miR-33a-5p
GFRA1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.577; TCGA BRCA -0.511; TCGA CESC -0.627; TCGA COAD -0.532; TCGA ESCA -0.6; TCGA HNSC -0.489; TCGA KIRP -0.155; TCGA LUAD -0.3; TCGA LUSC -0.46; TCGA PAAD -0.313; TCGA PRAD -0.224; TCGA STAD -0.492; TCGA UCEC -0.451
hsa-miR-33a-5p
DST
9 cancers: BLCA; BRCA; COAD; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.126; TCGA BRCA -0.176; TCGA COAD -0.132; TCGA LUAD -0.129; TCGA PAAD -0.114; TCGA PRAD -0.121; TCGA SARC -0.128; TCGA STAD -0.236; TCGA UCEC -0.191
hsa-miR-33a-5p
SETBP1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.317; TCGA BRCA -0.174; TCGA CESC -0.229; TCGA COAD -0.333; TCGA HNSC -0.164; TCGA LUAD -0.162; TCGA PAAD -0.156; TCGA PRAD -0.078; TCGA SARC -0.168; TCGA THCA -0.11; TCGA STAD -0.37; TCGA UCEC -0.215
hsa-miR-33a-5p
CCDC50
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.096; TCGA BRCA -0.053; TCGA CESC -0.092; TCGA COAD -0.09; TCGA ESCA -0.091; TCGA HNSC -0.069; TCGA KIRC -0.095; TCGA KIRP -0.082; TCGA LUAD -0.094; TCGA LUSC -0.114; TCGA PAAD -0.137; TCGA STAD -0.176; TCGA UCEC -0.119
hsa-miR-33a-5p
ADAMTS5
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.282; TCGA BRCA -0.193; TCGA CESC -0.415; TCGA COAD -0.182; TCGA ESCA -0.458; TCGA HNSC -0.336; TCGA KIRC -0.122; TCGA LGG -0.163; TCGA LUSC -0.256; TCGA PAAD -0.305; TCGA PRAD -0.163; TCGA THCA -0.101; TCGA STAD -0.152; TCGA UCEC -0.273
hsa-miR-33a-5p
AFF2
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD
mirMAP; miRNATAP
TCGA BLCA -0.148; TCGA BRCA -0.121; TCGA COAD -0.288; TCGA KIRC -0.217; TCGA KIRP -0.148; TCGA LIHC -0.269; TCGA LUAD -0.13; TCGA PAAD -0.286; TCGA PRAD -0.268
hsa-miR-33a-5p
KCNMA1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.557; TCGA BRCA -0.207; TCGA CESC -0.295; TCGA COAD -0.642; TCGA ESCA -0.574; TCGA HNSC -0.266; TCGA KIRC -0.251; TCGA LUAD -0.096; TCGA LUSC -0.305; TCGA PAAD -0.22; TCGA PRAD -0.168; TCGA SARC -0.339; TCGA STAD -0.581; TCGA UCEC -0.229
hsa-miR-33a-5p
FBXO32
10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.292; TCGA COAD -0.219; TCGA ESCA -0.2; TCGA HNSC -0.19; TCGA LIHC -0.139; TCGA PAAD -0.249; TCGA PRAD -0.059; TCGA SARC -0.31; TCGA STAD -0.395; TCGA UCEC -0.225
hsa-miR-33a-5p
ZNF208
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.23; TCGA BRCA -0.142; TCGA CESC -0.431; TCGA COAD -0.355; TCGA ESCA -0.592; TCGA HNSC -0.322; TCGA LUSC -0.373; TCGA PAAD -0.304; TCGA PRAD -0.089; TCGA SARC -0.238; TCGA STAD -0.325; TCGA UCEC -0.191
hsa-miR-33a-5p
NFIA
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.226; TCGA BRCA -0.125; TCGA ESCA -0.166; TCGA HNSC -0.05; TCGA KIRC -0.109; TCGA KIRP -0.08; TCGA LGG -0.112; TCGA LUAD -0.112; TCGA PAAD -0.144; TCGA STAD -0.22
hsa-miR-33a-5p
NFASC
11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.278; TCGA COAD -0.211; TCGA ESCA -0.314; TCGA HNSC -0.171; TCGA LUAD -0.204; TCGA LUSC -0.215; TCGA PRAD -0.141; TCGA SARC -0.505; TCGA THCA -0.115; TCGA STAD -0.458; TCGA UCEC -0.242
hsa-miR-33a-5p
GRIK3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.375; TCGA BRCA -0.336; TCGA CESC -0.223; TCGA COAD -0.292; TCGA ESCA -0.619; TCGA HNSC -0.239; TCGA KIRC -0.791; TCGA PAAD -0.328; TCGA PRAD -0.141; TCGA STAD -0.477
hsa-miR-33a-5p
GALNT10
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.124; TCGA CESC -0.101; TCGA COAD -0.076; TCGA ESCA -0.2; TCGA HNSC -0.118; TCGA LGG -0.089; TCGA LIHC -0.112; TCGA LUAD -0.129; TCGA LUSC -0.271; TCGA PAAD -0.144; TCGA PRAD -0.069; TCGA THCA -0.168
hsa-miR-33a-5p
HSPA12A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.333; TCGA BRCA -0.176; TCGA CESC -0.141; TCGA COAD -0.13; TCGA ESCA -0.178; TCGA HNSC -0.216; TCGA LIHC -0.214; TCGA LUAD -0.143; TCGA LUSC -0.2; TCGA PAAD -0.404; TCGA PRAD -0.095; TCGA STAD -0.295
hsa-miR-33a-5p
SAMD14
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.222; TCGA CESC -0.311; TCGA COAD -0.09; TCGA ESCA -0.27; TCGA HNSC -0.163; TCGA KIRC -0.178; TCGA KIRP -0.104; TCGA LUSC -0.312; TCGA PAAD -0.222; TCGA PRAD -0.099; TCGA STAD -0.07
hsa-miR-33a-5p
DNAJC18
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.161; TCGA BRCA -0.089; TCGA CESC -0.143; TCGA COAD -0.125; TCGA ESCA -0.164; TCGA HNSC -0.108; TCGA LIHC -0.126; TCGA LUSC -0.145; TCGA PAAD -0.155; TCGA PRAD -0.06; TCGA STAD -0.268; TCGA UCEC -0.082
hsa-miR-33a-5p
SGCD
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.648; TCGA BRCA -0.201; TCGA CESC -0.306; TCGA COAD -0.472; TCGA ESCA -0.574; TCGA HNSC -0.59; TCGA LUAD -0.218; TCGA LUSC -0.452; TCGA PAAD -0.544; TCGA SARC -0.174; TCGA STAD -0.376; TCGA UCEC -0.278
hsa-miR-33a-5p
NPTX1
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.318; TCGA BRCA -0.179; TCGA COAD -0.702; TCGA ESCA -0.441; TCGA LIHC -0.289; TCGA LUSC -0.231; TCGA PAAD -0.35; TCGA PRAD -0.09; TCGA STAD -0.647
hsa-miR-33a-5p
DSEL
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.211; TCGA BRCA -0.179; TCGA COAD -0.367; TCGA ESCA -0.167; TCGA HNSC -0.247; TCGA LUAD -0.175; TCGA LUSC -0.21; TCGA PAAD -0.326; TCGA STAD -0.28
hsa-miR-33a-5p
BCL2
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.197; TCGA BRCA -0.202; TCGA COAD -0.129; TCGA KIRC -0.157; TCGA KIRP -0.126; TCGA LIHC -0.11; TCGA LUAD -0.098; TCGA PAAD -0.243; TCGA PRAD -0.118; TCGA THCA -0.104; TCGA STAD -0.187; TCGA UCEC -0.138
hsa-miR-33a-5p
IL16
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.336; TCGA BRCA -0.126; TCGA CESC -0.231; TCGA COAD -0.194; TCGA ESCA -0.233; TCGA HNSC -0.202; TCGA KIRC -0.261; TCGA LGG -0.103; TCGA LIHC -0.107; TCGA LUAD -0.151; TCGA LUSC -0.413; TCGA PAAD -0.398; TCGA PRAD -0.083; TCGA SARC -0.233; TCGA STAD -0.092; TCGA UCEC -0.167
hsa-miR-33a-5p
PPP1R3B
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.154; TCGA BRCA -0.126; TCGA CESC -0.159; TCGA ESCA -0.309; TCGA HNSC -0.179; TCGA KIRC -0.283; TCGA LGG -0.114; TCGA LUSC -0.082; TCGA PAAD -0.147; TCGA PRAD -0.054; TCGA SARC -0.332; TCGA THCA -0.148; TCGA STAD -0.057; TCGA UCEC -0.117
hsa-miR-33a-5p
PRIMA1
10 cancers: BLCA; BRCA; COAD; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.458; TCGA BRCA -0.166; TCGA COAD -0.873; TCGA KIRC -0.269; TCGA LUAD -0.167; TCGA PAAD -0.613; TCGA PRAD -0.24; TCGA SARC -0.493; TCGA STAD -0.582; TCGA UCEC -0.247
hsa-miR-33a-5p
MAF
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUAD; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.273; TCGA BRCA -0.108; TCGA COAD -0.271; TCGA HNSC -0.135; TCGA KIRC -0.107; TCGA LGG -0.107; TCGA LUAD -0.064; TCGA PAAD -0.206; TCGA STAD -0.147; TCGA UCEC -0.24
hsa-miR-33a-5p
WSCD1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD
mirMAP
TCGA BLCA -0.312; TCGA BRCA -0.284; TCGA CESC -0.424; TCGA ESCA -0.457; TCGA HNSC -0.205; TCGA KIRP -0.118; TCGA LUAD -0.131; TCGA LUSC -0.45; TCGA PRAD -0.062; TCGA STAD -0.173
hsa-miR-33a-5p
CIITA
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.242; TCGA BRCA -0.057; TCGA CESC -0.22; TCGA COAD -0.19; TCGA ESCA -0.332; TCGA HNSC -0.221; TCGA KIRC -0.192; TCGA LGG -0.166; TCGA LIHC -0.127; TCGA LUAD -0.113; TCGA LUSC -0.512; TCGA PAAD -0.29; TCGA PRAD -0.09; TCGA SARC -0.307
hsa-miR-33a-5p
GIPC3
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.075; TCGA CESC -0.242; TCGA COAD -0.158; TCGA ESCA -0.336; TCGA HNSC -0.144; TCGA KIRC -0.109; TCGA LGG -0.069; TCGA LIHC -0.103; TCGA LUAD -0.121; TCGA LUSC -0.315; TCGA PAAD -0.121; TCGA SARC -0.226; TCGA THCA -0.112; TCGA STAD -0.1; TCGA UCEC -0.17
hsa-miR-33a-5p
MXRA7
13 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.29; TCGA BRCA -0.057; TCGA COAD -0.265; TCGA KIRC -0.149; TCGA KIRP -0.06; TCGA LIHC -0.102; TCGA LUAD -0.06; TCGA PAAD -0.181; TCGA PRAD -0.112; TCGA SARC -0.133; TCGA THCA -0.083; TCGA STAD -0.291; TCGA UCEC -0.155
hsa-miR-33a-5p
PAPPA
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.257; TCGA BRCA -0.105; TCGA COAD -0.308; TCGA ESCA -0.244; TCGA HNSC -0.257; TCGA LIHC -0.324; TCGA LUAD -0.216; TCGA LUSC -0.301; TCGA PAAD -0.388; TCGA PRAD -0.159; TCGA SARC -0.239; TCGA STAD -0.11; TCGA UCEC -0.319
hsa-miR-33a-5p
FLRT2
12 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.486; TCGA BRCA -0.228; TCGA COAD -0.434; TCGA HNSC -0.345; TCGA LIHC -0.2; TCGA LUAD -0.143; TCGA LUSC -0.165; TCGA PAAD -0.397; TCGA PRAD -0.223; TCGA THCA -0.105; TCGA STAD -0.3; TCGA UCEC -0.189
hsa-miR-33a-5p
IKZF1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.345; TCGA CESC -0.219; TCGA COAD -0.308; TCGA ESCA -0.264; TCGA HNSC -0.254; TCGA KIRC -0.341; TCGA KIRP -0.1; TCGA LGG -0.129; TCGA LUAD -0.179; TCGA LUSC -0.454; TCGA PAAD -0.363; TCGA PRAD -0.114; TCGA SARC -0.242; TCGA UCEC -0.125
hsa-miR-33a-5p
ZNF471
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.157; TCGA BRCA -0.118; TCGA CESC -0.368; TCGA COAD -0.243; TCGA ESCA -0.403; TCGA HNSC -0.161; TCGA LUSC -0.341; TCGA PAAD -0.232; TCGA THCA -0.08; TCGA STAD -0.381; TCGA UCEC -0.182
hsa-miR-33a-5p
TLR7
16 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.227; TCGA CESC -0.212; TCGA COAD -0.364; TCGA ESCA -0.431; TCGA HNSC -0.4; TCGA KIRC -0.345; TCGA KIRP -0.105; TCGA LGG -0.114; TCGA LIHC -0.134; TCGA LUAD -0.221; TCGA LUSC -0.548; TCGA PAAD -0.36; TCGA PRAD -0.105; TCGA SARC -0.238; TCGA STAD -0.098; TCGA UCEC -0.205
hsa-miR-33a-5p
ADARB1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.33; TCGA CESC -0.091; TCGA COAD -0.134; TCGA ESCA -0.282; TCGA HNSC -0.159; TCGA KIRC -0.078; TCGA LIHC -0.155; TCGA LUAD -0.156; TCGA LUSC -0.363; TCGA PAAD -0.208; TCGA STAD -0.226; TCGA UCEC -0.08
hsa-miR-33a-5p
SPN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.308; TCGA BRCA -0.059; TCGA CESC -0.245; TCGA COAD -0.213; TCGA ESCA -0.252; TCGA HNSC -0.246; TCGA KIRC -0.34; TCGA KIRP -0.108; TCGA LGG -0.1; TCGA LUAD -0.206; TCGA LUSC -0.591; TCGA PAAD -0.363; TCGA PRAD -0.123; TCGA SARC -0.266
hsa-miR-33a-5p
TMEM229B
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; UCEC
mirMAP
TCGA BLCA -0.073; TCGA BRCA -0.112; TCGA ESCA -0.353; TCGA HNSC -0.172; TCGA KIRC -0.074; TCGA KIRP -0.084; TCGA LIHC -0.114; TCGA LUAD -0.09; TCGA LUSC -0.325; TCGA UCEC -0.099
hsa-miR-33a-5p
BMPR2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.098; TCGA BRCA -0.057; TCGA CESC -0.078; TCGA COAD -0.128; TCGA ESCA -0.198; TCGA HNSC -0.131; TCGA LIHC -0.099; TCGA LUAD -0.155; TCGA LUSC -0.184; TCGA PAAD -0.201; TCGA PRAD -0.078; TCGA SARC -0.069; TCGA THCA -0.058; TCGA STAD -0.128; TCGA UCEC -0.15
hsa-miR-33a-5p
ATP10A
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.359; TCGA CESC -0.271; TCGA COAD -0.329; TCGA ESCA -0.43; TCGA HNSC -0.335; TCGA KIRP -0.162; TCGA LIHC -0.23; TCGA LUAD -0.223; TCGA LUSC -0.607; TCGA PAAD -0.329; TCGA PRAD -0.102; TCGA SARC -0.128; TCGA STAD -0.164
hsa-miR-33a-5p
PLEKHO2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.257; TCGA BRCA -0.064; TCGA CESC -0.171; TCGA COAD -0.228; TCGA ESCA -0.283; TCGA HNSC -0.167; TCGA KIRC -0.139; TCGA LGG -0.063; TCGA LUAD -0.078; TCGA LUSC -0.3; TCGA PAAD -0.198; TCGA PRAD -0.086; TCGA SARC -0.093; TCGA STAD -0.121; TCGA UCEC -0.093
hsa-miR-33a-5p
RUNX1T1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.508; TCGA BRCA -0.289; TCGA CESC -0.55; TCGA COAD -0.457; TCGA ESCA -0.635; TCGA HNSC -0.422; TCGA LUAD -0.238; TCGA LUSC -0.611; TCGA PAAD -0.45; TCGA PRAD -0.185; TCGA SARC -0.141; TCGA THCA -0.163; TCGA STAD -0.382; TCGA UCEC -0.239
hsa-miR-33a-5p
TCF4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.252; TCGA BRCA -0.136; TCGA CESC -0.114; TCGA COAD -0.309; TCGA ESCA -0.139; TCGA HNSC -0.159; TCGA KIRC -0.21; TCGA LIHC -0.165; TCGA LUAD -0.137; TCGA LUSC -0.069; TCGA PAAD -0.356; TCGA PRAD -0.11; TCGA STAD -0.21; TCGA UCEC -0.153
hsa-miR-33a-5p
CELF2
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.529; TCGA BRCA -0.128; TCGA CESC -0.329; TCGA ESCA -0.43; TCGA HNSC -0.292; TCGA KIRC -0.162; TCGA KIRP -0.104; TCGA LIHC -0.155; TCGA LUAD -0.183; TCGA LUSC -0.464; TCGA PAAD -0.307; TCGA PRAD -0.159; TCGA SARC -0.151; TCGA STAD -0.299; TCGA UCEC -0.144
hsa-miR-33a-5p
EBF1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.426; TCGA BRCA -0.257; TCGA CESC -0.325; TCGA COAD -0.295; TCGA ESCA -0.367; TCGA HNSC -0.299; TCGA LIHC -0.267; TCGA LUAD -0.174; TCGA LUSC -0.346; TCGA PAAD -0.245; TCGA PRAD -0.095; TCGA STAD -0.275; TCGA UCEC -0.171
hsa-miR-33a-5p
CNTN4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.378; TCGA BRCA -0.221; TCGA CESC -0.451; TCGA COAD -0.432; TCGA ESCA -0.598; TCGA HNSC -0.395; TCGA KIRP -0.202; TCGA LUAD -0.217; TCGA LUSC -0.377; TCGA PAAD -0.511; TCGA PRAD -0.161; TCGA SARC -0.336; TCGA STAD -0.291; TCGA UCEC -0.261
hsa-miR-33a-5p
TTC28
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.172; TCGA CESC -0.138; TCGA COAD -0.188; TCGA ESCA -0.173; TCGA KIRC -0.08; TCGA LUAD -0.14; TCGA LUSC -0.073; TCGA PAAD -0.237; TCGA PRAD -0.11; TCGA THCA -0.054; TCGA STAD -0.254
hsa-miR-33a-5p
GAS1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.588; TCGA BRCA -0.143; TCGA CESC -0.254; TCGA COAD -0.594; TCGA HNSC -0.251; TCGA LIHC -0.232; TCGA LUAD -0.134; TCGA LUSC -0.313; TCGA PAAD -0.667; TCGA PRAD -0.213; TCGA STAD -0.373; TCGA UCEC -0.305
hsa-miR-33a-5p
PDE4D
13 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.251; TCGA COAD -0.159; TCGA ESCA -0.223; TCGA HNSC -0.165; TCGA KIRP -0.065; TCGA LIHC -0.112; TCGA LUAD -0.125; TCGA LUSC -0.196; TCGA PRAD -0.121; TCGA SARC -0.241; TCGA THCA -0.206; TCGA STAD -0.201; TCGA UCEC -0.126
hsa-miR-33a-5p
EDN1
10 cancers: BLCA; BRCA; COAD; KIRC; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.247; TCGA BRCA -0.093; TCGA COAD -0.116; TCGA KIRC -0.377; TCGA LUSC -0.235; TCGA PAAD -0.23; TCGA PRAD -0.101; TCGA SARC -0.235; TCGA THCA -0.092; TCGA UCEC -0.24
hsa-miR-33a-5p
CDK14
10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.057; TCGA COAD -0.391; TCGA HNSC -0.222; TCGA KIRP -0.068; TCGA LUAD -0.126; TCGA LUSC -0.268; TCGA PAAD -0.297; TCGA PRAD -0.064; TCGA STAD -0.188
hsa-miR-33a-5p
AFF3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.602; TCGA BRCA -0.409; TCGA CESC -0.466; TCGA COAD -0.418; TCGA ESCA -0.476; TCGA HNSC -0.257; TCGA KIRC -0.259; TCGA KIRP -0.104; TCGA LUAD -0.232; TCGA LUSC -0.518; TCGA PAAD -0.284; TCGA STAD -0.382; TCGA UCEC -0.117
hsa-miR-33a-5p
MAP3K3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.161; TCGA BRCA -0.062; TCGA CESC -0.074; TCGA COAD -0.12; TCGA ESCA -0.195; TCGA HNSC -0.12; TCGA LUAD -0.089; TCGA LUSC -0.219; TCGA PAAD -0.169; TCGA SARC -0.058; TCGA STAD -0.145; TCGA UCEC -0.114
hsa-miR-33a-5p
FOXN3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.15; TCGA BRCA -0.093; TCGA COAD -0.074; TCGA ESCA -0.138; TCGA HNSC -0.092; TCGA LUAD -0.077; TCGA PAAD -0.149; TCGA SARC -0.19; TCGA STAD -0.172; TCGA UCEC -0.067
hsa-miR-33a-5p
STS
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; UCEC
MirTarget
TCGA BRCA -0.116; TCGA CESC -0.168; TCGA COAD -0.099; TCGA ESCA -0.259; TCGA HNSC -0.156; TCGA KIRC -0.13; TCGA LIHC -0.257; TCGA LUAD -0.089; TCGA LUSC -0.304; TCGA PAAD -0.13; TCGA SARC -0.107; TCGA UCEC -0.095
hsa-miR-33a-5p
SLC14A1
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD
MirTarget
TCGA BRCA -0.191; TCGA CESC -0.427; TCGA COAD -0.326; TCGA ESCA -0.327; TCGA HNSC -0.28; TCGA LIHC -0.263; TCGA LUAD -0.163; TCGA LUSC -0.501; TCGA PRAD -0.353; TCGA SARC -0.233; TCGA STAD -0.161
hsa-miR-33a-5p
LIN7A
10 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.342; TCGA CESC -0.26; TCGA ESCA -0.309; TCGA HNSC -0.152; TCGA LUAD -0.103; TCGA LUSC -0.194; TCGA PAAD -0.235; TCGA THCA -0.12; TCGA STAD -0.107; TCGA UCEC -0.142
hsa-miR-33a-5p
KLF7
9 cancers: BRCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD
mirMAP; miRNATAP
TCGA BRCA -0.091; TCGA HNSC -0.099; TCGA KIRC -0.078; TCGA LUAD -0.087; TCGA LUSC -0.177; TCGA PAAD -0.168; TCGA SARC -0.187; TCGA THCA -0.108; TCGA STAD -0.132
hsa-miR-33a-5p
TTBK2
11 cancers: BRCA; COAD; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.085; TCGA COAD -0.153; TCGA HNSC -0.094; TCGA LIHC -0.128; TCGA LUAD -0.151; TCGA PAAD -0.234; TCGA PRAD -0.099; TCGA SARC -0.162; TCGA THCA -0.127; TCGA STAD -0.186; TCGA UCEC -0.094
hsa-miR-33a-5p
HYDIN
10 cancers: BRCA; CESC; COAD; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.137; TCGA CESC -0.347; TCGA COAD -0.226; TCGA KIRP -0.254; TCGA LUAD -0.222; TCGA LUSC -0.206; TCGA PAAD -0.216; TCGA THCA -0.134; TCGA STAD -0.139; TCGA UCEC -0.264
hsa-miR-33a-5p
FIGN
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; SARC; STAD
mirMAP
TCGA BRCA -0.075; TCGA CESC -0.299; TCGA COAD -0.431; TCGA ESCA -0.458; TCGA HNSC -0.393; TCGA KIRC -0.088; TCGA KIRP -0.086; TCGA LUSC -0.409; TCGA PAAD -0.173; TCGA SARC -0.416; TCGA STAD -0.244
hsa-miR-33a-5p
COLQ
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; STAD; UCEC
mirMAP
TCGA BRCA -0.131; TCGA CESC -0.283; TCGA COAD -0.108; TCGA ESCA -0.301; TCGA HNSC -0.185; TCGA KIRP -0.172; TCGA LUSC -0.222; TCGA STAD -0.213; TCGA UCEC -0.079
hsa-miR-33a-5p
SECISBP2L
12 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.141; TCGA COAD -0.1; TCGA ESCA -0.164; TCGA HNSC -0.15; TCGA LIHC -0.082; TCGA LUAD -0.169; TCGA LUSC -0.256; TCGA PAAD -0.104; TCGA SARC -0.104; TCGA THCA -0.088; TCGA STAD -0.113; TCGA UCEC -0.139
hsa-miR-33a-5p
NFAT5
9 cancers: CESC; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA CESC -0.073; TCGA ESCA -0.111; TCGA KIRP -0.109; TCGA LUAD -0.099; TCGA LUSC -0.091; TCGA PAAD -0.08; TCGA PRAD -0.062; TCGA STAD -0.107; TCGA UCEC -0.096
hsa-miR-33a-5p
PHACTR2
11 cancers: CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.131; TCGA ESCA -0.173; TCGA HNSC -0.13; TCGA KIRC -0.054; TCGA LUAD -0.158; TCGA LUSC -0.227; TCGA PAAD -0.2; TCGA PRAD -0.085; TCGA THCA -0.088; TCGA STAD -0.085; TCGA UCEC -0.093
hsa-miR-33a-5p
TMEM86A
9 cancers: CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.219; TCGA COAD -0.134; TCGA ESCA -0.127; TCGA HNSC -0.252; TCGA LGG -0.06; TCGA LIHC -0.127; TCGA LUSC -0.238; TCGA PAAD -0.088; TCGA UCEC -0.12
hsa-miR-33a-5p
ZNF264
10 cancers: CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; THCA; STAD
mirMAP
TCGA CESC -0.08; TCGA COAD -0.094; TCGA ESCA -0.136; TCGA KIRC -0.08; TCGA KIRP -0.059; TCGA LIHC -0.087; TCGA LUAD -0.109; TCGA PAAD -0.094; TCGA THCA -0.063; TCGA STAD -0.127
hsa-miR-33a-5p
APOL4
9 cancers: CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD
mirMAP
TCGA CESC -0.31; TCGA COAD -0.198; TCGA ESCA -0.223; TCGA HNSC -0.228; TCGA LGG -0.21; TCGA LUAD -0.092; TCGA LUSC -0.159; TCGA PAAD -0.382; TCGA PRAD -0.18
hsa-miR-33a-5p
RNF19A
10 cancers: COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA COAD -0.077; TCGA ESCA -0.123; TCGA HNSC -0.052; TCGA KIRC -0.06; TCGA LGG -0.129; TCGA LUAD -0.054; TCGA LUSC -0.136; TCGA SARC -0.194; TCGA STAD -0.075; TCGA UCEC -0.077
hsa-miR-33a-5p
MR1
9 cancers: COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA COAD -0.109; TCGA HNSC -0.079; TCGA LUAD -0.051; TCGA LUSC -0.122; TCGA PAAD -0.129; TCGA PRAD -0.153; TCGA SARC -0.154; TCGA STAD -0.087; TCGA UCEC -0.131
hsa-miR-33a-5p
ZC3H12C
9 cancers: HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA HNSC -0.123; TCGA LUAD -0.106; TCGA LUSC -0.078; TCGA PAAD -0.157; TCGA PRAD -0.07; TCGA SARC -0.092; TCGA THCA -0.1; TCGA STAD -0.145; TCGA UCEC -0.21





Enriched cancer pathways of putative targets