microRNA information: hsa-miR-346
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-346 | miRbase |
| Accession: | MIMAT0000773 | miRbase |
| Precursor name: | hsa-mir-346 | miRbase |
| Precursor accession: | MI0000826 | miRbase |
| Symbol: | MIR346 | HGNC |
| RefSeq ID: | NR_029907 | GenBank |
| Sequence: | UGUCUGCCCGCAUGCCUGCCUCU |
Reported expression in cancers: hsa-miR-346
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-346
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-346 | NA | NA | "NA ......" | NA | NA |
| hsa-miR-346 | " ......" |
Reported cancer prognosis affected by hsa-miR-346
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-346 | lung cancer | poor survival | "We then focused on characterizing the inhibitors o ......" | 24157646 | |
| hsa-miR-346 | thyroid cancer | tumorigenesis | "Validation was done by quantitative RT-PCR; Two sp ......" | 16822819 |
Reported gene related to hsa-miR-346
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-346 | cervical and endocervical cancer | AGO2 | "miR 346 Up regulates Argonaute 2 AGO2 Protein Expr ......" | 26518874 |