microRNA information: hsa-miR-342-5p

SectionIDlink
Mature name: hsa-miR-342-5pmiRbase
Accession: MIMAT0004694miRbase
Precursor name: hsa-mir-342 miRbase
Precursor accession: MI0000805miRbase
Symbol: MIR342HGNC
RefSeq ID: NR_029888GenBank
Sequence: AGGGGUGCUAUCUGUGAUUGA



Reported expression in cancers: hsa-miR-342-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-342-5p

acute myeloid leukemiaderegulation"Circulating miR 150 and miR 342 in plasma are nove ......"23391324Microarray; qPCR
hsa-miR-342-5p

breast cancerdownregulation"Increased expression of three of the most promisin ......"18708351Reverse transcription PCR; qPCR
hsa-miR-342-5p

breast cancerdownregulation"Stepwise ANN analysis identified predictive miRNA ......"19432961
hsa-miR-342-5p

breast cancerdownregulation"Downregulation of miR 342 is associated with tamox ......"21172025
hsa-miR-342-5p

breast cancerdownregulation"We demonstrated the clinical relevance of the miRN ......"24148764
hsa-miR-342-5p

colorectal cancerderegulation"MicroRNA 342 inhibits colorectal cancer cell proli ......"21565830
hsa-miR-342-5p

gastric cancerupregulation"miRNA expression was determined using a custom-des ......"22112324Microarray
hsa-miR-342-5p

lung cancerderegulation"The expression of 319 miRNAs was evaluated by Exiq ......"20818338Microarray
hsa-miR-342-5p

sarcomadownregulation"Similar analysis in mouse metastatic sarcomas reve ......"26044957



Reported cancer pathway affected by hsa-miR-342-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-342-5p

breast cancerApoptosis pathway; cell cycle pathway"Downregulation of miR 342 is associated with tamox ......"21172025
hsa-miR-342-5p

breast cancerApoptosis pathway"miR 342 is associated with estrogen receptor α ex ......"23408138
hsa-miR-342-5p

breast cancerApoptosis pathway"Effect of miR 342 3p on chemotherapy sensitivity i ......"24921394Flow cytometry
hsa-miR-342-5p

breast cancerApoptosis pathway"miR 342 overexpression results in a synthetic leth ......"26919240Luciferase
hsa-miR-342-5p

colon cancercell cycle pathway; Apoptosis pathway"microRNA 342 5p and miR 608 inhibit colon cancer t ......"26646451
hsa-miR-342-5p

colorectal cancerApoptosis pathway"Epigenetic silencing of the intronic microRNA hsa ......"18264139
hsa-miR-342-5p

gastric cancerApoptosis pathway"In order to identify miRNA signatures for gastric ......"22112324



Reported cancer prognosis affected by hsa-miR-342-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-342-5p

breast cancerworse prognosis"Stepwise ANN analysis identified predictive miRNA ......"19432961
hsa-miR-342-5p

breast cancerdrug resistance; progression"Downregulation of miR 342 is associated with tamox ......"21172025
hsa-miR-342-5p

breast cancerdrug resistance"miR 342 is associated with estrogen receptor α ex ......"23408138
hsa-miR-342-5p

breast cancerpoor survival"Rank product analyses identified 38 miRNAs q < 0 ......"24148764
hsa-miR-342-5p

breast cancerrecurrence"Using microarray-based technology we have performe ......"24632820
hsa-miR-342-5p

breast cancerdrug resistance"The few available studies investigating microRNA i ......"26473850
hsa-miR-342-5p

cervical and endocervical cancerdrug resistance"Seven differentially expressed miRNAs were selecte ......"27423381
hsa-miR-342-5p

colon cancertumorigenesis; progression"microRNA 342 5p and miR 608 inhibit colon cancer t ......"26646451
hsa-miR-342-5p

colorectal cancermetastasis"MicroRNA 342 inhibits colorectal cancer cell proli ......"21565830
hsa-miR-342-5p

gastric cancerdrug resistance"In order to identify miRNA signatures for gastric ......"22112324



Reported gene related to hsa-miR-342-5p

miRNAcancergenereportingPUBMED
hsa-miR-342-5p

bladder cancerFOXM1"Long non coding RNA H19 regulates FOXM1 expression ......"27716361
hsa-miR-342-5p

cervical and endocervical cancerFOXM1"miR 342 3p suppresses proliferation migration and ......"25066298
hsa-miR-342-5p

colorectal cancerFOXM1"FOXM1 and FOXQ1 Are Promising Prognostic Biomarker ......"27162244
hsa-miR-342-5p

breast cancerBRCA1"miR 342 overexpression results in a synthetic leth ......"26919240
hsa-miR-342-5p

breast cancerBRCA1"miR 342 regulates BRCA1 expression through modulat ......"24475217
hsa-miR-342-5p

breast cancerERBB2"Statistically significant associations were observ ......"23408138
hsa-miR-342-5p

breast cancerERBB2"We observed significant and dramatic downregulatio ......"21172025
hsa-miR-342-5p

breast cancerESR1"miR 342 is associated with estrogen receptor α ex ......"23408138
hsa-miR-342-5p

breast cancerESR1"Expression of miR-342 has been strongly correlated ......"26919240
hsa-miR-342-5p

breast cancerBIRC6"Using an in silico approach and a luciferase repor ......"26919240
hsa-miR-342-5p

colorectal cancerDNMT1"Restoration of miR-342 resulted in a dramatic redu ......"21565830
hsa-miR-342-5p

lung cancerE2F1"miR 342 3p regulates MYC transcriptional activity ......"26483346
hsa-miR-342-5p

colorectal cancerEVL"Epigenetic silencing of the intronic microRNA hsa ......"18264139
hsa-miR-342-5p

lung squamous cell cancerFGFR3"Further studies revealed that the growth of SCLC c ......"27670444
hsa-miR-342-5p

colorectal cancerFOXQ1"FOXM1 and FOXQ1 Are Promising Prognostic Biomarker ......"27162244
hsa-miR-342-5p

bladder cancerH19"Long non coding RNA H19 regulates FOXM1 expression ......"27716361
hsa-miR-342-5p

breast cancerID4"miR 342 regulates BRCA1 expression through modulat ......"24475217
hsa-miR-342-5p

lung cancerMYC"miR 342 3p regulates MYC transcriptional activity ......"26483346
hsa-miR-342-5p

colon cancerNAA10"microRNA 342 5p and miR 608 inhibit colon cancer t ......"26646451
hsa-miR-342-5p

liver cancerNFASC"miR 342 3p affects hepatocellular carcinoma cell p ......"25580008
hsa-miR-342-5p

lung squamous cell cancerPTPRN"Small cell lung cancer growth is inhibited by miR ......"27670444
hsa-miR-342-5p

lung squamous cell cancerRAP2B"miR 342 3p targets RAP2B to suppress proliferation ......"25663460
hsa-miR-342-5p

lung squamous cell cancerSCLC1"The present experiments were initiated to see whet ......"27670444
hsa-miR-342-5p

lymphomaTIAM1"Expression of microRNA 10a microRNA 342 3p and the ......"26870215
hsa-miR-342-5p

breast cancerVEGFA"Statistically significant associations were observ ......"23408138



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-342-5p
NFE2L1
10 cancers: BLCA; CESC; HNSC; KIRC; LIHC; LUSC; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.113; TCGA CESC -0.059; TCGA HNSC -0.112; TCGA KIRC -0.093; TCGA LIHC -0.184; TCGA LUSC -0.175; TCGA PRAD -0.065; TCGA SARC -0.112; TCGA THCA -0.151; TCGA UCEC -0.115
hsa-miR-342-5p
PTPRG
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.21; TCGA CESC -0.375; TCGA ESCA -0.267; TCGA HNSC -0.213; TCGA KIRC -0.139; TCGA KIRP -0.196; TCGA LUSC -0.173; TCGA PRAD -0.115; TCGA THCA -0.212; TCGA STAD -0.112
hsa-miR-342-5p
LMNA
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.069; TCGA BRCA -0.204; TCGA ESCA -0.13; TCGA HNSC -0.084; TCGA LIHC -0.11; TCGA LUSC -0.183; TCGA PAAD -0.284; TCGA PRAD -0.083; TCGA STAD -0.072; TCGA UCEC -0.231
hsa-miR-342-5p
TMEM231
9 cancers: BLCA; CESC; KIRC; KIRP; LGG; OV; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.09; TCGA CESC -0.193; TCGA KIRC -0.145; TCGA KIRP -0.098; TCGA LGG -0.088; TCGA OV -0.157; TCGA PRAD -0.076; TCGA THCA -0.208; TCGA STAD -0.173
hsa-miR-342-5p
CSDC2
9 cancers: BLCA; BRCA; HNSC; KIRC; LGG; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.62; TCGA BRCA -0.264; TCGA HNSC -0.484; TCGA KIRC -0.604; TCGA LGG -0.469; TCGA PRAD -0.217; TCGA SARC -0.465; TCGA STAD -0.145; TCGA UCEC -0.38
hsa-miR-342-5p
SORBS2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.517; TCGA BRCA -0.157; TCGA CESC -0.542; TCGA ESCA -0.316; TCGA HNSC -0.198; TCGA LIHC -0.22; TCGA LUAD -0.179; TCGA PRAD -0.18; TCGA SARC -0.404; TCGA STAD -0.441
hsa-miR-342-5p
MKL2
9 cancers: BLCA; CESC; HNSC; KIRC; LIHC; LUAD; THCA; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.103; TCGA CESC -0.069; TCGA HNSC -0.11; TCGA KIRC -0.057; TCGA LIHC -0.072; TCGA LUAD -0.11; TCGA THCA -0.072; TCGA STAD -0.09; TCGA UCEC -0.115
hsa-miR-342-5p
ZBTB47
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.199; TCGA BRCA -0.129; TCGA CESC -0.079; TCGA ESCA -0.234; TCGA KIRC -0.182; TCGA LGG -0.249; TCGA PRAD -0.075; TCGA SARC -0.251; TCGA THCA -0.173; TCGA STAD -0.205; TCGA UCEC -0.164
hsa-miR-342-5p
MPL
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.249; TCGA BRCA -0.126; TCGA CESC -0.102; TCGA ESCA -0.182; TCGA KIRC -0.197; TCGA LIHC -0.107; TCGA LUAD -0.08; TCGA PRAD -0.16; TCGA SARC -0.58; TCGA THCA -0.096; TCGA STAD -0.314; TCGA UCEC -0.133
hsa-miR-342-5p
PPARGC1A
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
MirTarget; PITA; miRNATAP
TCGA BLCA -0.738; TCGA BRCA -0.43; TCGA HNSC -0.366; TCGA KIRC -0.863; TCGA KIRP -0.332; TCGA PAAD -0.524; TCGA PRAD -0.533; TCGA SARC -0.871; TCGA STAD -0.518
hsa-miR-342-5p
ENAH
12 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.164; TCGA CESC -0.123; TCGA COAD -0.139; TCGA HNSC -0.145; TCGA LGG -0.196; TCGA LUAD -0.145; TCGA LUSC -0.257; TCGA PRAD -0.077; TCGA SARC -0.324; TCGA THCA -0.144; TCGA STAD -0.273; TCGA UCEC -0.134
hsa-miR-342-5p
UBE3B
9 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; SARC; THCA
MirTarget
TCGA BLCA -0.082; TCGA ESCA -0.066; TCGA HNSC -0.05; TCGA KIRC -0.095; TCGA KIRP -0.071; TCGA LIHC -0.061; TCGA LUAD -0.088; TCGA SARC -0.129; TCGA THCA -0.128
hsa-miR-342-5p
BMPR2
10 cancers: BLCA; CESC; HNSC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA
TCGA BLCA -0.196; TCGA CESC -0.077; TCGA HNSC -0.096; TCGA KIRP -0.112; TCGA LUAD -0.07; TCGA PRAD -0.089; TCGA SARC -0.08; TCGA THCA -0.088; TCGA STAD -0.093; TCGA UCEC -0.205
hsa-miR-342-5p
PCDH1
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; THCA; UCEC
PITA; miRNATAP
TCGA BLCA -0.127; TCGA CESC -0.206; TCGA ESCA -0.346; TCGA HNSC -0.18; TCGA KIRC -0.467; TCGA KIRP -0.475; TCGA PAAD -0.395; TCGA THCA -0.234; TCGA UCEC -0.201
hsa-miR-342-5p
DGCR2
9 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA
mirMAP
TCGA BLCA -0.057; TCGA HNSC -0.091; TCGA KIRP -0.064; TCGA LGG -0.218; TCGA LIHC -0.119; TCGA LUAD -0.054; TCGA LUSC -0.111; TCGA PAAD -0.107; TCGA THCA -0.062
hsa-miR-342-5p
MGLL
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.137; TCGA BRCA -0.217; TCGA CESC -0.281; TCGA ESCA -0.217; TCGA HNSC -0.206; TCGA PAAD -0.234; TCGA PRAD -0.181; TCGA SARC -0.15; TCGA STAD -0.214; TCGA UCEC -0.135
hsa-miR-342-5p
GNA11
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA
mirMAP
TCGA BLCA -0.166; TCGA CESC -0.154; TCGA ESCA -0.214; TCGA HNSC -0.127; TCGA KIRC -0.338; TCGA KIRP -0.337; TCGA LUSC -0.122; TCGA PRAD -0.159; TCGA SARC -0.354; TCGA THCA -0.278
hsa-miR-342-5p
DAB2IP
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; OV; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.107; TCGA BRCA -0.188; TCGA ESCA -0.152; TCGA KIRC -0.178; TCGA KIRP -0.139; TCGA OV -0.119; TCGA PRAD -0.141; TCGA SARC -0.137; TCGA THCA -0.083; TCGA UCEC -0.094
hsa-miR-342-5p
IGF1R
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA
mirMAP
TCGA BLCA -0.172; TCGA CESC -0.207; TCGA HNSC -0.202; TCGA KIRC -0.202; TCGA KIRP -0.166; TCGA LGG -0.113; TCGA LUAD -0.134; TCGA LUSC -0.295; TCGA PRAD -0.101; TCGA SARC -0.231; TCGA THCA -0.158
hsa-miR-342-5p
WASF2
9 cancers: BLCA; BRCA; HNSC; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.094; TCGA BRCA -0.068; TCGA HNSC -0.074; TCGA OV -0.166; TCGA PRAD -0.064; TCGA SARC -0.088; TCGA THCA -0.064; TCGA STAD -0.07; TCGA UCEC -0.099
hsa-miR-342-5p
TOM1L2
9 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.106; TCGA HNSC -0.123; TCGA KIRC -0.355; TCGA KIRP -0.107; TCGA LIHC -0.075; TCGA SARC -0.338; TCGA THCA -0.093; TCGA STAD -0.147; TCGA UCEC -0.112
hsa-miR-342-5p
CBX6
9 cancers: BLCA; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.19; TCGA HNSC -0.123; TCGA KIRC -0.256; TCGA KIRP -0.14; TCGA PRAD -0.22; TCGA SARC -0.217; TCGA THCA -0.246; TCGA STAD -0.18; TCGA UCEC -0.204
hsa-miR-342-5p
DUSP8
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.168; TCGA CESC -0.182; TCGA ESCA -0.204; TCGA HNSC -0.165; TCGA KIRC -0.399; TCGA PAAD -0.186; TCGA SARC -0.297; TCGA THCA -0.177; TCGA STAD -0.103; TCGA UCEC -0.149
hsa-miR-342-5p
C15orf52
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.371; TCGA BRCA -0.247; TCGA CESC -0.359; TCGA ESCA -0.227; TCGA HNSC -0.192; TCGA KIRC -0.239; TCGA LGG -0.177; TCGA PRAD -0.076; TCGA SARC -0.657; TCGA STAD -0.495; TCGA UCEC -0.208
hsa-miR-342-5p
KIF13B
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; PAAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.186; TCGA CESC -0.161; TCGA ESCA -0.299; TCGA KIRC -0.485; TCGA KIRP -0.104; TCGA LUAD -0.095; TCGA PAAD -0.192; TCGA SARC -0.101; TCGA THCA -0.157; TCGA UCEC -0.143
hsa-miR-342-5p
FYCO1
9 cancers: BLCA; ESCA; HNSC; KIRC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.336; TCGA ESCA -0.247; TCGA HNSC -0.124; TCGA KIRC -0.188; TCGA PRAD -0.144; TCGA SARC -0.308; TCGA THCA -0.111; TCGA STAD -0.237; TCGA UCEC -0.231
hsa-miR-342-5p
SLC2A4
9 cancers: BLCA; BRCA; KIRC; LGG; LIHC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.725; TCGA BRCA -0.444; TCGA KIRC -0.458; TCGA LGG -0.321; TCGA LIHC -0.221; TCGA PRAD -0.498; TCGA SARC -0.389; TCGA STAD -0.643; TCGA UCEC -0.273
hsa-miR-342-5p
TOB2
12 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.075; TCGA ESCA -0.159; TCGA HNSC -0.08; TCGA KIRC -0.156; TCGA KIRP -0.178; TCGA LGG -0.187; TCGA LIHC -0.132; TCGA LUAD -0.093; TCGA OV -0.079; TCGA PAAD -0.08; TCGA STAD -0.083; TCGA UCEC -0.105
hsa-miR-342-5p
PRKAR2A
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.245; TCGA CESC -0.27; TCGA ESCA -0.28; TCGA HNSC -0.225; TCGA KIRC -0.373; TCGA KIRP -0.275; TCGA LUAD -0.096; TCGA LUSC -0.116; TCGA OV -0.096; TCGA PRAD -0.169; TCGA SARC -0.2; TCGA THCA -0.327; TCGA STAD -0.121
hsa-miR-342-5p
UBE2W
10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUAD; OV; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.056; TCGA COAD -0.109; TCGA HNSC -0.085; TCGA KIRC -0.143; TCGA KIRP -0.087; TCGA LUAD -0.137; TCGA OV -0.085; TCGA THCA -0.094; TCGA STAD -0.092; TCGA UCEC -0.11
hsa-miR-342-5p
ILK
9 cancers: BLCA; CESC; ESCA; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.195; TCGA CESC -0.088; TCGA ESCA -0.123; TCGA LGG -0.078; TCGA PAAD -0.087; TCGA PRAD -0.181; TCGA SARC -0.361; TCGA STAD -0.163; TCGA UCEC -0.134
hsa-miR-342-5p
MYH11
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.11; TCGA BRCA -0.356; TCGA CESC -0.464; TCGA HNSC -0.633; TCGA KIRC -0.18; TCGA PRAD -0.573; TCGA SARC -1.878; TCGA STAD -0.759; TCGA UCEC -0.757
hsa-miR-342-5p
EIF3D
9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.062; TCGA HNSC -0.052; TCGA LGG -0.193; TCGA LIHC -0.077; TCGA LUAD -0.062; TCGA LUSC -0.135; TCGA OV -0.122; TCGA PAAD -0.084; TCGA UCEC -0.056
hsa-miR-342-5p
RASL10B
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; STAD
MirTarget
TCGA BRCA -0.284; TCGA CESC -0.322; TCGA HNSC -0.277; TCGA KIRC -0.267; TCGA KIRP -0.239; TCGA LGG -0.096; TCGA LIHC -0.664; TCGA LUSC -0.256; TCGA PRAD -0.118; TCGA STAD -0.199
hsa-miR-342-5p
DDX1
12 cancers: CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC
miRNAWalker2 validate
TCGA CESC -0.079; TCGA COAD -0.051; TCGA HNSC -0.05; TCGA KIRC -0.102; TCGA KIRP -0.102; TCGA LIHC -0.097; TCGA LUAD -0.11; TCGA LUSC -0.149; TCGA OV -0.083; TCGA PAAD -0.089; TCGA THCA -0.084; TCGA UCEC -0.077
hsa-miR-342-5p
ACVR2B
10 cancers: CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; OV; THCA; STAD
miRNATAP
TCGA CESC -0.18; TCGA COAD -0.075; TCGA KIRC -0.233; TCGA KIRP -0.135; TCGA LGG -0.212; TCGA LUAD -0.081; TCGA LUSC -0.129; TCGA OV -0.125; TCGA THCA -0.068; TCGA STAD -0.117
hsa-miR-342-5p
NARS2
12 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA
miRNATAP
TCGA CESC -0.158; TCGA COAD -0.107; TCGA ESCA -0.09; TCGA HNSC -0.113; TCGA KIRC -0.174; TCGA KIRP -0.092; TCGA LGG -0.11; TCGA LIHC -0.071; TCGA LUAD -0.097; TCGA LUSC -0.112; TCGA OV -0.122; TCGA THCA -0.129
hsa-miR-342-5p
OXSR1
11 cancers: CESC; ESCA; KIRC; KIRP; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
miRNATAP
TCGA CESC -0.072; TCGA ESCA -0.131; TCGA KIRC -0.146; TCGA KIRP -0.089; TCGA LUAD -0.054; TCGA LUSC -0.109; TCGA OV -0.103; TCGA SARC -0.063; TCGA THCA -0.074; TCGA STAD -0.069; TCGA UCEC -0.074
hsa-miR-342-5p
IRF6
11 cancers: COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA
MirTarget
TCGA COAD -0.066; TCGA HNSC -0.117; TCGA KIRC -1.018; TCGA KIRP -0.341; TCGA LIHC -0.287; TCGA LUAD -0.138; TCGA LUSC -0.341; TCGA PAAD -0.411; TCGA PRAD -0.11; TCGA SARC -0.891; TCGA THCA -0.16





Enriched cancer pathways of putative targets