microRNA information: hsa-miR-340-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-340-3p | miRbase |
| Accession: | MIMAT0000750 | miRbase |
| Precursor name: | hsa-mir-340 | miRbase |
| Precursor accession: | MI0000802 | miRbase |
| Symbol: | MIR340 | HGNC |
| RefSeq ID: | NR_029885 | GenBank |
| Sequence: | UCCGUCUCAGUUACUUUAUAGC |
Reported expression in cancers: hsa-miR-340-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-340-3p | breast cancer | downregulation | "They then analyzed miR-340 expression in benign an ......" | 21692045 | qPCR |
| hsa-miR-340-3p | esophageal cancer | downregulation | "Emerging evidence indicates that microRNA miR-340 ......" | 26316084 | qPCR |
| hsa-miR-340-3p | gastric cancer | upregulation | "However the clinical significance and underlying m ......" | 27374211 | |
| hsa-miR-340-3p | glioblastoma | downregulation | "miRNA microarray reveals specific expression in th ......" | 24858071 | Microarray |
| hsa-miR-340-3p | glioblastoma | downregulation | "Here we provide evidence for a function of miR-340 ......" | 25817794 | |
| hsa-miR-340-3p | glioblastoma | downregulation | "miR 340 suppresses glioblastoma multiforme. Down-r ......" | 25831237 | |
| hsa-miR-340-3p | lung squamous cell cancer | downregulation | "miR 340 inhibits tumor cell proliferation and indu ......" | 25151966 | |
| hsa-miR-340-3p | ovarian cancer | upregulation | "Aberrant expression of microRNA-340 miR-340 has be ......" | 27160777 | |
| hsa-miR-340-3p | prostate cancer | downregulation | "microRNA-340 miR-340 has been reported as a tumor ......" | 26394192 | |
| hsa-miR-340-3p | prostate cancer | downregulation | "In the present study we found that miR-340 may act ......" | 26718483 | |
| hsa-miR-340-3p | sarcoma | downregulation | "Our results showed that miR-340 was frequently dow ......" | 23872151 |
Reported cancer pathway affected by hsa-miR-340-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-340-3p | breast cancer | Wnt signaling pathway | "MicroRNA 340 inhibits the migration invasion and m ......" | 26758430 | Western blot; Luciferase |
| hsa-miR-340-3p | breast cancer | cell cycle pathway | "The effect of miR 340 over expression on cell cycl ......" | 27229858 | |
| hsa-miR-340-3p | gastric cancer | Apoptosis pathway; cell cycle pathway | "Effect of miR 340 on gastric cancer cell prolifera ......" | 26722508 | Colony formation; Flow cytometry |
| hsa-miR-340-3p | gastric cancer | cell cycle pathway | "MicroRNA 340 promotes the tumor growth of human ga ......" | 27374211 | Colony formation; Luciferase |
| hsa-miR-340-3p | glioblastoma | cell cycle pathway | "miR 340 inhibits glioblastoma cell proliferation b ......" | 25817794 | Western blot; Luciferase |
| hsa-miR-340-3p | glioblastoma | cell cycle pathway; Apoptosis pathway | "miR 340 suppresses glioblastoma multiforme; Down-r ......" | 25831237 | |
| hsa-miR-340-3p | lung squamous cell cancer | Apoptosis pathway | "miR 340 inhibits tumor cell proliferation and indu ......" | 25151966 | |
| hsa-miR-340-3p | melanoma | MAPK signaling pathway | "MicroRNA 340 as a modulator of RAS RAF MAPK signal ......" | 25043973 | |
| hsa-miR-340-3p | ovarian cancer | Apoptosis pathway; cell cycle pathway | "MicroRNA 340 Induces Apoptosis and Inhibits Metast ......" | 27160777 | Flow cytometry; Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-340-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-340-3p | breast cancer | cell migration; staging; metastasis; poor survival; progression; worse prognosis | "miR 340 inhibition of breast cancer cell migration ......" | 21692045 | |
| hsa-miR-340-3p | breast cancer | cell migration | "MiR 340 suppresses cell migration and invasion by ......" | 26573744 | Wound Healing Assay |
| hsa-miR-340-3p | breast cancer | metastasis | "MicroRNA 340 inhibits the migration invasion and m ......" | 26758430 | Western blot; Luciferase |
| hsa-miR-340-3p | breast cancer | progression | "miR 340 and ZEB1 negative feedback loop regulates ......" | 27036021 | |
| hsa-miR-340-3p | breast cancer | metastasis | "The effect of miR 340 over expression on cell cycl ......" | 27229858 | |
| hsa-miR-340-3p | colorectal cancer | worse prognosis | "miR 124 miR 137 and miR 340 regulate colorectal ca ......" | 22895557 | |
| hsa-miR-340-3p | colorectal cancer | metastasis; poor survival; worse prognosis | "Decreased miR 340 expression in bone marrow is ass ......" | 24448820 | |
| hsa-miR-340-3p | esophageal cancer | metastasis; progression | "MicroRNA 340 Inhibits Esophageal Cancer Cell Growt ......" | 26316084 | Western blot; Luciferase; Colony formation |
| hsa-miR-340-3p | gastric cancer | staging; metastasis; differentiation; tumor size; poor survival; progression | "MicroRNA 340 promotes the tumor growth of human ga ......" | 27374211 | Colony formation; Luciferase |
| hsa-miR-340-3p | glioblastoma | poor survival; differentiation; motility; worse prognosis | "miR 340 suppresses glioblastoma multiforme; Down-r ......" | 25831237 | |
| hsa-miR-340-3p | glioblastoma | poor survival; worse prognosis; tumorigenesis | "miR 340 predicts glioblastoma survival and modulat ......" | 26799668 | |
| hsa-miR-340-3p | glioblastoma | malignant trasformation | "Combined with high throughput sequencing analysis ......" | 27614160 | |
| hsa-miR-340-3p | liver cancer | drug resistance | "miR 340 reverses cisplatin resistance of hepatocel ......" | 25556489 | Luciferase |
| hsa-miR-340-3p | lung squamous cell cancer | motility; staging; progression | "miR 340 inhibits tumor cell proliferation and indu ......" | 25151966 | |
| hsa-miR-340-3p | ovarian cancer | metastasis; progression | "MicroRNA 340 Induces Apoptosis and Inhibits Metast ......" | 27160777 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-340-3p | prostate cancer | progression | "microRNA 340 Suppresses Tumorigenic Potential of P ......" | 26394192 | Luciferase; Western blot |
| hsa-miR-340-3p | prostate cancer | metastasis | "MicroRNA 340 inhibits prostate cancer cell prolife ......" | 26718483 | |
| hsa-miR-340-3p | sarcoma | metastasis; progression | "MicroRNA 340 suppresses osteosarcoma tumor growth ......" | 23872151 | |
| hsa-miR-340-3p | sarcoma | progression; worse prognosis; metastasis; drug resistance | "Combined microRNA 340 and ROCK1 mRNA profiling pre ......" | 24398981 |
Reported gene related to hsa-miR-340-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-340-3p | glioblastoma | ROCK1 | "Furthermore ROCK1 was validated as a direct functi ......" | 25831237 |
| hsa-miR-340-3p | sarcoma | ROCK1 | "MicroRNA 340 suppresses osteosarcoma tumor growth ......" | 23872151 |
| hsa-miR-340-3p | sarcoma | ROCK1 | "Combined microRNA 340 and ROCK1 mRNA profiling pre ......" | 24398981 |
| hsa-miR-340-3p | breast cancer | MET | "miR 340 inhibition of breast cancer cell migration ......" | 21692045 |
| hsa-miR-340-3p | colorectal cancer | MET | "It was of note that the colorectal cancer group wi ......" | 24448820 |
| hsa-miR-340-3p | melanoma | ABCB5 | "Diminution of miR 340 5p levels is responsible for ......" | 26554847 |
| hsa-miR-340-3p | gastric cancer | CCNG2 | "MicroRNA 340 promotes the tumor growth of human ga ......" | 27374211 |
| hsa-miR-340-3p | lung cancer | CDKN1B | "A novel miRNA mediated STOP sign in lung cancer: m ......" | 27308439 |
| hsa-miR-340-3p | lung cancer | CDKN3 | "miR-340 inhibits neoplastic cell proliferation and ......" | 27308439 |
| hsa-miR-340-3p | prostate cancer | HMGN5 | "Intriguingly on the basis of bioinformatics analys ......" | 26394192 |
| hsa-miR-340-3p | lung cancer | MAP6 | "A novel miRNA mediated STOP sign in lung cancer: m ......" | 27308439 |
| hsa-miR-340-3p | prostate cancer | MDM2 | "MicroRNA 340 inhibits prostate cancer cell prolife ......" | 26718483 |
| hsa-miR-340-3p | breast cancer | MYO10 | "MiR 340 suppresses cell migration and invasion by ......" | 26573744 |
| hsa-miR-340-3p | ovarian cancer | NFASC | "MicroRNA 340 Induces Apoptosis and Inhibits Metast ......" | 27160777 |
| hsa-miR-340-3p | glioblastoma | NRAS | "miR 340 predicts glioblastoma survival and modulat ......" | 26799668 |
| hsa-miR-340-3p | glioblastoma | NT5E | "Three miRNAs miR-340 -494 and -1293 active on cell ......" | 27614160 |
| hsa-miR-340-3p | gastric cancer | PCNA | "MicroRNA 340 promotes the tumor growth of human ga ......" | 27374211 |
| hsa-miR-340-3p | esophageal cancer | PSAT1 | "MicroRNA 340 Inhibits Esophageal Cancer Cell Growt ......" | 26316084 |
| hsa-miR-340-3p | lung squamous cell cancer | PUM1 | "Accordingly the inhibition of either PUM1 or SKP2 ......" | 25151966 |
| hsa-miR-340-3p | lung squamous cell cancer | SKP2 | "At the same time miR-340 induces the stabilization ......" | 25151966 |
| hsa-miR-340-3p | prostate cancer | TP53 | "MicroRNA 340 inhibits prostate cancer cell prolife ......" | 26718483 |
| hsa-miR-340-3p | breast cancer | ZEB1 | "miR 340 and ZEB1 negative feedback loop regulates ......" | 27036021 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-340-3p | SYT15 | 10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.209; TCGA BRCA -0.276; TCGA COAD -0.337; TCGA KIRC -0.339; TCGA KIRP -0.235; TCGA LUAD -0.239; TCGA PRAD -0.239; TCGA SARC -0.175; TCGA STAD -0.331; TCGA UCEC -0.134 |
hsa-miR-340-3p | ANKRD40 | 10 cancers: BLCA; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.065; TCGA HNSC -0.094; TCGA KIRP -0.055; TCGA LIHC -0.056; TCGA LUAD -0.085; TCGA PAAD -0.085; TCGA PRAD -0.087; TCGA SARC -0.169; TCGA STAD -0.139; TCGA UCEC -0.182 |
hsa-miR-340-3p | KLHL30 | 11 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.336; TCGA HNSC -0.295; TCGA KIRC -0.387; TCGA KIRP -0.4; TCGA LUAD -0.256; TCGA LUSC -0.406; TCGA PAAD -0.361; TCGA PRAD -0.177; TCGA SARC -1.005; TCGA STAD -0.346; TCGA UCEC -0.327 |
hsa-miR-340-3p | VIPR2 | 9 cancers: BLCA; BRCA; COAD; KIRC; LGG; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.244; TCGA BRCA -0.581; TCGA COAD -0.712; TCGA KIRC -0.729; TCGA LGG -0.49; TCGA PRAD -0.232; TCGA SARC -1.174; TCGA STAD -0.353; TCGA UCEC -0.229 |
hsa-miR-340-3p | ZC3H6 | 12 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.154; TCGA BRCA -0.171; TCGA KIRC -0.124; TCGA KIRP -0.2; TCGA LGG -0.068; TCGA LUAD -0.094; TCGA LUSC -0.098; TCGA PRAD -0.101; TCGA SARC -0.188; TCGA THCA -0.069; TCGA STAD -0.235; TCGA UCEC -0.159 |
hsa-miR-340-3p | PPFIBP1 | 11 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.115; TCGA BRCA -0.087; TCGA CESC -0.205; TCGA HNSC -0.232; TCGA LUAD -0.21; TCGA LUSC -0.25; TCGA PAAD -0.224; TCGA PRAD -0.207; TCGA THCA -0.16; TCGA STAD -0.259; TCGA UCEC -0.207 |
hsa-miR-340-3p | INMT | 10 cancers: BLCA; BRCA; COAD; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.211; TCGA BRCA -0.568; TCGA COAD -0.34; TCGA KIRC -0.324; TCGA LUAD -0.508; TCGA PRAD -0.276; TCGA SARC -0.276; TCGA THCA -0.301; TCGA STAD -0.406; TCGA UCEC -0.29 |
hsa-miR-340-3p | MCPH1 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD | MirTarget | TCGA BRCA -0.053; TCGA ESCA -0.105; TCGA KIRC -0.083; TCGA KIRP -0.099; TCGA LGG -0.067; TCGA LIHC -0.091; TCGA LUAD -0.118; TCGA PRAD -0.065; TCGA SARC -0.112; TCGA STAD -0.103 |
hsa-miR-340-3p | SLC16A4 | 9 cancers: BRCA; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.219; TCGA LGG -0.14; TCGA LUAD -0.396; TCGA LUSC -0.405; TCGA PAAD -0.459; TCGA PRAD -0.349; TCGA THCA -0.144; TCGA STAD -0.204; TCGA UCEC -0.351 |
hsa-miR-340-3p | CCDC122 | 9 cancers: BRCA; CESC; LIHC; LUAD; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.113; TCGA CESC -0.192; TCGA LIHC -0.159; TCGA LUAD -0.166; TCGA OV -0.123; TCGA PRAD -0.168; TCGA THCA -0.089; TCGA STAD -0.237; TCGA UCEC -0.137 |
hsa-miR-340-3p | F3 | 12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BRCA -0.361; TCGA CESC -0.584; TCGA ESCA -0.253; TCGA HNSC -0.287; TCGA KIRC -0.603; TCGA KIRP -0.681; TCGA LUAD -0.384; TCGA LUSC -0.247; TCGA PAAD -0.408; TCGA PRAD -0.351; TCGA STAD -0.163; TCGA UCEC -0.216 |
Enriched cancer pathways of putative targets