microRNA information: hsa-miR-33b-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-33b-5p | miRbase |
Accession: | MIMAT0003301 | miRbase |
Precursor name: | hsa-mir-33b | miRbase |
Precursor accession: | MI0003646 | miRbase |
Symbol: | MIR33B | HGNC |
RefSeq ID: | NR_030361 | GenBank |
Sequence: | GUGCAUUGCUGUUGCAUUGC |
Reported expression in cancers: hsa-miR-33b-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-33b-5p | bladder cancer | upregulation | "Samples were analyzed with a miRNA array containin ......" | 22863868 | Microarray |
hsa-miR-33b-5p | breast cancer | downregulation | "Here we report the identification of miR-33b as a ......" | 25919570 | |
hsa-miR-33b-5p | colorectal cancer | downregulation | "MicroRNA 33b inhibits tumor cell growth and is ass ......" | 26329295 | qPCR |
hsa-miR-33b-5p | gastric cancer | downregulation | "DNA Methylation mediated down regulating of MicroR ......" | 26729612 |
Reported cancer pathway affected by hsa-miR-33b-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-33b-5p | colorectal cancer | cell cycle pathway | "MicroRNA 33b inhibits tumor cell growth and is ass ......" | 26329295 | Flow cytometry; Colony formation; MTT assay; Western blot |
hsa-miR-33b-5p | gastric cancer | Apoptosis pathway | "Curcumin inhibits cell growth and induces cell apo ......" | 27456358 | Western blot; Luciferase |
hsa-miR-33b-5p | lung cancer | Epithelial mesenchymal transition pathway | "MicroRNA 33b inhibits lung adenocarcinoma cell gro ......" | 26459797 | Luciferase |
Reported cancer prognosis affected by hsa-miR-33b-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-33b-5p | bladder cancer | staging | "Samples were analyzed with a miRNA array containin ......" | 22863868 | |
hsa-miR-33b-5p | breast cancer | metastasis; progression | "MicroRNA 33b Inhibits Breast Cancer Metastasis by ......" | 25919570 | |
hsa-miR-33b-5p | colorectal cancer | worse prognosis; progression; staging; tumor size | "MicroRNA 33b inhibits tumor cell growth and is ass ......" | 26329295 | Flow cytometry; Colony formation; MTT assay; Western blot |
hsa-miR-33b-5p | gastric cancer | staging; tumorigenesis | "DNA Methylation mediated down regulating of MicroR ......" | 26729612 | |
hsa-miR-33b-5p | gastric cancer | staging | "Curcumin inhibits cell growth and induces cell apo ......" | 27456358 | Western blot; Luciferase |
hsa-miR-33b-5p | liver cancer | malignant trasformation | "Using gene expression microarrays and high-through ......" | 26646011 | |
hsa-miR-33b-5p | lung cancer | metastasis | "MicroRNA 33b inhibits lung adenocarcinoma cell gro ......" | 26459797 | Luciferase |
hsa-miR-33b-5p | lung cancer | poor survival; drug resistance | "DNA damage responsive miR 33b 3p promoted lung can ......" | 27559850 | |
hsa-miR-33b-5p | melanoma | metastasis | "MicroRNA 33b upregulated by EF24 a curcumin analog ......" | 25725129 | Luciferase |
hsa-miR-33b-5p | melanoma | metastasis | "Cordycepin 3' deoxyadenosine suppressed HMGA2 Twis ......" | 25868853 | |
hsa-miR-33b-5p | sarcoma | metastasis; progression | "MicroRNA 33b suppresses migration and invasion by ......" | 25546234 |
Reported gene related to hsa-miR-33b-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-33b-5p | esophageal cancer | HMGA2 | "The expression and significance of miR 33b and HMG ......" | 27609581 |
hsa-miR-33b-5p | melanoma | HMGA2 | "By targeting HMGA2 and Twist1 miR-33b attenuated m ......" | 25868853 |
hsa-miR-33b-5p | melanoma | HMGA2 | "MicroRNA 33b upregulated by EF24 a curcumin analog ......" | 25725129 |
hsa-miR-33b-5p | gastric cancer | MYC | "Ectopic expression of miR-33b in HGC-27 and MGC-80 ......" | 26729612 |
hsa-miR-33b-5p | sarcoma | MYC | "Moreover we also showed that c-Myc was negatively ......" | 25546234 |
hsa-miR-33b-5p | melanoma | CDH2 | "miR-33b knockdown or ZEB1 overexpression reverted ......" | 25868853 |
hsa-miR-33b-5p | melanoma | TWIST1 | "By targeting HMGA2 and Twist1 miR-33b attenuated m ......" | 25868853 |
hsa-miR-33b-5p | gastric cancer | XIAP | "The first stage of our studies showed that curcumi ......" | 27456358 |
hsa-miR-33b-5p | melanoma | ZEB1 | "miR-33b knockdown or ZEB1 overexpression reverted ......" | 25868853 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-33b-5p | STON1 | 9 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; THCA; UCEC | MirTarget | TCGA CESC -0.293; TCGA COAD -0.474; TCGA ESCA -0.206; TCGA HNSC -0.092; TCGA LIHC -0.084; TCGA LUSC -0.114; TCGA PAAD -0.384; TCGA THCA -0.105; TCGA UCEC -0.445 |
hsa-miR-33b-5p | MEF2C | 9 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; THCA; UCEC | mirMAP | TCGA CESC -0.26; TCGA COAD -0.311; TCGA ESCA -0.244; TCGA HNSC -0.324; TCGA LIHC -0.076; TCGA LUSC -0.316; TCGA PAAD -0.206; TCGA THCA -0.068; TCGA UCEC -0.268 |
hsa-miR-33b-5p | EBF1 | 9 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; THCA; UCEC | miRNATAP | TCGA CESC -0.346; TCGA COAD -0.268; TCGA ESCA -0.277; TCGA HNSC -0.219; TCGA LIHC -0.213; TCGA LUSC -0.257; TCGA PAAD -0.147; TCGA THCA -0.135; TCGA UCEC -0.189 |
Enriched cancer pathways of putative targets