microRNA information: hsa-miR-34a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-34a-5p | miRbase |
| Accession: | MIMAT0000255 | miRbase |
| Precursor name: | hsa-mir-34a | miRbase |
| Precursor accession: | MI0000268 | miRbase |
| Symbol: | MIR34A | HGNC |
| RefSeq ID: | NR_029610 | GenBank |
| Sequence: | UGGCAGUGUCUUAGCUGGUUGU |
Reported expression in cancers: hsa-miR-34a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-34a-5p | B cell lymphoma | downregulation | "We measured the levels of miRNAs miR-15a miR-16-1 ......" | 21987025 | Reverse transcription PCR; qPCR |
| hsa-miR-34a-5p | B cell lymphoma | upregulation | "High miR 34a expression improves response to doxor ......" | 26854484 | |
| hsa-miR-34a-5p | bladder cancer | downregulation | "Expression and role of miR 34a in bladder cancer. ......" | 23720881 | qPCR |
| hsa-miR-34a-5p | bladder cancer | downregulation | "The expression of mir-34a was detected by quantita ......" | 25551284 | qPCR |
| hsa-miR-34a-5p | breast cancer | downregulation | "MiR 34a expression has an effect for lower risk of ......" | 22102859 | |
| hsa-miR-34a-5p | breast cancer | downregulation | "However the profile and biological effects of miR- ......" | 22623155 | qPCR |
| hsa-miR-34a-5p | breast cancer | downregulation | "In this study we investigated the therapeutic pote ......" | 23032974 | |
| hsa-miR-34a-5p | breast cancer | downregulation | "Inactivation of miR-34a has been reported in multi ......" | 23292869 | |
| hsa-miR-34a-5p | breast cancer | downregulation | "Previous studies have shown that microRNA-34a miR- ......" | 25783790 | |
| hsa-miR-34a-5p | breast cancer | downregulation | "As microRNA-34a miR-34a has been suggested to be a ......" | 27524218 | Reverse transcription PCR; in situ hybridization |
| hsa-miR-34a-5p | cervical and endocervical cancer | upregulation | "miR 34a and miR 125b Expression in HPV Infection a ......" | 26180794 | |
| hsa-miR-34a-5p | colon cancer | downregulation | "Moreover miR-34a also suppressed in vivo growth of ......" | 17875987 | Microarray |
| hsa-miR-34a-5p | colon cancer | downregulation | "MicroRNA-34a miR-34a has been reported to be downr ......" | 25333573 | |
| hsa-miR-34a-5p | colorectal cancer | downregulation | "Circulating miR 34a levels are reduced in colorect ......" | 22648208 | |
| hsa-miR-34a-5p | colorectal cancer | downregulation | "The miR-34 family members described as potential t ......" | 23183747 | RNA-Seq |
| hsa-miR-34a-5p | colorectal cancer | downregulation | "Association between miR 34a expression and recurre ......" | 23355243 | qPCR |
| hsa-miR-34a-5p | colorectal cancer | downregulation | "MiR-34a is a tumor suppressor that is frequently d ......" | 24370784 | qPCR |
| hsa-miR-34a-5p | colorectal cancer | downregulation | "miR 34a 5p suppresses colorectal cancer metastasis ......" | 25362853 | |
| hsa-miR-34a-5p | esophageal cancer | downregulation | "Among those dysregulated miRNAs miR-203 miR-34b/c ......" | 21547903 | |
| hsa-miR-34a-5p | esophageal cancer | downregulation | "Inactivation of miR 34a by aberrant CpG methylatio ......" | 24528540 | qPCR |
| hsa-miR-34a-5p | esophageal cancer | downregulation | "Clinical significance of microRNA 34a in esophagea ......" | 26782413 | qPCR |
| hsa-miR-34a-5p | esophageal cancer | downregulation | "Increasing studies demonstrate that reduced expres ......" | 26944831 | qPCR |
| hsa-miR-34a-5p | gastric cancer | downregulation | "Meanwhile we found that miR-34a was down-regulated ......" | 24837198 | |
| hsa-miR-34a-5p | gastric cancer | downregulation | "Quantitative real-time polymerase chain reaction q ......" | 24988056 | qPCR |
| hsa-miR-34a-5p | gastric cancer | downregulation | "The prognostic value of miR 34a expression in comp ......" | 25932212 | qPCR |
| hsa-miR-34a-5p | gastric cancer | downregulation | "miR-335 and miR-34a are two microRNAs miRNAs usual ......" | 26318298 | Microarray |
| hsa-miR-34a-5p | gastric cancer | downregulation | "Prognostic Significance of MiR 34a Expression in P ......" | 26415802 | qPCR |
| hsa-miR-34a-5p | glioblastoma | downregulation | "In this study we found that microRNA-34a miR-34a i ......" | 21743299 | |
| hsa-miR-34a-5p | head and neck cancer | downregulation | "Dysregulation of microRNA 34a expression in head a ......" | 22629428 | |
| hsa-miR-34a-5p | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-34a-5p | liver cancer | downregulation | "Several studies have shown that miR-34a represses ......" | 19006648 | |
| hsa-miR-34a-5p | liver cancer | downregulation | "Of these 15 downregulated proteins may be downstre ......" | 20186752 | |
| hsa-miR-34a-5p | liver cancer | downregulation | "However the correlation between miR-34a expression ......" | 23862748 | qPCR |
| hsa-miR-34a-5p | liver cancer | downregulation | "Previous studies have identified miR-34 family as ......" | 24704024 | Reverse transcription PCR |
| hsa-miR-34a-5p | lung cancer | downregulation | "miR-34a was identified as one of the downregulated ......" | 23036084 | |
| hsa-miR-34a-5p | lung cancer | downregulation | "The miR-34 family consists of tumor-suppressive mi ......" | 23805317 | |
| hsa-miR-34a-5p | lung squamous cell cancer | downregulation | "miR 34a as a prognostic marker of relapse in surgi ......" | 19736307 | Reverse transcription PCR |
| hsa-miR-34a-5p | lung squamous cell cancer | downregulation | "miR-34a and miR-15a/16 are functionally related; t ......" | 21575235 | qPCR |
| hsa-miR-34a-5p | lung squamous cell cancer | downregulation | "The miR-34 family is comprised of tumor-suppressiv ......" | 22047961 | |
| hsa-miR-34a-5p | lymphoma | deregulation | "We found miR-34a miR-146a and miR-193b to be up-re ......" | 25862860 | |
| hsa-miR-34a-5p | melanoma | downregulation | "Subsequently melanoma cell proliferation and migra ......" | 19029026 | |
| hsa-miR-34a-5p | melanoma | deregulation | "We determined the expression level of 16 potential ......" | 19830692 | qPCR |
| hsa-miR-34a-5p | melanoma | upregulation | "Microarray analysis was performed to measure miRNA ......" | 25982144 | Microarray; qPCR |
| hsa-miR-34a-5p | ovarian cancer | downregulation | "miR-34a expression was determined by quantitative ......" | 25895459 | qPCR |
| hsa-miR-34a-5p | prostate cancer | downregulation | "Multiple tumor-suppressive miRNAs were downregulat ......" | 22719071 | |
| hsa-miR-34a-5p | prostate cancer | downregulation | "Previous studies from our laboratory have shown th ......" | 23145211 | |
| hsa-miR-34a-5p | prostate cancer | downregulation | "Using novel high throughput technologies we identi ......" | 23573364 | |
| hsa-miR-34a-5p | prostate cancer | downregulation | "An analysis of miR-34a expression levels in matche ......" | 25587085 | |
| hsa-miR-34a-5p | prostate cancer | downregulation | "miR-34a is downregulated and a regulator of drug r ......" | 26499184 | |
| hsa-miR-34a-5p | sarcoma | upregulation | "miRNA expression was investigated in 49 primary EW ......" | 21960059 | qPCR; Microarray; in situ hybridization |
| hsa-miR-34a-5p | sarcoma | upregulation | "High expression of miR-34a in localized tumors was ......" | 25015333 | |
| hsa-miR-34a-5p | thyroid cancer | upregulation | "MiR-34a is best known as a tumor suppressor throug ......" | 24220341 |
Reported cancer pathway affected by hsa-miR-34a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-34a-5p | acute myeloid leukemia | cell cycle pathway; Apoptosis pathway | "Profiling microRNA miRNA expression delineated TP5 ......" | 22810507 | |
| hsa-miR-34a-5p | acute myeloid leukemia | Apoptosis pathway | "Tumor suppressor miR 34a targets PD L1 and functio ......" | 25499621 | Luciferase |
| hsa-miR-34a-5p | bladder cancer | cell cycle pathway | "MiR 34a chemosensitizes bladder cancer cells to ci ......" | 21702042 | |
| hsa-miR-34a-5p | bladder cancer | cell cycle pathway; Apoptosis pathway | "Expression and role of miR 34a in bladder cancer; ......" | 23720881 | Flow cytometry |
| hsa-miR-34a-5p | bladder cancer | Epithelial mesenchymal transition pathway | "MicroRNA 34a functions as an anti metastatic micro ......" | 25551284 | Transwell assay; Luciferase |
| hsa-miR-34a-5p | bladder cancer | Apoptosis pathway | "miRNAs and their validated miRNA targets appear as ......" | 25572695 | Western blot |
| hsa-miR-34a-5p | breast cancer | Apoptosis pathway | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 | Western blot |
| hsa-miR-34a-5p | breast cancer | cell cycle pathway; Apoptosis pathway | "Downregulation of miR 34a in breast tumors is not ......" | 23292869 | |
| hsa-miR-34a-5p | breast cancer | PI3K/Akt signaling pathway | "MicroRNA 34a suppresses cell proliferation by targ ......" | 24050776 | Luciferase |
| hsa-miR-34a-5p | breast cancer | Apoptosis pathway | "Hyaluronic acid chitosan nanoparticles for co deli ......" | 24565525 | |
| hsa-miR-34a-5p | breast cancer | Apoptosis pathway | "To address this problem a miRNA-delivering nanocap ......" | 25044638 | |
| hsa-miR-34a-5p | breast cancer | cell cycle pathway | "Effects on potential targets were analyzed with qP ......" | 25064703 | Western blot |
| hsa-miR-34a-5p | breast cancer | Apoptosis pathway | "miR 34a may regulate sensitivity of breast cancer ......" | 25623761 | Western blot |
| hsa-miR-34a-5p | breast cancer | cell cycle pathway | "Phytochemical regulation of the tumor suppressive ......" | 25789847 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-34a-5p | breast cancer | Epithelial mesenchymal transition pathway | "Tumor suppressive microRNA 34a inhibits breast can ......" | 26678891 | |
| hsa-miR-34a-5p | breast cancer | Apoptosis pathway | "Conversely kallistatin stimulated expression of th ......" | 26790955 | |
| hsa-miR-34a-5p | breast cancer | Apoptosis pathway | "A novel miR 34a target protein kinase D1 stimulate ......" | 26895471 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | Notch signaling pathway | "MicroRNA 34a suppresses invasion through downregul ......" | 20351093 | Western blot; RNAi |
| hsa-miR-34a-5p | cervical and endocervical cancer | Apoptosis pathway | "MicroRNAs as biomarkers of cervical cancer develop ......" | 24402874 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | Apoptosis pathway | "The effects of lanthanum chloride on proliferation ......" | 26209160 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "miR-34 family members can form a p53-miR-34 positi ......" | 26619844 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway; Epithelial mesenchymal transition pathway | "microRNA 34a Upregulated Retinoic Acid Inducible G ......" | 26910120 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | p53 signaling pathway | "HPV E6/p53 mediated down regulation of miR 34a inh ......" | 27186405 | Colony formation |
| hsa-miR-34a-5p | chordoma | Apoptosis pathway | "MicroRNA 608 and microRNA 34a regulate chordoma ma ......" | 24621885 | |
| hsa-miR-34a-5p | colon cancer | Apoptosis pathway | "For instance miR-34a up-regulation corresponded wi ......" | 20433755 | |
| hsa-miR-34a-5p | colorectal cancer | Apoptosis pathway | "The miR-34 family members described as potential t ......" | 23183747 | |
| hsa-miR-34a-5p | colorectal cancer | Wnt signaling pathway | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 | |
| hsa-miR-34a-5p | colorectal cancer | Notch signaling pathway | "miR 34a sets the "sweet spot" for notch in colorec ......" | 23642356 | |
| hsa-miR-34a-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "The microRNA miR-34 family is a direct transcripti ......" | 24337371 | |
| hsa-miR-34a-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "miR 34a 5p suppresses colorectal cancer metastasis ......" | 25362853 | |
| hsa-miR-34a-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 | |
| hsa-miR-34a-5p | endometrial cancer | cell cycle pathway | "The Significance of miR 34a Expression in Endometr ......" | 26734589 | |
| hsa-miR-34a-5p | esophageal cancer | cell cycle pathway; Apoptosis pathway | "Inactivation of miR 34a by aberrant CpG methylatio ......" | 24528540 | |
| hsa-miR-34a-5p | esophageal cancer | Apoptosis pathway | "miR 34a inhibits the migration and invasion of eso ......" | 25954903 | Western blot |
| hsa-miR-34a-5p | esophageal cancer | Apoptosis pathway | "Clinical significance of microRNA 34a in esophagea ......" | 26782413 | |
| hsa-miR-34a-5p | gastric cancer | cell cycle pathway; Apoptosis pathway | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 | Western blot |
| hsa-miR-34a-5p | gastric cancer | Apoptosis pathway | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
| hsa-miR-34a-5p | gastric cancer | Apoptosis pathway | "We aimed to investigate the expression of microRNA ......" | 23264087 | MTT assay; Flow cytometry; Western blot |
| hsa-miR-34a-5p | gastric cancer | Apoptosis pathway | "miR 34a regulates cisplatin induce gastric cancer ......" | 24068565 | Western blot; Flow cytometry |
| hsa-miR-34a-5p | gastric cancer | Apoptosis pathway | "Luteolin Induces Apoptosis by Up regulating miR 34 ......" | 24988056 | |
| hsa-miR-34a-5p | gastric cancer | Apoptosis pathway | "Sirt7 promotes gastric cancer growth and inhibits ......" | 25860861 | Colony formation |
| hsa-miR-34a-5p | gastric cancer | Apoptosis pathway | "miR 335 directly while miR 34a indirectly modulate ......" | 26318298 | Flow cytometry; Transwell assay |
| hsa-miR-34a-5p | gastric cancer | cell cycle pathway; Apoptosis pathway; Notch signaling pathway | "An integrated approach of predicted miR 34a target ......" | 26622549 | |
| hsa-miR-34a-5p | gastric cancer | Apoptosis pathway | "Upregulation of microRNA 34a enhances the DDP sens ......" | 27513895 | |
| hsa-miR-34a-5p | glioblastoma | cell cycle pathway | "MicroRNA 34a inhibits glioblastoma growth by targe ......" | 19773441 | |
| hsa-miR-34a-5p | glioblastoma | Apoptosis pathway | "MicroRNA 34a targets notch1 and inhibits cell prol ......" | 21743299 | Colony formation |
| hsa-miR-34a-5p | glioblastoma | cell cycle pathway | "miR 34a functions as a tumor suppressor modulating ......" | 22580610 | |
| hsa-miR-34a-5p | glioblastoma | cell cycle pathway; Apoptosis pathway | "We focused on miR-34a which is known for its key r ......" | 27569663 | |
| hsa-miR-34a-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "MicroRNA 34a regulates epithelial mesenchymal tran ......" | 26323460 | Flow cytometry |
| hsa-miR-34a-5p | kidney renal cell cancer | cell cycle pathway; Apoptosis pathway | "Members of the miR-34 family have been shown to be ......" | 24503183 | Luciferase |
| hsa-miR-34a-5p | liver cancer | Apoptosis pathway | "miR 34a inhibits migration and invasion by down re ......" | 19006648 | |
| hsa-miR-34a-5p | liver cancer | cell cycle pathway; p53 signaling pathway | "The impact of miR 34a on protein output in hepatoc ......" | 20186752 | |
| hsa-miR-34a-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "The miR-34 family members are direct transcription ......" | 20309940 | |
| hsa-miR-34a-5p | liver cancer | Apoptosis pathway | "Underexpression of miR 34a in hepatocellular carci ......" | 23593387 | |
| hsa-miR-34a-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 34a targets Bcl 2 and sensitizes human he ......" | 23862748 | Luciferase; Western blot |
| hsa-miR-34a-5p | liver cancer | Apoptosis pathway | "Carboxymethyl Dextran Stabilized Polyethylenimine ......" | 27300477 | |
| hsa-miR-34a-5p | lung cancer | Apoptosis pathway | "MicroRNA 34a is an important component of PRIMA 1 ......" | 19921694 | Flow cytometry |
| hsa-miR-34a-5p | lung cancer | cell cycle pathway | "microRNA 34a sensitizes lung cancer cell lines to ......" | 23036084 | |
| hsa-miR-34a-5p | lung cancer | Apoptosis pathway | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 | |
| hsa-miR-34a-5p | lung cancer | Apoptosis pathway | "Downregulation of PEBP4 a target of miR 34a sensit ......" | 25038915 | Western blot; MTT assay; Flow cytometry; Luciferase |
| hsa-miR-34a-5p | lung cancer | Apoptosis pathway | "Negative feedback regulation of AXL by miR 34a mod ......" | 26667302 | |
| hsa-miR-34a-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "miR 34a and miR 15a/16 are co regulated in non sma ......" | 21575235 | Flow cytometry; RNAi |
| hsa-miR-34a-5p | lung squamous cell cancer | Apoptosis pathway | "Delta tocotrienol suppresses Notch 1 pathway by up ......" | 22438124 | |
| hsa-miR-34a-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "The miR-34 family under-expressed in-non small cel ......" | 22593438 | Flow cytometry |
| hsa-miR-34a-5p | lung squamous cell cancer | Apoptosis pathway | "Ectopic expression of miR 34a enhances radiosensit ......" | 23349340 | |
| hsa-miR-34a-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "Rhamnetin and cirsiliol induce radiosensitization ......" | 23902763 | |
| hsa-miR-34a-5p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 34a inhibits the proliferation and promot ......" | 25501507 | Luciferase; Western blot |
| hsa-miR-34a-5p | melanoma | cell cycle pathway | "MicroRNA 34a inhibits uveal melanoma cell prolifer ......" | 19029026 | Cell migration assay; Luciferase; Western blot |
| hsa-miR-34a-5p | melanoma | cell cycle pathway | "The authors' previous studies on miR-34a showed th ......" | 21051724 | Flow cytometry; Cell Proliferation Assay; Western blot |
| hsa-miR-34a-5p | ovarian cancer | Apoptosis pathway | "Frequent downregulation of miR 34 family in human ......" | 20145172 | |
| hsa-miR-34a-5p | ovarian cancer | cell cycle pathway | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 | Western blot |
| hsa-miR-34a-5p | ovarian cancer | cell cycle pathway | "The effect of miR-449 and miR-34 on the growth cel ......" | 26770455 | Flow cytometry; Cell Proliferation Assay |
| hsa-miR-34a-5p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "Expression and promotor hypermethylation of miR 34 ......" | 26879132 | |
| hsa-miR-34a-5p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA miR 34 inhibits human pancreatic cancer t ......" | 19714243 | |
| hsa-miR-34a-5p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "Targeting epigenetic regulation of miR 34a for tre ......" | 21909380 | |
| hsa-miR-34a-5p | pancreatic cancer | Apoptosis pathway | "Genistein inhibits cell growth and induces apoptos ......" | 23140286 | |
| hsa-miR-34a-5p | pancreatic cancer | MAPK signaling pathway | "In our previous studies we identified four microRN ......" | 27380024 | |
| hsa-miR-34a-5p | prostate cancer | Apoptosis pathway | "Using qPCR we showed that the level of miR-34a inc ......" | 18497571 | |
| hsa-miR-34a-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "Effects of miR 34a on cell growth and chemoresista ......" | 18834855 | |
| hsa-miR-34a-5p | prostate cancer | Apoptosis pathway | "MicroRNA 34a modulates c Myc transcriptional compl ......" | 22235332 | Luciferase |
| hsa-miR-34a-5p | prostate cancer | cell cycle pathway | "In this study we used quantitative real-time-PCR t ......" | 22719071 | |
| hsa-miR-34a-5p | prostate cancer | Wnt signaling pathway; Ras signaling pathway | "MicroRNA 34a regulates WNT/TCF7 signaling and inhi ......" | 25436980 | |
| hsa-miR-34a-5p | prostate cancer | Epithelial mesenchymal transition pathway | "LEF1 Targeting EMT in Prostate Cancer Invasion Is ......" | 25587085 | Luciferase |
| hsa-miR-34a-5p | prostate cancer | Apoptosis pathway | "Here we report that chitosan nanoparticle-mediated ......" | 26313360 | |
| hsa-miR-34a-5p | prostate cancer | Apoptosis pathway | "Methylation induced silencing of miR 34a enhances ......" | 26499184 | |
| hsa-miR-34a-5p | prostate cancer | cell cycle pathway | "miR 34a inhibits cell proliferation in prostate ca ......" | 26722316 | Western blot; Flow cytometry |
| hsa-miR-34a-5p | prostate cancer | Apoptosis pathway | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-34a-5p | retinoblastoma | cell cycle pathway | "To investigate differential expression of microRNA ......" | 21941147 | |
| hsa-miR-34a-5p | sarcoma | cell cycle pathway; Apoptosis pathway | "Frequent concomitant inactivation of miR 34a and m ......" | 21225432 | |
| hsa-miR-34a-5p | sarcoma | Notch signaling pathway | "MicroRNA 34a inhibits the proliferation and metast ......" | 22457788 | |
| hsa-miR-34a-5p | sarcoma | Apoptosis pathway | "MicroRNA 199a 3p and microRNA 34a regulate apoptos ......" | 24957404 | |
| hsa-miR-34a-5p | sarcoma | cell cycle pathway | "p53 dependent activation of microRNA 34a in respon ......" | 25490093 | |
| hsa-miR-34a-5p | sarcoma | cell cycle pathway; Apoptosis pathway | "Genetically engineered pre microRNA 34a prodrug su ......" | 27216562 | |
| hsa-miR-34a-5p | sarcoma | cell cycle pathway; Apoptosis pathway | "MiR 34a and miR 203 Inhibit Survivin Expression to ......" | 27326248 | Colony formation |
| hsa-miR-34a-5p | thyroid cancer | Apoptosis pathway | "MiR 34a targets GAS1 to promote cell proliferation ......" | 24220341 | Colony formation |
Reported cancer prognosis affected by hsa-miR-34a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-34a-5p | B cell lymphoma | poor survival | "Finally eight miRNAs were found to correlate with ......" | 18537969 | |
| hsa-miR-34a-5p | B cell lymphoma | malignant trasformation | "Myc mediated repression of microRNA 34a promotes h ......" | 21460242 | |
| hsa-miR-34a-5p | B cell lymphoma | malignant trasformation | "In this review we discuss miRNAs with essential fu ......" | 25541152 | |
| hsa-miR-34a-5p | B cell lymphoma | drug resistance; poor survival; differentiation | "High miR 34a expression improves response to doxor ......" | 26854484 | |
| hsa-miR-34a-5p | acute myeloid leukemia | progression; drug resistance; poor survival | "Profiling microRNA miRNA expression delineated TP5 ......" | 22810507 | |
| hsa-miR-34a-5p | acute myeloid leukemia | tumorigenesis | "Tumor suppressor miR 34a targets PD L1 and functio ......" | 25499621 | Luciferase |
| hsa-miR-34a-5p | bladder cancer | poor survival | "MiR 34a chemosensitizes bladder cancer cells to ci ......" | 21702042 | |
| hsa-miR-34a-5p | bladder cancer | tumor size | "Expression and role of miR 34a in bladder cancer; ......" | 23720881 | Flow cytometry |
| hsa-miR-34a-5p | bladder cancer | worse prognosis | "miR 34 is associated with poor prognosis of patien ......" | 24078448 | |
| hsa-miR-34a-5p | bladder cancer | tumorigenesis | "Cisplatin induced epigenetic activation of miR 34a ......" | 24423412 | |
| hsa-miR-34a-5p | bladder cancer | cell migration; metastasis | "MicroRNA 34a functions as an anti metastatic micro ......" | 25551284 | Transwell assay; Luciferase |
| hsa-miR-34a-5p | bladder cancer | recurrence | "Expression of tumor suppressive microRNA 34a is as ......" | 25556547 | Colony formation |
| hsa-miR-34a-5p | bladder cancer | drug resistance | "Focusing on the major obstacle regarding MIBC pati ......" | 27586262 | |
| hsa-miR-34a-5p | breast cancer | drug resistance; poor survival | "The mir 34 microRNA is required for the DNA damage ......" | 19421141 | |
| hsa-miR-34a-5p | breast cancer | metastasis; staging | "The relative concentrations of breast cancer-assoc ......" | 21047409 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "MiRNA microarray analysis identified 299 and 226 m ......" | 21399894 | Luciferase |
| hsa-miR-34a-5p | breast cancer | metastasis; recurrence; poor survival | "MiR 34a expression has an effect for lower risk of ......" | 22102859 | |
| hsa-miR-34a-5p | breast cancer | malignant trasformation | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 | Western blot |
| hsa-miR-34a-5p | breast cancer | metastasis | "Here we describe the regulation and function of mi ......" | 23001043 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "MicroRNA 34a modulates chemosensitivity of breast ......" | 23085450 | Western blot; Flow cytometry; MTT assay; Luciferase |
| hsa-miR-34a-5p | breast cancer | metastasis; tumorigenesis | "Downregulation of miR 34a in breast tumors is not ......" | 23292869 | |
| hsa-miR-34a-5p | breast cancer | progression | "Deregulated serum concentrations of circulating ce ......" | 23748853 | |
| hsa-miR-34a-5p | breast cancer | poor survival | "Synergistic effects of curcumin with emodin agains ......" | 23771315 | Flow cytometry; Cell migration assay; MTT assay |
| hsa-miR-34a-5p | breast cancer | drug resistance; cell migration | "Hyaluronic acid chitosan nanoparticles for co deli ......" | 24565525 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "Neoadjuvant Chemotherapy in Breast Cancer Patients ......" | 25078559 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "We used RNAi-mediated p53 knockdown KD and antagom ......" | 25123132 | RNAi |
| hsa-miR-34a-5p | breast cancer | drug resistance; poor survival | "MiR 34a regulates therapy resistance by targeting ......" | 25173798 | |
| hsa-miR-34a-5p | breast cancer | metastasis | "Diallyl disulfide suppresses SRC/Ras/ERK signaling ......" | 25396727 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "MTT-cytotoxic miRNA microarray Real-time quantitat ......" | 25562151 | Western blot; Luciferase |
| hsa-miR-34a-5p | breast cancer | cell migration | "PEGylated thymoquinone nanoparticle mediated retar ......" | 25771001 | |
| hsa-miR-34a-5p | breast cancer | staging; metastasis | "MicroRNA 34a suppresses the breast cancer stem cel ......" | 25783790 | |
| hsa-miR-34a-5p | breast cancer | drug resistance; poor survival | "Phytochemical regulation of the tumor suppressive ......" | 25789847 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-34a-5p | breast cancer | malignant trasformation | "Dysregulation of the miR 34a SIRT1 axis inhibits b ......" | 25826085 | |
| hsa-miR-34a-5p | breast cancer | metastasis | "Using real-time quantitative polymerase chain reac ......" | 26124926 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "Furthermore several studies have documented that s ......" | 26310899 | |
| hsa-miR-34a-5p | breast cancer | cell migration; metastasis; staging; progression | "Tumor suppressive microRNA 34a inhibits breast can ......" | 26678891 | |
| hsa-miR-34a-5p | breast cancer | progression | "Conversely kallistatin stimulated expression of th ......" | 26790955 | |
| hsa-miR-34a-5p | breast cancer | drug resistance | "A novel miR 34a target protein kinase D1 stimulate ......" | 26895471 | |
| hsa-miR-34a-5p | breast cancer | metastasis; poor survival | "The miR 34a LDHA axis regulates glucose metabolism ......" | 26902416 | Luciferase |
| hsa-miR-34a-5p | breast cancer | progression | "MiR 34a Inhibits Breast Cancer Proliferation and P ......" | 27524218 | Luciferase; Western blot; MTT assay; Transwell assay; Wound Healing Assay |
| hsa-miR-34a-5p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | drug resistance | "MicroRNA 34a suppresses invasion through downregul ......" | 20351093 | Western blot; RNAi |
| hsa-miR-34a-5p | cervical and endocervical cancer | immune resistance; tumorigenesis | "MicroRNAs as biomarkers of cervical cancer develop ......" | 24402874 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | tumorigenesis | "MiR 34a Inhibits Viability and Invasion of Human P ......" | 25675046 | |
| hsa-miR-34a-5p | cervical and endocervical cancer | progression | "HPV E6/p53 mediated down regulation of miR 34a inh ......" | 27186405 | Colony formation |
| hsa-miR-34a-5p | colon cancer | drug resistance | "Dysregulation of microRNA 34a expression causes dr ......" | 21067862 | |
| hsa-miR-34a-5p | colon cancer | cell migration | "MicroRNA 34a inhibits migration and invasion of co ......" | 22198213 | |
| hsa-miR-34a-5p | colon cancer | metastasis | "Expression of miR 34 is lost in colon cancer which ......" | 22992310 | |
| hsa-miR-34a-5p | colon cancer | metastasis | "Detection of miR 34a promoter methylation in combi ......" | 23243217 | |
| hsa-miR-34a-5p | colon cancer | staging; differentiation; drug resistance | "A microRNA miR 34a regulated bimodal switch target ......" | 23642368 | |
| hsa-miR-34a-5p | colon cancer | drug resistance | "Inhibition of lactate dehydrogenase A by microRNA ......" | 25333573 | |
| hsa-miR-34a-5p | colon cancer | staging; tumorigenesis; progression | "The microRNA-34 family miR-34a -34b and -34c have ......" | 25894979 | |
| hsa-miR-34a-5p | colon cancer | metastasis | "MiR 34a inhibits colon cancer proliferation and me ......" | 26324236 | Luciferase; Western blot |
| hsa-miR-34a-5p | colon cancer | staging | "A miR 34a Numb Feedforward Loop Triggered by Infla ......" | 26849305 | |
| hsa-miR-34a-5p | colon cancer | staging | "A long non coding RNA targets microRNA miR 34a to ......" | 27077950 | |
| hsa-miR-34a-5p | colorectal cancer | staging; progression | "The quantitative analysis by stem loop real time P ......" | 22562822 | |
| hsa-miR-34a-5p | colorectal cancer | recurrence; staging; metastasis; differentiation | "Association between miR 34a expression and recurre ......" | 23355243 | |
| hsa-miR-34a-5p | colorectal cancer | staging | "Genome-wide microarray analysis of miRNA expressio ......" | 23673725 | |
| hsa-miR-34a-5p | colorectal cancer | metastasis | "Detection of miR 34a and miR 34b/c in stool sample ......" | 24573638 | |
| hsa-miR-34a-5p | colorectal cancer | metastasis; progression | "Members of the miR-34 family are induced by the tu ......" | 24642471 | |
| hsa-miR-34a-5p | colorectal cancer | staging; metastasis; recurrence; poor survival | "miR 34a 5p suppresses colorectal cancer metastasis ......" | 25362853 | |
| hsa-miR-34a-5p | colorectal cancer | progression; staging | "Circulating miRNAs miR 34a and miR 150 associated ......" | 25924769 | |
| hsa-miR-34a-5p | colorectal cancer | progression; metastasis | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 | |
| hsa-miR-34a-5p | colorectal cancer | drug resistance; metastasis | "For example overexpressing miR-34a a master regula ......" | 26518892 | |
| hsa-miR-34a-5p | colorectal cancer | staging; worse prognosis | "Serological under expression of microRNA 21 microR ......" | 27142899 | |
| hsa-miR-34a-5p | colorectal cancer | drug resistance; metastasis | "Downregulation of HMGB1 by miR 34a is sufficient t ......" | 27456356 | Luciferase |
| hsa-miR-34a-5p | endometrial cancer | cell migration | "Role of miR 34a as a suppressor of L1CAM in endome ......" | 24497324 | Luciferase |
| hsa-miR-34a-5p | endometrial cancer | tumorigenesis | "The Significance of miR 34a Expression in Endometr ......" | 26734589 | |
| hsa-miR-34a-5p | esophageal cancer | tumorigenesis; progression | "Transcriptional activation of microRNA 34a by NF k ......" | 22292433 | |
| hsa-miR-34a-5p | esophageal cancer | staging; metastasis; worse prognosis | "Inactivation of miR 34a by aberrant CpG methylatio ......" | 24528540 | |
| hsa-miR-34a-5p | esophageal cancer | metastasis | "miR 34a inhibits the migration and invasion of eso ......" | 25954903 | Western blot |
| hsa-miR-34a-5p | esophageal cancer | staging; differentiation; poor survival; progression; worse prognosis | "Clinical significance of microRNA 34a in esophagea ......" | 26782413 | |
| hsa-miR-34a-5p | esophageal cancer | progression; poor survival | "miR 34a inhibits the in vitro cell proliferation a ......" | 26944831 | Flow cytometry; Cell migration assay |
| hsa-miR-34a-5p | gastric cancer | poor survival; differentiation | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 | Western blot |
| hsa-miR-34a-5p | gastric cancer | drug resistance | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
| hsa-miR-34a-5p | gastric cancer | metastasis | "We previously identified five miRNAs miR-1 miR-20a ......" | 24122958 | |
| hsa-miR-34a-5p | gastric cancer | metastasis; cell migration | "MicroRNA 34A inhibits the growth invasion and meta ......" | 24837198 | Luciferase |
| hsa-miR-34a-5p | gastric cancer | tumorigenesis | "Previous studies have demonstrated that miR-34 fam ......" | 25658980 | |
| hsa-miR-34a-5p | gastric cancer | poor survival | "Sirt7 promotes gastric cancer growth and inhibits ......" | 25860861 | Colony formation |
| hsa-miR-34a-5p | gastric cancer | poor survival; recurrence; worse prognosis; staging; differentiation | "The prognostic value of miR 34a expression in comp ......" | 25932212 | |
| hsa-miR-34a-5p | gastric cancer | poor survival; staging; metastasis | "miR 335 directly while miR 34a indirectly modulate ......" | 26318298 | Flow cytometry; Transwell assay |
| hsa-miR-34a-5p | gastric cancer | progression; tumorigenesis; worse prognosis; staging; metastasis | "Prognostic Significance of MiR 34a Expression in P ......" | 26415802 | |
| hsa-miR-34a-5p | gastric cancer | metastasis | "MicroRNA 34a inhibits tumor invasion and metastasi ......" | 26464633 | Western blot |
| hsa-miR-34a-5p | gastric cancer | progression | "An integrated approach of predicted miR 34a target ......" | 26622549 | |
| hsa-miR-34a-5p | gastric cancer | metastasis; poor survival | "Nanovesicle mediated systemic delivery of microRNA ......" | 27497057 | |
| hsa-miR-34a-5p | gastric cancer | drug resistance | "Upregulation of microRNA 34a enhances the DDP sens ......" | 27513895 | |
| hsa-miR-34a-5p | glioblastoma | progression; poor survival | "MicroRNA 34a inhibits glioblastoma growth by targe ......" | 19773441 | |
| hsa-miR-34a-5p | glioblastoma | poor survival | "miR 34a functions as a tumor suppressor modulating ......" | 22580610 | |
| hsa-miR-34a-5p | glioblastoma | poor survival | "microRNA regulatory network inference identifies m ......" | 22750848 | |
| hsa-miR-34a-5p | head and neck cancer | poor survival | "Dysregulation of microRNA 34a expression in head a ......" | 22629428 | Colony formation |
| hsa-miR-34a-5p | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-34a-5p | head and neck cancer | metastasis | "MiR 34a suppresses amphiregulin and tumor metastat ......" | 25762634 | Luciferase |
| hsa-miR-34a-5p | kidney papillary renal cell cancer | staging; poor survival; progression | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-34a-5p | kidney renal cell cancer | malignant trasformation | "MicroRNA 34a suppresses malignant transformation b ......" | 22159222 | Luciferase |
| hsa-miR-34a-5p | liver cancer | metastasis; cell migration | "miR 34a inhibits migration and invasion by down re ......" | 19006648 | |
| hsa-miR-34a-5p | liver cancer | metastasis | "Identification of metastasis related microRNAs of ......" | 19912688 | |
| hsa-miR-34a-5p | liver cancer | cell migration | "The impact of miR 34a on protein output in hepatoc ......" | 20186752 | |
| hsa-miR-34a-5p | liver cancer | recurrence | "Sequencing and bioinformatics based analyses of th ......" | 21283620 | |
| hsa-miR-34a-5p | liver cancer | metastasis | "TGF β miR 34a CCL22 signaling induced Treg cell r ......" | 22975373 | |
| hsa-miR-34a-5p | liver cancer | progression; tumorigenesis; staging; metastasis | "Underexpression of miR 34a in hepatocellular carci ......" | 23593387 | |
| hsa-miR-34a-5p | liver cancer | tumorigenesis | "Numerous studies have focused on the association b ......" | 23632240 | |
| hsa-miR-34a-5p | liver cancer | poor survival; drug resistance | "MicroRNA 34a targets Bcl 2 and sensitizes human he ......" | 23862748 | Luciferase; Western blot |
| hsa-miR-34a-5p | liver cancer | tumorigenesis | "Previous studies have focused on the association o ......" | 23935875 | |
| hsa-miR-34a-5p | liver cancer | tumorigenesis | "Previous studies have identified miR-34 family as ......" | 24704024 | |
| hsa-miR-34a-5p | liver cancer | recurrence; progression; staging; tumor size | "MicroRNA 34a expression is predictive of recurrenc ......" | 25596083 | |
| hsa-miR-34a-5p | liver cancer | staging | "miR 34a induces cellular senescence via modulation ......" | 25686834 | |
| hsa-miR-34a-5p | liver cancer | staging | "This study investigated the potential of serum mic ......" | 26352740 | |
| hsa-miR-34a-5p | lung cancer | immune resistance | "Here we describe the development of a therapeutic ......" | 20570894 | |
| hsa-miR-34a-5p | lung cancer | tumorigenesis; progression | "The microRNA-34 mir-34 gene family members are dow ......" | 22964582 | |
| hsa-miR-34a-5p | lung cancer | drug resistance | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 | |
| hsa-miR-34a-5p | lung cancer | metastasis | "By developing an integrated bioinformatics analysi ......" | 26075299 | |
| hsa-miR-34a-5p | lung cancer | poor survival; recurrence; staging; metastasis | "The expression of microRNA 34a is inversely correl ......" | 26104764 | |
| hsa-miR-34a-5p | lung cancer | drug resistance | "In Vivo Delivery of miR 34a Sensitizes Lung Tumors ......" | 26670277 | |
| hsa-miR-34a-5p | lung squamous cell cancer | drug resistance; poor survival; recurrence | "miR 34a as a prognostic marker of relapse in surgi ......" | 19736307 | |
| hsa-miR-34a-5p | lung squamous cell cancer | staging; recurrence | "Recently miR-34 family has been shown to be part o ......" | 21383543 | |
| hsa-miR-34a-5p | lung squamous cell cancer | progression | "miR 34a and miR 15a/16 are co regulated in non sma ......" | 21575235 | Flow cytometry; RNAi |
| hsa-miR-34a-5p | lung squamous cell cancer | malignant trasformation | "miR-34a is known as a p53 regulated tumor suppress ......" | 21731696 | |
| hsa-miR-34a-5p | lung squamous cell cancer | staging | "Circulating miR 22 miR 24 and miR 34a as novel pre ......" | 23794259 | |
| hsa-miR-34a-5p | lung squamous cell cancer | poor survival | "Tumor-suppressive miR-34a a direct target of p53 h ......" | 24444609 | |
| hsa-miR-34a-5p | lung squamous cell cancer | poor survival | "Systemic nanodelivery of miR-34 and let-7 suppress ......" | 25174400 | |
| hsa-miR-34a-5p | lung squamous cell cancer | tumor size; staging | "Here we analyzed expression of miR-15a/16 miR-21 m ......" | 25384507 | |
| hsa-miR-34a-5p | lung squamous cell cancer | drug resistance | "Combinatorial Action of MicroRNAs let 7 and miR 34 ......" | 25714397 | |
| hsa-miR-34a-5p | lung squamous cell cancer | metastasis; worse prognosis; tumorigenesis | "Combined Effect of Metastasis Related MicroRNA miR ......" | 27444357 | |
| hsa-miR-34a-5p | lymphoma | worse prognosis | "Expression profiling of 664 miRNAs was investigate ......" | 23640973 | |
| hsa-miR-34a-5p | melanoma | poor survival; recurrence | "We determined the expression level of 16 potential ......" | 19830692 | |
| hsa-miR-34a-5p | melanoma | tumorigenesis | "Analysis of the miR 34a locus in 62 patients with ......" | 22198089 | |
| hsa-miR-34a-5p | melanoma | drug resistance | "To improve uveal melanoma specificity of adenoviru ......" | 24001901 | Luciferase |
| hsa-miR-34a-5p | melanoma | malignant trasformation | "5 Aminolevulinic acid mediated sonodynamic therapy ......" | 25982144 | Western blot |
| hsa-miR-34a-5p | ovarian cancer | motility; staging; progression | "Frequent downregulation of miR 34 family in human ......" | 20145172 | |
| hsa-miR-34a-5p | ovarian cancer | staging | "The aim of this study was to investigate whether m ......" | 22340095 | Western blot |
| hsa-miR-34a-5p | ovarian cancer | motility; metastasis; cell migration | "MiR 34a suppresses ovarian cancer proliferation an ......" | 25895459 | MTT assay; Transwell assay |
| hsa-miR-34a-5p | ovarian cancer | poor survival | "MiR 137 and miR 34a directly target Snail and inhi ......" | 27596137 | Western blot; Luciferase |
| hsa-miR-34a-5p | pancreatic cancer | poor survival | "MicroRNA miR 34 inhibits human pancreatic cancer t ......" | 19714243 | |
| hsa-miR-34a-5p | pancreatic cancer | poor survival | "Two miRNA candidates known to be downregulated in ......" | 21622730 | |
| hsa-miR-34a-5p | pancreatic cancer | progression | "Targeting epigenetic regulation of miR 34a for tre ......" | 21909380 | |
| hsa-miR-34a-5p | pancreatic cancer | drug resistance | "Furthermore several studies have documented that s ......" | 25250326 | |
| hsa-miR-34a-5p | prostate cancer | drug resistance | "Effects of miR 34a on cell growth and chemoresista ......" | 18834855 | |
| hsa-miR-34a-5p | prostate cancer | drug resistance | "MiR 34a attenuates paclitaxel resistance of hormon ......" | 20687223 | Western blot; Luciferase |
| hsa-miR-34a-5p | prostate cancer | metastasis; poor survival | "The microRNA miR 34a inhibits prostate cancer stem ......" | 21240262 | |
| hsa-miR-34a-5p | prostate cancer | metastasis | "Next generation sequencing technology was applied ......" | 21980368 | |
| hsa-miR-34a-5p | prostate cancer | cell migration | "MicroRNA 34a modulates c Myc transcriptional compl ......" | 22235332 | Luciferase |
| hsa-miR-34a-5p | prostate cancer | motility | "miR 34 cooperates with p53 in suppression of prost ......" | 24630988 | |
| hsa-miR-34a-5p | prostate cancer | progression; drug resistance; staging | "miR 34a is an intracellular and exosomal predictiv ......" | 25053345 | |
| hsa-miR-34a-5p | prostate cancer | metastasis; poor survival | "MicroRNA 34a regulates WNT/TCF7 signaling and inhi ......" | 25436980 | |
| hsa-miR-34a-5p | prostate cancer | metastasis | "Registered report: the microRNA miR 34a inhibits p ......" | 26231042 | Luciferase |
| hsa-miR-34a-5p | prostate cancer | metastasis; progression | "Here we report that chitosan nanoparticle-mediated ......" | 26313360 | |
| hsa-miR-34a-5p | prostate cancer | drug resistance | "Methylation induced silencing of miR 34a enhances ......" | 26499184 | |
| hsa-miR-34a-5p | prostate cancer | drug resistance | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-34a-5p | prostate cancer | progression | "Therefore identification of miRNAs could reveal a ......" | 26942553 | |
| hsa-miR-34a-5p | sarcoma | poor survival; progression; worse prognosis; malignant trasformation | "miR 34a predicts survival of Ewing's sarcoma patie ......" | 21960059 | |
| hsa-miR-34a-5p | sarcoma | metastasis | "MicroRNA 34a inhibits the proliferation and metast ......" | 22457788 | |
| hsa-miR-34a-5p | sarcoma | metastasis; cell migration | "miR 34a inhibits the metastasis of osteosarcoma ce ......" | 23314380 | Western blot |
| hsa-miR-34a-5p | sarcoma | worse prognosis; poor survival; metastasis | "Prognostic significance of miR 34a in Ewing sarcom ......" | 25015333 | |
| hsa-miR-34a-5p | sarcoma | drug resistance | "The present study aimed to employ the miRNA respon ......" | 25335093 | Luciferase |
| hsa-miR-34a-5p | sarcoma | drug resistance; progression | "p53 dependent activation of microRNA 34a in respon ......" | 25490093 | |
| hsa-miR-34a-5p | sarcoma | differentiation | "In parallel we observed the modulation of several ......" | 26123714 | |
| hsa-miR-34a-5p | sarcoma | staging; progression | "Recent progress on systemic delivery as well as cu ......" | 26380245 | |
| hsa-miR-34a-5p | sarcoma | differentiation | "CD99 regulates neural differentiation of Ewing sar ......" | 26616853 | |
| hsa-miR-34a-5p | sarcoma | drug resistance | "MiR 34a 5p promotes the multi drug resistance of o ......" | 27056900 | |
| hsa-miR-34a-5p | sarcoma | malignant trasformation | "Genetically engineered pre microRNA 34a prodrug su ......" | 27216562 | |
| hsa-miR-34a-5p | sarcoma | poor survival | "MiR 34a and miR 203 Inhibit Survivin Expression to ......" | 27326248 | Colony formation |
| hsa-miR-34a-5p | thyroid cancer | tumorigenesis | "MiR 34a targets GAS1 to promote cell proliferation ......" | 24220341 | Colony formation |
Reported gene related to hsa-miR-34a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-34a-5p | B cell lymphoma | TP53 | "Compared with p53 normal group the expression leve ......" | 23450486 |
| hsa-miR-34a-5p | acute myeloid leukemia | TP53 | "Profiling microRNA miRNA expression delineated TP5 ......" | 22810507 |
| hsa-miR-34a-5p | bladder cancer | TP53 | "For this purpose cell viability assay Realtime qua ......" | 25572695 |
| hsa-miR-34a-5p | bladder cancer | TP53 | "MiR 34a chemosensitizes bladder cancer cells to ci ......" | 21702042 |
| hsa-miR-34a-5p | breast cancer | TP53 | "As expected p53 loss caused downregulation of esta ......" | 25123132 |
| hsa-miR-34a-5p | breast cancer | TP53 | "Conversely kallistatin stimulated expression of th ......" | 26790955 |
| hsa-miR-34a-5p | breast cancer | TP53 | "In particular mammalian miR-34 is upregulated by p ......" | 19421141 |
| hsa-miR-34a-5p | breast cancer | TP53 | "Further studies indicated that PEG4000-TQ-Nps coul ......" | 25771001 |
| hsa-miR-34a-5p | breast cancer | TP53 | "Downregulation of miR 34a in breast tumors is not ......" | 23292869 |
| hsa-miR-34a-5p | breast cancer | TP53 | "Functional genomic analysis highlighted a novel re ......" | 22102859 |
| hsa-miR-34a-5p | breast cancer | TP53 | "Phytochemical regulation of the tumor suppressive ......" | 25789847 |
| hsa-miR-34a-5p | cervical and endocervical cancer | TP53 | "Knockdown of oncoprotein E6 expression of human pa ......" | 27186405 |
| hsa-miR-34a-5p | cervical and endocervical cancer | TP53 | "miR-34a is directly regulated by p53 and acts as t ......" | 24402874 |
| hsa-miR-34a-5p | colon cancer | TP53 | "MicroRNA-34a miR-34a a transcriptional target of p ......" | 22198213 |
| hsa-miR-34a-5p | colon cancer | TP53 | "The microRNA-34 family miR-34a -34b and -34c have ......" | 25894979 |
| hsa-miR-34a-5p | colorectal cancer | TP53 | "Members of the miR-34 family are induced by the tu ......" | 24642471 |
| hsa-miR-34a-5p | colorectal cancer | TP53 | "Ectopic expression of miR-34a-5p in p53 wild-type ......" | 25362853 |
| hsa-miR-34a-5p | colorectal cancer | TP53 | "The microRNA miR-34 family is a direct transcripti ......" | 24337371 |
| hsa-miR-34a-5p | colorectal cancer | TP53 | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 |
| hsa-miR-34a-5p | esophageal cancer | TP53 | "Reporter assay further showed that NF-kappaB-induc ......" | 22292433 |
| hsa-miR-34a-5p | esophageal cancer | TP53 | "p53 status was not correlated with miR-34a ......" | 26944831 |
| hsa-miR-34a-5p | esophageal cancer | TP53 | "MiR-34a a direct p53 target gene possesses tumor-s ......" | 24528540 |
| hsa-miR-34a-5p | gastric cancer | TP53 | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 |
| hsa-miR-34a-5p | gastric cancer | TP53 | "MicroRNA-34a miR-34a is a direct transcriptional t ......" | 25932212 |
| hsa-miR-34a-5p | glioblastoma | TP53 | "The high miR-34a expression level in the cells aft ......" | 23155233 |
| hsa-miR-34a-5p | glioblastoma | TP53 | "MicroRNA-34a miR-34a is a transcriptional target o ......" | 19773441 |
| hsa-miR-34a-5p | head and neck cancer | TP53 | "Among these we found well studied molecules such a ......" | 24209638 |
| hsa-miR-34a-5p | kidney renal cell cancer | TP53 | "Members of the miR-34 family have been shown to be ......" | 24503183 |
| hsa-miR-34a-5p | liver cancer | TP53 | "Accumulating evidence suggests that miR-34a as a k ......" | 20186752 |
| hsa-miR-34a-5p | liver cancer | TP53 | "Numerous studies have focused on the association b ......" | 23632240 |
| hsa-miR-34a-5p | liver cancer | TP53 | "The miR-34 family members are direct transcription ......" | 20309940 |
| hsa-miR-34a-5p | liver cancer | TP53 | "MiR-34a a direct target of p53 has been shown to t ......" | 23862748 |
| hsa-miR-34a-5p | lung cancer | TP53 | "microRNA 34a sensitizes lung cancer cell lines to ......" | 23036084 |
| hsa-miR-34a-5p | lung cancer | TP53 | "The above results suggest that microRNA-34a is one ......" | 19921694 |
| hsa-miR-34a-5p | lung cancer | TP53 | "In conclusion overexpression of PEBP4 reduced the ......" | 25038915 |
| hsa-miR-34a-5p | lung squamous cell cancer | TP53 | "Moreover re-expression of miR-34a by transfection ......" | 22438124 |
| hsa-miR-34a-5p | lung squamous cell cancer | TP53 | "Recently miR-34 family has been shown to be part o ......" | 21383543 |
| hsa-miR-34a-5p | lung squamous cell cancer | TP53 | "Tumor-suppressive miR-34a a direct target of p53 h ......" | 24444609 |
| hsa-miR-34a-5p | lung squamous cell cancer | TP53 | "miR-34a is known as a p53 regulated tumor suppress ......" | 21731696 |
| hsa-miR-34a-5p | lung squamous cell cancer | TP53 | "In addition in patients with sufficient tumor tiss ......" | 19736307 |
| hsa-miR-34a-5p | lung squamous cell cancer | TP53 | "The miR-34 family under-expressed in-non small cel ......" | 22593438 |
| hsa-miR-34a-5p | lung squamous cell cancer | TP53 | "miR-34a is transcriptionally induced by the tumor ......" | 23349340 |
| hsa-miR-34a-5p | melanoma | TP53 | "5 Aminolevulinic acid mediated sonodynamic therapy ......" | 25982144 |
| hsa-miR-34a-5p | melanoma | TP53 | "MicroRNA-34a miR-34a a potential key effector of t ......" | 19029026 |
| hsa-miR-34a-5p | ovarian cancer | TP53 | "Particularly miR-34a has been revealed to be a dir ......" | 26879132 |
| hsa-miR-34a-5p | ovarian cancer | TP53 | "The miR-34 family is directly transactivated by tu ......" | 25895459 |
| hsa-miR-34a-5p | ovarian cancer | TP53 | "The miR-34 family is directly transactivated by tu ......" | 20145172 |
| hsa-miR-34a-5p | ovarian cancer | TP53 | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 |
| hsa-miR-34a-5p | pancreatic cancer | TP53 | "Transcription of the three miRNA miR-34 family mem ......" | 19714243 |
| hsa-miR-34a-5p | pancreatic cancer | TP53 | "MicroRNA-34a miR-34a is a transcriptional target o ......" | 21909380 |
| hsa-miR-34a-5p | prostate cancer | TP53 | "Here we show through expression analysis that miR- ......" | 21240262 |
| hsa-miR-34a-5p | prostate cancer | TP53 | "miR 34 cooperates with p53 in suppression of prost ......" | 24630988 |
| hsa-miR-34a-5p | prostate cancer | TP53 | "It appears that AR-dependent inhibition of p53 res ......" | 18497571 |
| hsa-miR-34a-5p | prostate cancer | TP53 | "Tumor suppressor p53 transcriptionally regulates e ......" | 18834855 |
| hsa-miR-34a-5p | retinoblastoma | TP53 | "miR-34a expression could be increased in Y79 cells ......" | 19443717 |
| hsa-miR-34a-5p | sarcoma | TP53 | "Studies have demonstrated that miR-34a which is a ......" | 22457788 |
| hsa-miR-34a-5p | sarcoma | TP53 | "As a direct target gene of p53 miR-34a has been su ......" | 23569431 |
| hsa-miR-34a-5p | sarcoma | TP53 | "The results demonstrated that miR-199a and miR-34a ......" | 24957404 |
| hsa-miR-34a-5p | sarcoma | TP53 | "In this study we evaluated the cascade of events d ......" | 25490093 |
| hsa-miR-34a-5p | sarcoma | TP53 | "The microRNA encoding genes miR-34a and miR-34b/c ......" | 21225432 |
| hsa-miR-34a-5p | breast cancer | NOTCH1 | "In addition intracellular restoration of miR-34a i ......" | 24565525 |
| hsa-miR-34a-5p | breast cancer | NOTCH1 | "MicroRNA 34a suppresses the breast cancer stem cel ......" | 25783790 |
| hsa-miR-34a-5p | breast cancer | NOTCH1 | "We showed that miR-34a as a tumor suppressor could ......" | 27082152 |
| hsa-miR-34a-5p | breast cancer | NOTCH1 | "miR 34a may regulate sensitivity of breast cancer ......" | 25623761 |
| hsa-miR-34a-5p | breast cancer | NOTCH1 | "MicroRNA 34a modulates chemosensitivity of breast ......" | 23085450 |
| hsa-miR-34a-5p | cervical and endocervical cancer | NOTCH1 | "MicroRNA 34a suppresses invasion through downregul ......" | 20351093 |
| hsa-miR-34a-5p | colon cancer | NOTCH1 | "Mechanistically miR-34a sequesters Notch1 mRNA to ......" | 23642368 |
| hsa-miR-34a-5p | colon cancer | NOTCH1 | "The re-expression of miR-34 led to a marked reduct ......" | 22992310 |
| hsa-miR-34a-5p | glioblastoma | NOTCH1 | "MicroRNA 34a targets notch1 and inhibits cell prol ......" | 21743299 |
| hsa-miR-34a-5p | lung squamous cell cancer | NOTCH1 | "Delta tocotrienol suppresses Notch 1 pathway by up ......" | 22438124 |
| hsa-miR-34a-5p | lung squamous cell cancer | NOTCH1 | "Rhamnetin and cirsiliol induce radiosensitization ......" | 23902763 |
| hsa-miR-34a-5p | pancreatic cancer | NOTCH1 | "We found that Re-expression forced expression of m ......" | 23140286 |
| hsa-miR-34a-5p | prostate cancer | NOTCH1 | "Most importantly BR-DIM intervention in PCa patien ......" | 24349627 |
| hsa-miR-34a-5p | prostate cancer | NOTCH1 | "Most importantly BR-DIM intervention in PCa patien ......" | 22347519 |
| hsa-miR-34a-5p | prostate cancer | NOTCH1 | "Inactivation of AR and Notch 1 signaling by miR 34 ......" | 23145211 |
| hsa-miR-34a-5p | sarcoma | NOTCH1 | "We also found that reexpression of miR-34a and miR ......" | 23430952 |
| hsa-miR-34a-5p | breast cancer | BCL2 | "In vitro and in vivo experiments showed that miR ......" | 24565525 |
| hsa-miR-34a-5p | breast cancer | BCL2 | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 |
| hsa-miR-34a-5p | breast cancer | BCL2 | "Quantitative PCR and western analysis confirmed de ......" | 21399894 |
| hsa-miR-34a-5p | colon cancer | BCL2 | "For instance miR-34a up-regulation corresponded wi ......" | 20433755 |
| hsa-miR-34a-5p | gastric cancer | BCL2 | "Target analysis indicated that micro RNA miR-34a d ......" | 24988056 |
| hsa-miR-34a-5p | gastric cancer | BCL2 | "miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......" | 18803879 |
| hsa-miR-34a-5p | glioblastoma | BCL2 | "The miR-34a expression levels in cells after irrad ......" | 23155233 |
| hsa-miR-34a-5p | liver cancer | BCL2 | "MicroRNA 34a targets Bcl 2 and sensitizes human he ......" | 23862748 |
| hsa-miR-34a-5p | lung cancer | BCL2 | "Tumors harvested from these lungs have elevated le ......" | 22964582 |
| hsa-miR-34a-5p | lung squamous cell cancer | BCL2 | "Functional analyses further indicate that restorat ......" | 24444609 |
| hsa-miR-34a-5p | pancreatic cancer | BCL2 | "Among the target proteins regulated by miR-34 are ......" | 19714243 |
| hsa-miR-34a-5p | prostate cancer | BCL2 | "Thus in PC3PR cells reduced expression of miR-34a ......" | 20687223 |
| hsa-miR-34a-5p | prostate cancer | BCL2 | "Manipulating miR-34a in prostate cancer cells conf ......" | 25053345 |
| hsa-miR-34a-5p | breast cancer | SIRT1 | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 |
| hsa-miR-34a-5p | breast cancer | SIRT1 | "Dysregulation of the miR 34a SIRT1 axis inhibits b ......" | 25826085 |
| hsa-miR-34a-5p | colon cancer | SIRT1 | "Sirt1 which is one of the target genes for miR-34a ......" | 21067862 |
| hsa-miR-34a-5p | colon cancer | SIRT1 | "Interestingly RES increased the intracellular expr ......" | 23954321 |
| hsa-miR-34a-5p | colorectal cancer | SIRT1 | "For example overexpressing miR-34a a master regula ......" | 26518892 |
| hsa-miR-34a-5p | melanoma | SIRT1 | "5 Aminolevulinic acid mediated sonodynamic therapy ......" | 25982144 |
| hsa-miR-34a-5p | prostate cancer | SIRT1 | "We aimed to elucidate the molecular mechanisms und ......" | 20687223 |
| hsa-miR-34a-5p | prostate cancer | SIRT1 | "miR 34a inhibits cell proliferation in prostate ca ......" | 26722316 |
| hsa-miR-34a-5p | prostate cancer | SIRT1 | "In addition the present micellar system facilitate ......" | 27126903 |
| hsa-miR-34a-5p | prostate cancer | SIRT1 | "In PC3 cell ectopic expression of miR-34a decrease ......" | 18834855 |
| hsa-miR-34a-5p | bladder cancer | CD44 | "The c-Myc and CD44 were confirmed as direct target ......" | 25572695 |
| hsa-miR-34a-5p | bladder cancer | CD44 | "Furthermore we identified CD44 as being targeted b ......" | 24423412 |
| hsa-miR-34a-5p | bladder cancer | CD44 | "MicroRNA 34a functions as an anti metastatic micro ......" | 25551284 |
| hsa-miR-34a-5p | breast cancer | CD44 | "Nanocomplex-assisted delivery of miR-34a induces c ......" | 25044638 |
| hsa-miR-34a-5p | gastric cancer | CD44 | "Nanovesicle mediated systemic delivery of microRNA ......" | 27497057 |
| hsa-miR-34a-5p | prostate cancer | CD44 | "The microRNA miR 34a inhibits prostate cancer stem ......" | 21240262 |
| hsa-miR-34a-5p | prostate cancer | CD44 | "Registered report: the microRNA miR 34a inhibits p ......" | 26231042 |
| hsa-miR-34a-5p | sarcoma | CD44 | "miR 34a inhibits the metastasis of osteosarcoma ce ......" | 23314380 |
| hsa-miR-34a-5p | colon cancer | MET | "Detection of miR 34a promoter methylation in combi ......" | 23243217 |
| hsa-miR-34a-5p | glioblastoma | MET | "miR-34a levels in human gliomas inversely correlat ......" | 19773441 |
| hsa-miR-34a-5p | liver cancer | MET | "Underexpression of miR 34a in hepatocellular carci ......" | 23593387 |
| hsa-miR-34a-5p | liver cancer | MET | "miR 34a inhibits migration and invasion by down re ......" | 19006648 |
| hsa-miR-34a-5p | lung cancer | MET | "The expression of microRNA 34a is inversely correl ......" | 26104764 |
| hsa-miR-34a-5p | melanoma | MET | "MicroRNA 34a inhibits uveal melanoma cell prolifer ......" | 19029026 |
| hsa-miR-34a-5p | sarcoma | MET | "c-Met is a target of miR-34a and regulates the mig ......" | 22457788 |
| hsa-miR-34a-5p | B cell lymphoma | MYC | "Myc mediated repression of microRNA 34a promotes h ......" | 21460242 |
| hsa-miR-34a-5p | bladder cancer | MYC | "The c-Myc and CD44 were confirmed as direct target ......" | 25572695 |
| hsa-miR-34a-5p | kidney renal cell cancer | MYC | "MicroRNA 34a suppresses malignant transformation b ......" | 22159222 |
| hsa-miR-34a-5p | liver cancer | MYC | "miR 34a induces cellular senescence via modulation ......" | 25686834 |
| hsa-miR-34a-5p | lymphoma | MYC | "Among them miR-34a was also associated with poor p ......" | 23640973 |
| hsa-miR-34a-5p | lymphoma | MYC | "We report that miR-34a did not inhibit cell prolif ......" | 22830357 |
| hsa-miR-34a-5p | prostate cancer | MYC | "MicroRNA 34a modulates c Myc transcriptional compl ......" | 22235332 |
| hsa-miR-34a-5p | prostate cancer | AR | "In this study we found loss of miR-34a which targe ......" | 24349627 |
| hsa-miR-34a-5p | prostate cancer | AR | "In this study we found loss of miR-34a which targe ......" | 22347519 |
| hsa-miR-34a-5p | prostate cancer | AR | "In particular analysis of clinical prostate cancer ......" | 21343391 |
| hsa-miR-34a-5p | prostate cancer | AR | "To explore further the possible role of miRNAs in ......" | 25920548 |
| hsa-miR-34a-5p | prostate cancer | AR | "Repression of miR-34a a known AR-targeting miRNA c ......" | 25797256 |
| hsa-miR-34a-5p | prostate cancer | AR | "Inactivation of AR and Notch 1 signaling by miR 34 ......" | 23145211 |
| hsa-miR-34a-5p | cervical and endocervical cancer | E2F3 | "MiR 34a Inhibits Viability and Invasion of Human P ......" | 25675046 |
| hsa-miR-34a-5p | colon cancer | E2F3 | "The ectopic expression of miR-34a in the 5-FU-resi ......" | 21067862 |
| hsa-miR-34a-5p | colon cancer | E2F3 | "Interestingly RES increased the intracellular expr ......" | 23954321 |
| hsa-miR-34a-5p | colorectal cancer | E2F3 | "For example overexpressing miR-34a a master regula ......" | 26518892 |
| hsa-miR-34a-5p | head and neck cancer | E2F3 | "miR-34a overexpression also markedly downregulated ......" | 22629428 |
| hsa-miR-34a-5p | chordoma | EGFR | "We find that miR-34a inversely correlates with MET ......" | 24621885 |
| hsa-miR-34a-5p | glioblastoma | EGFR | "miR 34a functions as a tumor suppressor modulating ......" | 22580610 |
| hsa-miR-34a-5p | lung cancer | EGFR | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 |
| hsa-miR-34a-5p | lung squamous cell cancer | EGFR | "This effect was observed over a wide range of miRN ......" | 25714397 |
| hsa-miR-34a-5p | breast cancer | PCNA | "High miR-34a expression associated with poor progn ......" | 22102859 |
| hsa-miR-34a-5p | glioblastoma | PCNA | "Forced expression of miR-34a in GBM cells decrease ......" | 22580610 |
| hsa-miR-34a-5p | liver cancer | PCNA | "This inhibition of proliferation was associated wi ......" | 25792709 |
| hsa-miR-34a-5p | lung cancer | PCNA | "The effect of simultaneous overexpression of miR-4 ......" | 25909221 |
| hsa-miR-34a-5p | colon cancer | SNAI1 | "Using a case-control study design of 94 primary co ......" | 23243217 |
| hsa-miR-34a-5p | colorectal cancer | SNAI1 | "EMT-TFs and microRNAs such as ZEB1/2 and miR-200 o ......" | 27573895 |
| hsa-miR-34a-5p | ovarian cancer | SNAI1 | "MiR 137 and miR 34a directly target Snail and inhi ......" | 27596137 |
| hsa-miR-34a-5p | pancreatic cancer | SNAI1 | "Metformin but not rapamycin reduced glucose and in ......" | 25576058 |
| hsa-miR-34a-5p | breast cancer | AXL | "We identified human miR-34a expression as being >3 ......" | 21814748 |
| hsa-miR-34a-5p | lung cancer | AXL | "Negative feedback regulation of AXL by miR 34a mod ......" | 26667302 |
| hsa-miR-34a-5p | ovarian cancer | AXL | "MiR 34a suppresses ovarian cancer proliferation an ......" | 25895459 |
| hsa-miR-34a-5p | bladder cancer | CASP3 | "The up-regulation of miR-34a in T24 cells contribu ......" | 23720881 |
| hsa-miR-34a-5p | gastric cancer | CASP3 | "The effects of miR-34 restoration were assessed by ......" | 18803879 |
| hsa-miR-34a-5p | retinoblastoma | CASP3 | "The tumor suppressor functions of miR-34a in RB ce ......" | 19443717 |
| hsa-miR-34a-5p | sarcoma | EWSR1 | "Functional analysis of miR-34a in EWS cell lines i ......" | 21960059 |
| hsa-miR-34a-5p | sarcoma | EWSR1 | "This study aimed to explore the role of miR-34A ex ......" | 25015333 |
| hsa-miR-34a-5p | sarcoma | EWSR1 | "CD99 counteracts EWS-FLI1 in controlling NF-κB si ......" | 26616853 |
| hsa-miR-34a-5p | breast cancer | LDHA | "The miR 34a LDHA axis regulates glucose metabolism ......" | 26902416 |
| hsa-miR-34a-5p | cervical and endocervical cancer | LDHA | "HPV E6/p53 mediated down regulation of miR 34a inh ......" | 27186405 |
| hsa-miR-34a-5p | colon cancer | LDHA | "Inhibition of lactate dehydrogenase A by microRNA ......" | 25333573 |
| hsa-miR-34a-5p | breast cancer | NPS | "To address these problems miR-34a a potent endogen ......" | 24565525 |
| hsa-miR-34a-5p | breast cancer | NPS | "Moreover NPs mediated miR-34a up-regulation direct ......" | 25771001 |
| hsa-miR-34a-5p | lung squamous cell cancer | NPS | "To explore new therapeutic options we successfully ......" | 26406332 |
| hsa-miR-34a-5p | gastric cancer | TIMM8A | "Upregulation of microRNA 34a enhances the DDP sens ......" | 27513895 |
| hsa-miR-34a-5p | gastric cancer | TIMM8A | "As shown by Western blot and flow cytometry in com ......" | 24068565 |
| hsa-miR-34a-5p | lung cancer | TIMM8A | "microRNA 34a sensitizes lung cancer cell lines to ......" | 23036084 |
| hsa-miR-34a-5p | breast cancer | AKR1B1 | "To explore the influence of miR-34a on Notch1 expr ......" | 25623761 |
| hsa-miR-34a-5p | breast cancer | AKR1B1 | "The aim of this study is to evaluate the role of m ......" | 23085450 |
| hsa-miR-34a-5p | breast cancer | CCND1 | "Quantitative PCR and western analysis confirmed de ......" | 21399894 |
| hsa-miR-34a-5p | liver cancer | CCND1 | "This inhibition of proliferation was associated wi ......" | 25792709 |
| hsa-miR-34a-5p | sarcoma | CD99 | "CD99 counteracts EWS-FLI1 in controlling NF-κB si ......" | 26616853 |
| hsa-miR-34a-5p | sarcoma | CD99 | "To decipher their impact on the modified transcrip ......" | 26123714 |
| hsa-miR-34a-5p | bladder cancer | CDK6 | "Molecular analyses identified Cdk6 and sirtuin SIR ......" | 21702042 |
| hsa-miR-34a-5p | lung cancer | CDK6 | "The expression of microRNA 34a is inversely correl ......" | 26104764 |
| hsa-miR-34a-5p | endometrial cancer | CDKN2A | "The Significance of miR 34a Expression in Endometr ......" | 26734589 |
| hsa-miR-34a-5p | head and neck cancer | CDKN2A | "MiR-34a tumor levels significantly correlated with ......" | 25862914 |
| hsa-miR-34a-5p | breast cancer | FOSL1 | "Moreover significant downregulation of miR-34a in ......" | 23001043 |
| hsa-miR-34a-5p | colon cancer | FOSL1 | "MicroRNA 34a inhibits migration and invasion of co ......" | 22198213 |
| hsa-miR-34a-5p | B cell lymphoma | FOXP1 | "Myc mediated repression of microRNA 34a promotes h ......" | 21460242 |
| hsa-miR-34a-5p | B cell lymphoma | FOXP1 | "Our data further support FOXP1 as a target of miR- ......" | 26854484 |
| hsa-miR-34a-5p | breast cancer | HDAC1 | "MiR 34a regulates therapy resistance by targeting ......" | 25173798 |
| hsa-miR-34a-5p | gastric cancer | HDAC1 | "The reverse transcription-quantitative polymerase ......" | 26035691 |
| hsa-miR-34a-5p | prostate cancer | ITGA2 | "Erratum: Epigenetic silencing of miR 34a in human ......" | 24349627 |
| hsa-miR-34a-5p | prostate cancer | ITGA2 | "Epigenetic silencing of miR 34a in human prostate ......" | 22347519 |
| hsa-miR-34a-5p | kidney renal cell cancer | RHOA | "miR-34a was also found to repress RhoA expression ......" | 22159222 |
| hsa-miR-34a-5p | prostate cancer | RHOA | "miR-34a was found to repress RhoA a regulator of c ......" | 22235332 |
| hsa-miR-34a-5p | lung squamous cell cancer | SCLC1 | "Overexpression or downregulation of miR-34a did no ......" | 21731696 |
| hsa-miR-34a-5p | lung squamous cell cancer | SCLC1 | "The methylation of miR-34a and miR-34b/c was obser ......" | 22047961 |
| hsa-miR-34a-5p | breast cancer | SRC | "Furthermore Src was identified as a target of miR- ......" | 25396727 |
| hsa-miR-34a-5p | breast cancer | SRC | "miR 34a Silences c SRC to Attenuate Tumor Growth i ......" | 26676753 |
| hsa-miR-34a-5p | colorectal cancer | VEGFA | "Dysregulation of microRNA 34a expression in colore ......" | 24370784 |
| hsa-miR-34a-5p | head and neck cancer | VEGFA | "Interestingly miR-34a inhibited tumor angiogenesis ......" | 22629428 |
| hsa-miR-34a-5p | breast cancer | ZNF77 | "Within the M0-cohort patients at advanced tumor st ......" | 21047409 |
| hsa-miR-34a-5p | lung squamous cell cancer | ZNF77 | "In human NSCLC tissues miR-34a expression level wa ......" | 25501507 |
| hsa-miR-34a-5p | liver cancer | AFP | "Low miR-34a level was associated with larger tumor ......" | 25596083 |
| hsa-miR-34a-5p | prostate cancer | AGO2 | "Downregulation of AGO2 enhanced expression of miR- ......" | 24805183 |
| hsa-miR-34a-5p | gastric cancer | AKT1 | "Moreover the cancer-associated cell signalling pat ......" | 24837198 |
| hsa-miR-34a-5p | breast cancer | ALDH1A1 | "Mammosphere formation and expression of the stemne ......" | 25783790 |
| hsa-miR-34a-5p | head and neck cancer | AREG | "MiR 34a suppresses amphiregulin and tumor metastat ......" | 25762634 |
| hsa-miR-34a-5p | lung squamous cell cancer | ARHGDIB | "Ectopic expression of miR 34a enhances radiosensit ......" | 23349340 |
| hsa-miR-34a-5p | prostate cancer | ATG4B | "Methylation induced silencing of miR 34a enhances ......" | 26499184 |
| hsa-miR-34a-5p | colorectal cancer | AXIN2 | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 |
| hsa-miR-34a-5p | prostate cancer | BIRC5 | "We demonstrate that miR-34a can directly interfere ......" | 25436980 |
| hsa-miR-34a-5p | glioblastoma | CASP9 | "The miR-34a expression levels in cells after irrad ......" | 23155233 |
| hsa-miR-34a-5p | liver cancer | CCL22 | "TGF β miR 34a CCL22 signaling induced Treg cell r ......" | 22975373 |
| hsa-miR-34a-5p | glioblastoma | CCNA1 | "Forced expression of miR-34a in GBM cells decrease ......" | 22580610 |
| hsa-miR-34a-5p | lung cancer | CCNE1 | "The effect of simultaneous overexpression of miR-4 ......" | 25909221 |
| hsa-miR-34a-5p | acute myeloid leukemia | CD274 | "Tumor suppressor miR 34a targets PD L1 and functio ......" | 25499621 |
| hsa-miR-34a-5p | prostate cancer | CD33 | "Tumors with exogenous miR-34a showed reduced level ......" | 26231042 |
| hsa-miR-34a-5p | breast cancer | CDC37 | "These findings show a role for mir-34 in both apop ......" | 19421141 |
| hsa-miR-34a-5p | breast cancer | CDK4 | "Real-time PCR and western blot analysis of extract ......" | 25789847 |
| hsa-miR-34a-5p | chordoma | CHDM | "We find that miR-608 and miR-34a expressions are d ......" | 24621885 |
| hsa-miR-34a-5p | gastric cancer | DAPK2 | "E2F 1 promotes DAPK2 induced anti tumor immunity o ......" | 27704360 |
| hsa-miR-34a-5p | head and neck cancer | DCLRE1C | "Ectopic expression of miR-34a also significantly i ......" | 22629428 |
| hsa-miR-34a-5p | cervical and endocervical cancer | DDX58 | "In our study RIG-I and miR-34a suppressed cell gro ......" | 26910120 |
| hsa-miR-34a-5p | colon cancer | DLD | "Dysregulation of microRNA 34a expression causes dr ......" | 21067862 |
| hsa-miR-34a-5p | lung squamous cell cancer | DLL1 | "Delta tocotrienol suppresses Notch 1 pathway by up ......" | 22438124 |
| hsa-miR-34a-5p | colon cancer | DROSHA | "Conversely bypassing Par-4 overexpression by direc ......" | 20433755 |
| hsa-miR-34a-5p | gastric cancer | E2F1 | "E2F 1 promotes DAPK2 induced anti tumor immunity o ......" | 27704360 |
| hsa-miR-34a-5p | colorectal cancer | E2F5 | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 |
| hsa-miR-34a-5p | glioblastoma | EGF | "Our experiments found that miR-34a was often delet ......" | 22580610 |
| hsa-miR-34a-5p | breast cancer | ERBB2 | "We report smart nanoprobe hyaluronic acid HA-based ......" | 22947044 |
| hsa-miR-34a-5p | colorectal cancer | FMNL2 | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 |
| hsa-miR-34a-5p | lung cancer | FRTS1 | "RFS were longer in adenocarcinoma patients with hi ......" | 26104764 |
| hsa-miR-34a-5p | liver cancer | FUT8 | "Furthermore using microRNA array we identified FUT ......" | 27533464 |
| hsa-miR-34a-5p | thyroid cancer | GAS1 | "MiR 34a targets GAS1 to promote cell proliferation ......" | 24220341 |
| hsa-miR-34a-5p | breast cancer | HDAC7 | "MiR 34a regulates therapy resistance by targeting ......" | 25173798 |
| hsa-miR-34a-5p | pancreatic cancer | HDAC9 | "This study aimed to investigate the functional sig ......" | 21909380 |
| hsa-miR-34a-5p | lung cancer | HGF | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 |
| hsa-miR-34a-5p | gastric cancer | HMGA2 | "miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......" | 18803879 |
| hsa-miR-34a-5p | colorectal cancer | HMGB1 | "Downregulation of HMGB1 by miR 34a is sufficient t ......" | 27456356 |
| hsa-miR-34a-5p | bladder cancer | HNF4G | "Luciferase assay was performed to verify the putat ......" | 25878394 |
| hsa-miR-34a-5p | prostate cancer | HOTAIR | "Genistein inhibits prostate cancer cell growth by ......" | 23936419 |
| hsa-miR-34a-5p | colorectal cancer | IL1RAPL1 | "MRX34 a miR-34a replacement is the first synthetic ......" | 26518892 |
| hsa-miR-34a-5p | colorectal cancer | IL6 | "Here we determined that exposure of human colorect ......" | 24642471 |
| hsa-miR-34a-5p | sarcoma | KCNH1 | "However the link between miR-34a and Eag1 in cance ......" | 23569431 |
| hsa-miR-34a-5p | endometrial cancer | L1CAM | "Role of miR 34a as a suppressor of L1CAM in endome ......" | 24497324 |
| hsa-miR-34a-5p | prostate cancer | LEF1 | "LEF1 Targeting EMT in Prostate Cancer Invasion Is ......" | 25587085 |
| hsa-miR-34a-5p | breast cancer | LEP | "Honokiol activates LKB1 miR 34a axis and antagoniz ......" | 26359358 |
| hsa-miR-34a-5p | endometrial cancer | LITAF | "This study was undertaken to analyze miR-34a expre ......" | 26734589 |
| hsa-miR-34a-5p | breast cancer | LMTK3 | "MicroRNA 34a suppresses cell proliferation by targ ......" | 24050776 |
| hsa-miR-34a-5p | gastric cancer | MAP2K6 | "In the final integrative analysis of gastric cance ......" | 26622549 |
| hsa-miR-34a-5p | breast cancer | MAVS | "Targeted expression of miR 34a using the T VISA sy ......" | 23032974 |
| hsa-miR-34a-5p | breast cancer | MAZ | "Functional genomic analysis highlighted a novel re ......" | 22102859 |
| hsa-miR-34a-5p | sarcoma | MEF2A | "In addition the activity of the MEF2 signaling pat ......" | 27056900 |
| hsa-miR-34a-5p | esophageal cancer | MMP2 | "The results showed that miR-34a overexpression inc ......" | 25954903 |
| hsa-miR-34a-5p | esophageal cancer | NFASC | "Transcriptional activation of microRNA 34a by NF k ......" | 22292433 |
| hsa-miR-34a-5p | esophageal cancer | NFKB1 | "Transcriptional activation of microRNA 34a by NF k ......" | 22292433 |
| hsa-miR-34a-5p | glioblastoma | NRGN | "We evaluated the capability of six NG derivatives ......" | 27569663 |
| hsa-miR-34a-5p | colon cancer | NUMB | "A miR 34a Numb Feedforward Loop Triggered by Infla ......" | 26849305 |
| hsa-miR-34a-5p | gastric cancer | PAEP | "Upregulation of Mir 34a in AGS Gastric Cancer Cell ......" | 26745070 |
| hsa-miR-34a-5p | colon cancer | PAWR | "Conversely bypassing Par-4 overexpression by direc ......" | 20433755 |
| hsa-miR-34a-5p | gastric cancer | PCBP2 | "The RNA binding protein PCBP2 facilitates gastric ......" | 24796666 |
| hsa-miR-34a-5p | glioblastoma | PDGFRA | "Mechanistically in addition to its direct regulati ......" | 22750848 |
| hsa-miR-34a-5p | gastric cancer | PDGFRB | "MicroRNA 34A inhibits the growth invasion and meta ......" | 24837198 |
| hsa-miR-34a-5p | lung cancer | PEBP4 | "Downregulation of PEBP4 a target of miR 34a sensit ......" | 25038915 |
| hsa-miR-34a-5p | bladder cancer | PECAM1 | "CD31 an endothelial cell-specific marker which sta ......" | 25551284 |
| hsa-miR-34a-5p | cervical and endocervical cancer | PLG | "Besides we identified that miR-34a affected cell i ......" | 20351093 |
| hsa-miR-34a-5p | breast cancer | PPR1 | "Two miRNAs miR-34a and miR-122 that were significa ......" | 25078559 |
| hsa-miR-34a-5p | lung cancer | PRIMA1 | "MicroRNA 34a is an important component of PRIMA 1 ......" | 19921694 |
| hsa-miR-34a-5p | breast cancer | PRKD1 | "A novel miR 34a target protein kinase D1 stimulate ......" | 26895471 |
| hsa-miR-34a-5p | endometrial cancer | PSME3 | "The Significance of miR 34a Expression in Endometr ......" | 26734589 |
| hsa-miR-34a-5p | lung squamous cell cancer | PTGS2 | "Furthermore restoration of miR-34a indirectly redu ......" | 23349340 |
| hsa-miR-34a-5p | colorectal cancer | PTK2 | "Dysregulation of microRNA 34a expression in colore ......" | 24370784 |
| hsa-miR-34a-5p | breast cancer | RAC1 | "Moreover NPs mediated miR-34a up-regulation direct ......" | 25771001 |
| hsa-miR-34a-5p | lung cancer | RAD51 | "In Vivo Delivery of miR 34a Sensitizes Lung Tumors ......" | 26670277 |
| hsa-miR-34a-5p | breast cancer | SERPINA4 | "Conversely kallistatin stimulated expression of th ......" | 26790955 |
| hsa-miR-34a-5p | gastric cancer | SIRT7 | "Sirt7 promotes gastric cancer growth and inhibits ......" | 25860861 |
| hsa-miR-34a-5p | liver cancer | SLC25A19 | "The aim of the current study was to investigate th ......" | 27165229 |
| hsa-miR-34a-5p | glioblastoma | SMAD4 | "Mechanistically in addition to its direct regulati ......" | 22750848 |
| hsa-miR-34a-5p | pancreatic cancer | SNAI2 | "Metformin but not rapamycin reduced glucose and in ......" | 25576058 |
| hsa-miR-34a-5p | colon cancer | SPEN | "Mechanistically miR-34a sequesters Notch1 mRNA to ......" | 23642368 |
| hsa-miR-34a-5p | colorectal cancer | STAT3 | "Here we determined that exposure of human colorect ......" | 24642471 |
| hsa-miR-34a-5p | breast cancer | STK11 | "Honokiol activates LKB1 miR 34a axis and antagoniz ......" | 26359358 |
| hsa-miR-34a-5p | colon cancer | TBATA | "Here we report a novel LncRNA Lnc34a that is enric ......" | 27077950 |
| hsa-miR-34a-5p | prostate cancer | TCF7 | "TCF7 a WNT signaling-related gene has been implica ......" | 25436980 |
| hsa-miR-34a-5p | sarcoma | TGFB1 | "To decipher their impact on the modified transcrip ......" | 26123714 |
| hsa-miR-34a-5p | gastric cancer | TGIF2 | "MicroRNA 34a inhibits tumor invasion and metastasi ......" | 26464633 |
| hsa-miR-34a-5p | liver cancer | TLR4 | "A functional variant at miR 34a binding site in to ......" | 25179842 |
| hsa-miR-34a-5p | breast cancer | TPD52 | "Tumor suppressive microRNA 34a inhibits breast can ......" | 26678891 |
| hsa-miR-34a-5p | lung cancer | TXK | "In this study we found that miR-34a and miR-34c ta ......" | 23805317 |
| hsa-miR-34a-5p | breast cancer | WNT1 | "MiR 34a Inhibits Breast Cancer Proliferation and P ......" | 27524218 |
| hsa-miR-34a-5p | prostate cancer | XRN1 | "Repression of miR-34a a known AR-targeting miRNA c ......" | 25797256 |
| hsa-miR-34a-5p | esophageal cancer | YY1 | "miR 34a inhibits the migration and invasion of eso ......" | 25954903 |
| hsa-miR-34a-5p | breast cancer | ZEB1 | "Finally an integral role of miR-34a is discovered ......" | 26359358 |
| hsa-miR-34a-5p | breast cancer | ZNF135 | "Within the M0-cohort patients at advanced tumor st ......" | 21047409 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-34a-5p | ACSL4 | 9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; PRAD | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.128; TCGA BRCA -0.108; TCGA CESC -0.172; TCGA COAD -0.115; TCGA HNSC -0.278; TCGA KIRC -0.321; TCGA KIRP -0.322; TCGA LUAD -0.297; TCGA PRAD -0.233 |
hsa-miR-34a-5p | AFAP1L2 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.177; TCGA BRCA -0.128; TCGA CESC -0.408; TCGA ESCA -0.318; TCGA HNSC -0.325; TCGA KIRC -0.46; TCGA KIRP -0.785; TCGA LIHC -0.261; TCGA PRAD -0.191; TCGA THCA -0.246; TCGA STAD -0.372; TCGA UCEC -0.329 |
hsa-miR-34a-5p | AHNAK | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.3; TCGA BRCA -0.149; TCGA CESC -0.26; TCGA ESCA -0.305; TCGA HNSC -0.457; TCGA KIRP -0.179; TCGA LIHC -0.107; TCGA PRAD -0.195; TCGA THCA -0.072; TCGA STAD -0.386; TCGA UCEC -0.179 |
hsa-miR-34a-5p | AXL | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.54; TCGA CESC -0.505; TCGA COAD -0.33; TCGA ESCA -0.407; TCGA HNSC -0.339; TCGA LIHC -0.372; TCGA LUAD -0.124; TCGA SARC -0.193; TCGA STAD -0.383; TCGA UCEC -0.216 |
hsa-miR-34a-5p | BCL2 | 9 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; PAAD; SARC; THCA; STAD | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.313; TCGA BRCA -0.217; TCGA ESCA -0.271; TCGA LIHC -0.113; TCGA LUAD -0.185; TCGA PAAD -0.399; TCGA SARC -0.123; TCGA THCA -0.496; TCGA STAD -0.33 |
hsa-miR-34a-5p | BIRC6 | 11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.08; TCGA BRCA -0.071; TCGA HNSC -0.231; TCGA KIRC -0.108; TCGA KIRP -0.162; TCGA LGG -0.113; TCGA LIHC -0.132; TCGA LUSC -0.109; TCGA PRAD -0.375; TCGA SARC -0.058; TCGA THCA -0.129 |
hsa-miR-34a-5p | CALD1 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.734; TCGA CESC -0.479; TCGA COAD -0.496; TCGA ESCA -0.596; TCGA HNSC -0.388; TCGA LUAD -0.221; TCGA LUSC -0.208; TCGA PRAD -0.197; TCGA SARC -0.373; TCGA STAD -0.766; TCGA UCEC -0.158 |
hsa-miR-34a-5p | CAPRIN1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD | miRNAWalker2 validate | TCGA BLCA -0.085; TCGA BRCA -0.087; TCGA CESC -0.109; TCGA HNSC -0.14; TCGA KIRC -0.11; TCGA KIRP -0.074; TCGA LGG -0.074; TCGA LUAD -0.128; TCGA LUSC -0.192; TCGA PRAD -0.22 |
hsa-miR-34a-5p | CDC5L | 14 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.101; TCGA COAD -0.069; TCGA HNSC -0.053; TCGA KIRC -0.071; TCGA KIRP -0.085; TCGA LGG -0.1; TCGA LUAD -0.169; TCGA LUSC -0.21; TCGA OV -0.067; TCGA PAAD -0.103; TCGA PRAD -0.135; TCGA SARC -0.077; TCGA STAD -0.056; TCGA UCEC -0.092 |
hsa-miR-34a-5p | CDKN2AIP | 9 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.085; TCGA BRCA -0.058; TCGA KIRC -0.226; TCGA KIRP -0.204; TCGA LUAD -0.094; TCGA PRAD -0.212; TCGA SARC -0.132; TCGA THCA -0.084; TCGA UCEC -0.095 |
hsa-miR-34a-5p | CDON | 13 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.693; TCGA BRCA -0.131; TCGA COAD -0.211; TCGA ESCA -0.344; TCGA KIRP -0.294; TCGA LGG -0.362; TCGA LUAD -0.273; TCGA PAAD -0.582; TCGA PRAD -0.475; TCGA SARC -0.172; TCGA THCA -0.76; TCGA STAD -0.709; TCGA UCEC -0.412 |
hsa-miR-34a-5p | CEP170 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.25; TCGA BRCA -0.074; TCGA CESC -0.146; TCGA COAD -0.121; TCGA HNSC -0.192; TCGA LGG -0.126; TCGA LIHC -0.082; TCGA LUAD -0.133; TCGA LUSC -0.118; TCGA PRAD -0.324; TCGA STAD -0.146 |
hsa-miR-34a-5p | DDX21 | 10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD | miRNAWalker2 validate | TCGA BLCA -0.179; TCGA COAD -0.152; TCGA HNSC -0.351; TCGA KIRC -0.187; TCGA KIRP -0.273; TCGA LGG -0.195; TCGA LIHC -0.146; TCGA LUAD -0.325; TCGA LUSC -0.204; TCGA PRAD -0.476 |
hsa-miR-34a-5p | DEGS1 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.342; TCGA COAD -0.102; TCGA ESCA -0.29; TCGA HNSC -0.2; TCGA LUAD -0.07; TCGA PRAD -0.262; TCGA SARC -0.068; TCGA STAD -0.101; TCGA UCEC -0.252 |
hsa-miR-34a-5p | DLL1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.163; TCGA BRCA -0.185; TCGA CESC -0.372; TCGA ESCA -0.249; TCGA HNSC -0.315; TCGA KIRP -0.509; TCGA LGG -0.589; TCGA LUAD -0.236; TCGA STAD -0.175; TCGA UCEC -0.155 |
hsa-miR-34a-5p | EMP1 | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.262; TCGA CESC -0.302; TCGA COAD -0.166; TCGA HNSC -0.177; TCGA KIRC -0.183; TCGA KIRP -0.323; TCGA LIHC -0.17; TCGA STAD -0.342; TCGA UCEC -0.267 |
hsa-miR-34a-5p | ESYT2 | 9 cancers: BLCA; ESCA; HNSC; KIRP; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.151; TCGA ESCA -0.142; TCGA HNSC -0.147; TCGA KIRP -0.065; TCGA PRAD -0.13; TCGA SARC -0.153; TCGA THCA -0.078; TCGA STAD -0.185; TCGA UCEC -0.054 |
hsa-miR-34a-5p | EXT2 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.084; TCGA BRCA -0.051; TCGA CESC -0.279; TCGA HNSC -0.257; TCGA KIRP -0.116; TCGA LIHC -0.055; TCGA LUAD -0.141; TCGA LUSC -0.167; TCGA OV -0.068; TCGA PRAD -0.153; TCGA UCEC -0.1 |
hsa-miR-34a-5p | FIGN | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; PAAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.281; TCGA BRCA -0.203; TCGA CESC -0.591; TCGA COAD -0.481; TCGA ESCA -0.607; TCGA HNSC -0.636; TCGA LGG -0.098; TCGA LIHC -0.557; TCGA LUAD -0.254; TCGA PAAD -0.428; TCGA STAD -0.533 |
hsa-miR-34a-5p | GAPVD1 | 13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.077; TCGA COAD -0.066; TCGA ESCA -0.115; TCGA HNSC -0.131; TCGA KIRC -0.084; TCGA KIRP -0.065; TCGA LGG -0.073; TCGA LIHC -0.061; TCGA LUAD -0.079; TCGA PAAD -0.134; TCGA PRAD -0.153; TCGA THCA -0.072; TCGA STAD -0.115 |
hsa-miR-34a-5p | GAS1 | 15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.927; TCGA CESC -0.657; TCGA COAD -0.442; TCGA ESCA -0.917; TCGA HNSC -0.216; TCGA KIRC -0.551; TCGA KIRP -0.463; TCGA LGG -0.095; TCGA LIHC -0.404; TCGA LUAD -0.218; TCGA LUSC -0.328; TCGA SARC -0.212; TCGA THCA -0.442; TCGA STAD -0.768; TCGA UCEC -0.667 |
hsa-miR-34a-5p | GEMIN5 | 10 cancers: BLCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.118; TCGA HNSC -0.076; TCGA KIRP -0.083; TCGA LGG -0.056; TCGA LUSC -0.099; TCGA PAAD -0.22; TCGA PRAD -0.147; TCGA SARC -0.111; TCGA THCA -0.05; TCGA UCEC -0.072 |
hsa-miR-34a-5p | GIGYF2 | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.069; TCGA BRCA -0.059; TCGA HNSC -0.095; TCGA KIRC -0.13; TCGA KIRP -0.081; TCGA LGG -0.064; TCGA LIHC -0.073; TCGA LUAD -0.052; TCGA PRAD -0.196; TCGA UCEC -0.06 |
hsa-miR-34a-5p | HUWE1 | 9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.074; TCGA HNSC -0.184; TCGA KIRC -0.201; TCGA KIRP -0.122; TCGA LGG -0.098; TCGA LUSC -0.121; TCGA PRAD -0.234; TCGA SARC -0.125; TCGA THCA -0.057 |
hsa-miR-34a-5p | IGF1R | 14 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PAAD; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.097; TCGA CESC -0.216; TCGA ESCA -0.54; TCGA HNSC -0.312; TCGA KIRC -0.199; TCGA KIRP -0.112; TCGA LGG -0.192; TCGA LIHC -0.278; TCGA LUSC -0.294; TCGA OV -0.18; TCGA PAAD -0.221; TCGA PRAD -0.361; TCGA SARC -0.182; TCGA STAD -0.255 |
hsa-miR-34a-5p | KIF5B | 10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.122; TCGA HNSC -0.16; TCGA KIRC -0.12; TCGA KIRP -0.101; TCGA LGG -0.1; TCGA LIHC -0.063; TCGA LUAD -0.153; TCGA PRAD -0.229; TCGA SARC -0.121; TCGA STAD -0.091 |
hsa-miR-34a-5p | LRRC40 | 12 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.106; TCGA BRCA -0.063; TCGA HNSC -0.125; TCGA KIRP -0.09; TCGA LGG -0.062; TCGA LIHC -0.135; TCGA LUAD -0.224; TCGA OV -0.089; TCGA PRAD -0.261; TCGA SARC -0.084; TCGA THCA -0.059; TCGA UCEC -0.082 |
hsa-miR-34a-5p | MAP1B | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.787; TCGA CESC -0.402; TCGA COAD -0.413; TCGA ESCA -0.703; TCGA HNSC -0.299; TCGA LUSC -0.405; TCGA PAAD -0.488; TCGA PRAD -0.228; TCGA SARC -0.236; TCGA STAD -0.736 |
hsa-miR-34a-5p | MAP3K7 | 13 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.08; TCGA CESC -0.115; TCGA COAD -0.058; TCGA HNSC -0.131; TCGA KIRC -0.08; TCGA KIRP -0.054; TCGA LIHC -0.07; TCGA LUAD -0.12; TCGA LUSC -0.151; TCGA OV -0.08; TCGA PRAD -0.224; TCGA SARC -0.058; TCGA STAD -0.094 |
hsa-miR-34a-5p | MTMR2 | 11 cancers: BLCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.1; TCGA CESC -0.205; TCGA COAD -0.084; TCGA HNSC -0.229; TCGA LGG -0.076; TCGA LIHC -0.174; TCGA LUAD -0.207; TCGA LUSC -0.171; TCGA OV -0.112; TCGA PRAD -0.089; TCGA STAD -0.091 |
hsa-miR-34a-5p | MTMR9 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.139; TCGA BRCA -0.059; TCGA CESC -0.098; TCGA HNSC -0.115; TCGA KIRC -0.171; TCGA KIRP -0.061; TCGA LGG -0.068; TCGA LIHC -0.176; TCGA LUAD -0.136; TCGA PAAD -0.194; TCGA SARC -0.12; TCGA STAD -0.233; TCGA UCEC -0.067 |
hsa-miR-34a-5p | MYC | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; THCA; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.36; TCGA BRCA -0.216; TCGA CESC -0.427; TCGA ESCA -0.343; TCGA HNSC -0.158; TCGA LGG -0.47; TCGA LUAD -0.161; TCGA THCA -0.103; TCGA UCEC -0.195 |
hsa-miR-34a-5p | NUCKS1 | 13 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.129; TCGA BRCA -0.067; TCGA KIRC -0.081; TCGA KIRP -0.094; TCGA LUAD -0.105; TCGA LUSC -0.13; TCGA OV -0.065; TCGA PAAD -0.105; TCGA PRAD -0.151; TCGA SARC -0.127; TCGA THCA -0.078; TCGA STAD -0.101; TCGA UCEC -0.115 |
hsa-miR-34a-5p | NUP98 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD | miRNAWalker2 validate | TCGA BLCA -0.095; TCGA BRCA -0.075; TCGA COAD -0.06; TCGA HNSC -0.16; TCGA KIRC -0.085; TCGA KIRP -0.13; TCGA LGG -0.053; TCGA LIHC -0.092; TCGA LUAD -0.088; TCGA LUSC -0.104; TCGA PRAD -0.182 |
hsa-miR-34a-5p | PDGFRA | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.295; TCGA BRCA -0.257; TCGA COAD -0.294; TCGA HNSC -0.279; TCGA KIRC -0.873; TCGA KIRP -0.661; TCGA LGG -0.508; TCGA LIHC -1.204; TCGA LUAD -0.21; TCGA PAAD -0.392; TCGA THCA -0.537; TCGA STAD -0.23 |
hsa-miR-34a-5p | PTMS | 9 cancers: BLCA; CESC; ESCA; LGG; LIHC; LUAD; OV; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.2; TCGA CESC -0.199; TCGA ESCA -0.278; TCGA LGG -0.116; TCGA LIHC -0.107; TCGA LUAD -0.152; TCGA OV -0.164; TCGA STAD -0.14; TCGA UCEC -0.134 |
hsa-miR-34a-5p | RAB3GAP2 | 9 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC | miRNAWalker2 validate | TCGA BLCA -0.063; TCGA COAD -0.071; TCGA HNSC -0.208; TCGA KIRC -0.107; TCGA KIRP -0.137; TCGA LUAD -0.092; TCGA LUSC -0.124; TCGA PRAD -0.264; TCGA SARC -0.062 |
hsa-miR-34a-5p | RAP2A | 10 cancers: BLCA; CESC; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.188; TCGA CESC -0.148; TCGA HNSC -0.211; TCGA LGG -0.286; TCGA LUAD -0.213; TCGA LUSC -0.139; TCGA PAAD -0.153; TCGA PRAD -0.192; TCGA STAD -0.104; TCGA UCEC -0.074 |
hsa-miR-34a-5p | RBM26 | 11 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA | miRNAWalker2 validate | TCGA BLCA -0.076; TCGA BRCA -0.065; TCGA HNSC -0.192; TCGA KIRP -0.109; TCGA LIHC -0.091; TCGA LUAD -0.089; TCGA LUSC -0.099; TCGA OV -0.064; TCGA PAAD -0.155; TCGA PRAD -0.232; TCGA THCA -0.079 |
hsa-miR-34a-5p | SENP1 | 14 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.085; TCGA BRCA -0.093; TCGA CESC -0.088; TCGA COAD -0.137; TCGA KIRP -0.165; TCGA LGG -0.122; TCGA LIHC -0.057; TCGA LUAD -0.191; TCGA LUSC -0.231; TCGA OV -0.07; TCGA PAAD -0.166; TCGA PRAD -0.239; TCGA SARC -0.097; TCGA UCEC -0.087 |
hsa-miR-34a-5p | SEPT7 | 11 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.176; TCGA CESC -0.122; TCGA COAD -0.144; TCGA HNSC -0.126; TCGA KIRP -0.078; TCGA LUAD -0.125; TCGA OV -0.064; TCGA PAAD -0.14; TCGA PRAD -0.133; TCGA STAD -0.161; TCGA UCEC -0.106 |
hsa-miR-34a-5p | SIRT1 | 15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.117; TCGA BRCA -0.123; TCGA COAD -0.087; TCGA HNSC -0.099; TCGA KIRC -0.084; TCGA KIRP -0.175; TCGA LGG -0.219; TCGA LIHC -0.099; TCGA LUAD -0.205; TCGA OV -0.076; TCGA PRAD -0.256; TCGA SARC -0.073; TCGA THCA -0.083; TCGA STAD -0.116; TCGA UCEC -0.124 |
hsa-miR-34a-5p | SNTB2 | 10 cancers: BLCA; CESC; COAD; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.171; TCGA CESC -0.171; TCGA COAD -0.085; TCGA HNSC -0.236; TCGA LUAD -0.108; TCGA PRAD -0.163; TCGA SARC -0.084; TCGA THCA -0.113; TCGA STAD -0.118; TCGA UCEC -0.143 |
hsa-miR-34a-5p | SNX12 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.143; TCGA BRCA -0.061; TCGA CESC -0.133; TCGA COAD -0.089; TCGA HNSC -0.309; TCGA KIRC -0.235; TCGA KIRP -0.091; TCGA LGG -0.077; TCGA LUAD -0.144; TCGA LUSC -0.134; TCGA PRAD -0.269; TCGA UCEC -0.099 |
hsa-miR-34a-5p | SOCS4 | 12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.085; TCGA COAD -0.104; TCGA HNSC -0.145; TCGA KIRC -0.236; TCGA KIRP -0.132; TCGA LGG -0.08; TCGA LIHC -0.088; TCGA LUAD -0.12; TCGA PRAD -0.186; TCGA SARC -0.076; TCGA THCA -0.081; TCGA STAD -0.074 |
hsa-miR-34a-5p | SON | 13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.082; TCGA BRCA -0.069; TCGA COAD -0.062; TCGA HNSC -0.179; TCGA KIRC -0.127; TCGA KIRP -0.18; TCGA LGG -0.073; TCGA LIHC -0.099; TCGA PAAD -0.116; TCGA PRAD -0.257; TCGA SARC -0.101; TCGA THCA -0.085; TCGA STAD -0.06 |
hsa-miR-34a-5p | STAG2 | 15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.085; TCGA BRCA -0.087; TCGA COAD -0.125; TCGA HNSC -0.2; TCGA KIRC -0.113; TCGA KIRP -0.239; TCGA LGG -0.14; TCGA LUAD -0.137; TCGA LUSC -0.161; TCGA PAAD -0.115; TCGA PRAD -0.335; TCGA SARC -0.147; TCGA THCA -0.086; TCGA STAD -0.054; TCGA UCEC -0.067 |
hsa-miR-34a-5p | STRAP | 10 cancers: BLCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.101; TCGA HNSC -0.084; TCGA KIRC -0.117; TCGA LGG -0.06; TCGA LUAD -0.197; TCGA LUSC -0.198; TCGA OV -0.136; TCGA PAAD -0.245; TCGA PRAD -0.112; TCGA UCEC -0.067 |
hsa-miR-34a-5p | SYNE2 | 9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.243; TCGA BRCA -0.081; TCGA HNSC -0.152; TCGA KIRC -0.31; TCGA KIRP -0.182; TCGA LGG -0.189; TCGA PRAD -0.151; TCGA SARC -0.333; TCGA THCA -0.157 |
hsa-miR-34a-5p | TMOD2 | 12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.323; TCGA CESC -0.305; TCGA COAD -0.177; TCGA HNSC -0.16; TCGA KIRP -0.191; TCGA LGG -0.056; TCGA LUAD -0.134; TCGA PAAD -0.349; TCGA PRAD -0.276; TCGA THCA -0.119; TCGA STAD -0.48; TCGA UCEC -0.231 |
hsa-miR-34a-5p | TNPO1 | 9 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA | miRNAWalker2 validate | TCGA BLCA -0.141; TCGA HNSC -0.138; TCGA KIRC -0.1; TCGA KIRP -0.099; TCGA LUAD -0.176; TCGA LUSC -0.106; TCGA PAAD -0.154; TCGA PRAD -0.225; TCGA THCA -0.127 |
hsa-miR-34a-5p | TNPO3 | 10 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.097; TCGA BRCA -0.072; TCGA HNSC -0.233; TCGA KIRC -0.106; TCGA LGG -0.13; TCGA LUAD -0.063; TCGA LUSC -0.133; TCGA PRAD -0.267; TCGA SARC -0.109; TCGA THCA -0.068 |
hsa-miR-34a-5p | TNRC18 | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUSC; SARC; THCA; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.081; TCGA BRCA -0.081; TCGA HNSC -0.156; TCGA KIRC -0.11; TCGA KIRP -0.085; TCGA LGG -0.109; TCGA LUSC -0.118; TCGA SARC -0.154; TCGA THCA -0.066; TCGA UCEC -0.075 |
hsa-miR-34a-5p | UBQLN2 | 10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.053; TCGA CESC -0.094; TCGA HNSC -0.236; TCGA KIRC -0.059; TCGA KIRP -0.095; TCGA LGG -0.072; TCGA PRAD -0.182; TCGA SARC -0.085; TCGA STAD -0.12; TCGA UCEC -0.112 |
hsa-miR-34a-5p | USP47 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.071; TCGA BRCA -0.052; TCGA CESC -0.117; TCGA HNSC -0.2; TCGA KIRC -0.052; TCGA KIRP -0.128; TCGA LUAD -0.078; TCGA PRAD -0.159; TCGA SARC -0.058; TCGA THCA -0.066; TCGA STAD -0.105 |
hsa-miR-34a-5p | VCL | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.247; TCGA CESC -0.307; TCGA COAD -0.145; TCGA ESCA -0.247; TCGA HNSC -0.31; TCGA KIRC -0.213; TCGA KIRP -0.239; TCGA LIHC -0.143; TCGA LUAD -0.121; TCGA LUSC -0.125; TCGA PRAD -0.221; TCGA SARC -0.298; TCGA STAD -0.388; TCGA UCEC -0.186 |
hsa-miR-34a-5p | ZFR | 13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.124; TCGA BRCA -0.053; TCGA COAD -0.112; TCGA HNSC -0.173; TCGA KIRC -0.146; TCGA KIRP -0.206; TCGA LUAD -0.171; TCGA LUSC -0.197; TCGA PAAD -0.167; TCGA PRAD -0.272; TCGA THCA -0.087; TCGA STAD -0.089; TCGA UCEC -0.059 |
hsa-miR-34a-5p | ZNF644 | 12 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.088; TCGA BRCA -0.075; TCGA KIRC -0.067; TCGA KIRP -0.166; TCGA LGG -0.091; TCGA LIHC -0.091; TCGA LUAD -0.108; TCGA PRAD -0.283; TCGA SARC -0.13; TCGA THCA -0.162; TCGA STAD -0.086; TCGA UCEC -0.129 |
hsa-miR-34a-5p | FOXJ2 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.166; TCGA BRCA -0.086; TCGA CESC -0.127; TCGA ESCA -0.145; TCGA HNSC -0.127; TCGA KIRP -0.106; TCGA LGG -0.137; TCGA LUAD -0.055; TCGA PAAD -0.107; TCGA PRAD -0.105; TCGA SARC -0.088; TCGA STAD -0.138 |
hsa-miR-34a-5p | NDST1 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.152; TCGA BRCA -0.073; TCGA CESC -0.186; TCGA ESCA -0.372; TCGA HNSC -0.278; TCGA KIRP -0.056; TCGA LUAD -0.107; TCGA PAAD -0.37; TCGA PRAD -0.201; TCGA STAD -0.111; TCGA UCEC -0.074 |
hsa-miR-34a-5p | ZYG11B | 11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.054; TCGA BRCA -0.074; TCGA HNSC -0.17; TCGA KIRC -0.162; TCGA KIRP -0.073; TCGA LUAD -0.069; TCGA PAAD -0.138; TCGA PRAD -0.229; TCGA SARC -0.084; TCGA STAD -0.222; TCGA UCEC -0.139 |
hsa-miR-34a-5p | AMOTL2 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.313; TCGA BRCA -0.088; TCGA CESC -0.195; TCGA ESCA -0.174; TCGA HNSC -0.19; TCGA LGG -0.349; TCGA THCA -0.164; TCGA STAD -0.138; TCGA UCEC -0.268 |
hsa-miR-34a-5p | GLCE | 9 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD | MirTarget; miRNATAP | TCGA BLCA -0.103; TCGA BRCA -0.09; TCGA KIRC -0.162; TCGA KIRP -0.17; TCGA LIHC -0.097; TCGA LUAD -0.238; TCGA LUSC -0.118; TCGA OV -0.076; TCGA PRAD -0.163 |
hsa-miR-34a-5p | P2RY14 | 10 cancers: BLCA; BRCA; CESC; COAD; KIRP; LUAD; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.507; TCGA BRCA -0.165; TCGA CESC -0.339; TCGA COAD -0.545; TCGA KIRP -0.276; TCGA LUAD -0.235; TCGA PAAD -0.548; TCGA PRAD -0.257; TCGA THCA -0.196; TCGA STAD -0.529 |
hsa-miR-34a-5p | RAB11FIP2 | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.12; TCGA BRCA -0.087; TCGA CESC -0.144; TCGA COAD -0.169; TCGA HNSC -0.154; TCGA KIRC -0.226; TCGA KIRP -0.078; TCGA LUAD -0.155; TCGA OV -0.107; TCGA PAAD -0.137; TCGA PRAD -0.236; TCGA THCA -0.163; TCGA STAD -0.213; TCGA UCEC -0.215 |
hsa-miR-34a-5p | MAPK1IP1L | 11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.079; TCGA HNSC -0.122; TCGA KIRC -0.188; TCGA KIRP -0.061; TCGA LGG -0.065; TCGA LIHC -0.082; TCGA LUAD -0.069; TCGA PAAD -0.08; TCGA PRAD -0.051; TCGA SARC -0.065; TCGA THCA -0.074 |
hsa-miR-34a-5p | GREM2 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.445; TCGA BRCA -0.196; TCGA COAD -0.667; TCGA ESCA -0.831; TCGA KIRC -0.707; TCGA KIRP -0.614; TCGA PAAD -0.774; TCGA SARC -0.556; TCGA STAD -1.094 |
hsa-miR-34a-5p | LRRC7 | 9 cancers: BLCA; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.578; TCGA KIRP -0.469; TCGA LIHC -0.515; TCGA PAAD -0.593; TCGA PRAD -0.802; TCGA SARC -0.922; TCGA THCA -0.903; TCGA STAD -1.324; TCGA UCEC -0.262 |
hsa-miR-34a-5p | KIAA1644 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.985; TCGA CESC -0.747; TCGA COAD -0.601; TCGA ESCA -0.733; TCGA HNSC -0.859; TCGA KIRP -0.376; TCGA LIHC -0.283; TCGA PAAD -0.382; TCGA THCA -0.235; TCGA STAD -0.982; TCGA UCEC -0.394 |
hsa-miR-34a-5p | CHM | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.148; TCGA BRCA -0.091; TCGA COAD -0.143; TCGA HNSC -0.218; TCGA KIRC -0.228; TCGA KIRP -0.173; TCGA LUAD -0.1; TCGA LUSC -0.085; TCGA PRAD -0.282; TCGA STAD -0.085; TCGA UCEC -0.133 |
hsa-miR-34a-5p | PDE4B | 10 cancers: BLCA; BRCA; COAD; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.507; TCGA BRCA -0.141; TCGA COAD -0.215; TCGA KIRP -0.189; TCGA LIHC -0.266; TCGA LUAD -0.241; TCGA PAAD -0.387; TCGA PRAD -0.202; TCGA THCA -0.286; TCGA STAD -0.149 |
hsa-miR-34a-5p | SMAD7 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; THCA; UCEC | MirTarget | TCGA BLCA -0.137; TCGA BRCA -0.08; TCGA CESC -0.162; TCGA HNSC -0.15; TCGA KIRC -0.139; TCGA KIRP -0.162; TCGA LGG -0.137; TCGA LIHC -0.189; TCGA THCA -0.162; TCGA UCEC -0.233 |
hsa-miR-34a-5p | ZBTB5 | 12 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.072; TCGA BRCA -0.088; TCGA KIRC -0.131; TCGA KIRP -0.051; TCGA LGG -0.228; TCGA LIHC -0.131; TCGA LUAD -0.091; TCGA LUSC -0.185; TCGA PAAD -0.15; TCGA PRAD -0.121; TCGA SARC -0.184; TCGA THCA -0.192 |
hsa-miR-34a-5p | SYNJ1 | 11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.083; TCGA COAD -0.107; TCGA HNSC -0.07; TCGA KIRC -0.151; TCGA KIRP -0.2; TCGA LIHC -0.094; TCGA PAAD -0.157; TCGA PRAD -0.216; TCGA SARC -0.101; TCGA THCA -0.126; TCGA STAD -0.08 |
hsa-miR-34a-5p | AP1S2 | 9 cancers: BLCA; CESC; COAD; ESCA; LUAD; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.427; TCGA CESC -0.252; TCGA COAD -0.317; TCGA ESCA -0.274; TCGA LUAD -0.148; TCGA PAAD -0.222; TCGA PRAD -0.128; TCGA STAD -0.459; TCGA UCEC -0.21 |
hsa-miR-34a-5p | ASTN1 | 13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.252; TCGA BRCA -0.543; TCGA COAD -0.606; TCGA ESCA -1.361; TCGA KIRC -0.666; TCGA KIRP -0.37; TCGA LGG -0.061; TCGA LUAD -0.501; TCGA OV -0.283; TCGA PAAD -1.156; TCGA SARC -0.419; TCGA STAD -1.338; TCGA UCEC -0.273 |
hsa-miR-34a-5p | STX17 | 10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.1; TCGA ESCA -0.112; TCGA HNSC -0.086; TCGA KIRC -0.142; TCGA KIRP -0.102; TCGA LIHC -0.116; TCGA PRAD -0.174; TCGA SARC -0.129; TCGA THCA -0.063; TCGA STAD -0.114 |
hsa-miR-34a-5p | OLFML1 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.397; TCGA CESC -0.258; TCGA COAD -0.252; TCGA ESCA -0.288; TCGA HNSC -0.272; TCGA KIRP -0.434; TCGA LIHC -0.176; TCGA LUAD -0.143; TCGA PAAD -0.286; TCGA THCA -0.363; TCGA STAD -0.365; TCGA UCEC -0.193 |
hsa-miR-34a-5p | PFKM | 13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.164; TCGA BRCA -0.157; TCGA CESC -0.223; TCGA ESCA -0.266; TCGA KIRC -0.269; TCGA LUAD -0.119; TCGA LUSC -0.157; TCGA OV -0.136; TCGA PAAD -0.207; TCGA PRAD -0.124; TCGA SARC -0.089; TCGA STAD -0.24; TCGA UCEC -0.321 |
hsa-miR-34a-5p | KCNK3 | 12 cancers: BLCA; COAD; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.572; TCGA COAD -0.612; TCGA KIRP -0.385; TCGA LGG -0.305; TCGA LIHC -0.595; TCGA LUAD -0.317; TCGA PAAD -1.034; TCGA PRAD -0.311; TCGA SARC -0.543; TCGA THCA -0.329; TCGA STAD -1.077; TCGA UCEC -0.524 |
hsa-miR-34a-5p | POU6F1 | 10 cancers: BLCA; BRCA; ESCA; KIRP; LGG; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.326; TCGA BRCA -0.117; TCGA ESCA -0.332; TCGA KIRP -0.076; TCGA LGG -0.13; TCGA PAAD -0.215; TCGA SARC -0.124; TCGA THCA -0.072; TCGA STAD -0.489; TCGA UCEC -0.075 |
hsa-miR-34a-5p | MEX3C | 14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.096; TCGA BRCA -0.07; TCGA CESC -0.186; TCGA HNSC -0.158; TCGA KIRC -0.09; TCGA KIRP -0.172; TCGA LGG -0.171; TCGA LIHC -0.18; TCGA LUAD -0.16; TCGA LUSC -0.177; TCGA PAAD -0.176; TCGA PRAD -0.234; TCGA STAD -0.065; TCGA UCEC -0.138 |
hsa-miR-34a-5p | ASB1 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.164; TCGA BRCA -0.099; TCGA CESC -0.11; TCGA HNSC -0.059; TCGA KIRC -0.249; TCGA KIRP -0.121; TCGA LGG -0.103; TCGA LIHC -0.076; TCGA PAAD -0.167; TCGA PRAD -0.066; TCGA THCA -0.124; TCGA STAD -0.196; TCGA UCEC -0.143 |
hsa-miR-34a-5p | ZDHHC15 | 11 cancers: BLCA; BRCA; COAD; KIRC; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.54; TCGA BRCA -0.147; TCGA COAD -0.357; TCGA KIRC -0.646; TCGA LGG -0.051; TCGA PAAD -0.535; TCGA PRAD -0.203; TCGA SARC -0.401; TCGA THCA -0.071; TCGA STAD -0.778; TCGA UCEC -0.526 |
hsa-miR-34a-5p | ZDHHC17 | 9 cancers: BLCA; BRCA; CESC; KIRP; LIHC; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.06; TCGA BRCA -0.117; TCGA CESC -0.101; TCGA KIRP -0.163; TCGA LIHC -0.106; TCGA PAAD -0.301; TCGA PRAD -0.144; TCGA STAD -0.237; TCGA UCEC -0.116 |
hsa-miR-34a-5p | LRCH1 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LIHC; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.24; TCGA BRCA -0.091; TCGA CESC -0.225; TCGA HNSC -0.2; TCGA KIRC -0.087; TCGA LIHC -0.086; TCGA LUAD -0.14; TCGA PRAD -0.279; TCGA THCA -0.065; TCGA STAD -0.207; TCGA UCEC -0.1 |
hsa-miR-34a-5p | KITLG | 9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.471; TCGA BRCA -0.193; TCGA CESC -0.351; TCGA KIRC -0.501; TCGA KIRP -0.526; TCGA LUAD -0.113; TCGA PRAD -0.333; TCGA THCA -0.235; TCGA STAD -0.185 |
hsa-miR-34a-5p | BRPF3 | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.097; TCGA BRCA -0.121; TCGA COAD -0.079; TCGA HNSC -0.142; TCGA KIRC -0.293; TCGA KIRP -0.252; TCGA LGG -0.119; TCGA LUSC -0.105; TCGA PAAD -0.14; TCGA PRAD -0.279; TCGA SARC -0.137; TCGA UCEC -0.135 |
hsa-miR-34a-5p | ALDH1L2 | 10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.665; TCGA COAD -0.331; TCGA ESCA -0.423; TCGA HNSC -0.467; TCGA LGG -0.241; TCGA LUSC -0.326; TCGA PAAD -0.443; TCGA PRAD -0.263; TCGA THCA -0.283; TCGA STAD -0.335 |
hsa-miR-34a-5p | MPP2 | 11 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUSC; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.331; TCGA COAD -0.295; TCGA ESCA -0.752; TCGA KIRC -0.497; TCGA LIHC -0.331; TCGA LUSC -0.323; TCGA PAAD -0.712; TCGA SARC -0.437; TCGA THCA -0.388; TCGA STAD -0.562; TCGA UCEC -0.342 |
hsa-miR-34a-5p | ZMYM4 | 11 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.057; TCGA BRCA -0.062; TCGA HNSC -0.105; TCGA KIRP -0.099; TCGA LGG -0.08; TCGA LUAD -0.066; TCGA LUSC -0.07; TCGA PRAD -0.206; TCGA THCA -0.063; TCGA STAD -0.072; TCGA UCEC -0.05 |
hsa-miR-34a-5p | MAPT | 10 cancers: BLCA; COAD; ESCA; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.388; TCGA COAD -0.462; TCGA ESCA -0.799; TCGA LGG -0.286; TCGA PAAD -0.842; TCGA PRAD -0.183; TCGA SARC -0.493; TCGA THCA -0.248; TCGA STAD -0.94; TCGA UCEC -0.255 |
hsa-miR-34a-5p | ZNF551 | 15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.098; TCGA BRCA -0.207; TCGA CESC -0.457; TCGA COAD -0.209; TCGA HNSC -0.17; TCGA KIRC -0.252; TCGA KIRP -0.216; TCGA LGG -0.164; TCGA LUAD -0.16; TCGA LUSC -0.155; TCGA PAAD -0.238; TCGA PRAD -0.395; TCGA SARC -0.277; TCGA THCA -0.173; TCGA STAD -0.087 |
hsa-miR-34a-5p | ARPP19 | 12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.056; TCGA CESC -0.108; TCGA COAD -0.13; TCGA HNSC -0.133; TCGA KIRC -0.095; TCGA KIRP -0.086; TCGA LUAD -0.16; TCGA OV -0.072; TCGA PAAD -0.142; TCGA PRAD -0.223; TCGA SARC -0.192; TCGA STAD -0.14 |
hsa-miR-34a-5p | SH3PXD2A | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.141; TCGA BRCA -0.124; TCGA CESC -0.213; TCGA ESCA -0.274; TCGA HNSC -0.277; TCGA KIRP -0.212; TCGA LIHC -0.092; TCGA LUSC -0.129; TCGA PRAD -0.149; TCGA STAD -0.26 |
hsa-miR-34a-5p | GPC6 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.756; TCGA CESC -0.343; TCGA COAD -0.379; TCGA ESCA -0.395; TCGA HNSC -0.469; TCGA LIHC -0.578; TCGA LUAD -0.386; TCGA PAAD -0.52; TCGA PRAD -0.251; TCGA STAD -0.394 |
hsa-miR-34a-5p | GAB1 | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.188; TCGA BRCA -0.081; TCGA CESC -0.174; TCGA ESCA -0.254; TCGA HNSC -0.319; TCGA KIRC -0.18; TCGA KIRP -0.076; TCGA LGG -0.133; TCGA LIHC -0.104; TCGA PRAD -0.324; TCGA SARC -0.125; TCGA THCA -0.08; TCGA STAD -0.365; TCGA UCEC -0.099 |
hsa-miR-34a-5p | CORO1C | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.393; TCGA CESC -0.139; TCGA COAD -0.09; TCGA ESCA -0.265; TCGA HNSC -0.219; TCGA LGG -0.221; TCGA LIHC -0.085; TCGA LUAD -0.154; TCGA PRAD -0.084; TCGA SARC -0.136; TCGA STAD -0.249 |
hsa-miR-34a-5p | TMCC3 | 9 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.399; TCGA CESC -0.436; TCGA HNSC -0.348; TCGA KIRP -0.082; TCGA LIHC -0.127; TCGA LUAD -0.211; TCGA PAAD -0.286; TCGA PRAD -0.244; TCGA UCEC -0.293 |
hsa-miR-34a-5p | ASXL2 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC | MirTarget | TCGA BLCA -0.273; TCGA BRCA -0.166; TCGA COAD -0.205; TCGA HNSC -0.503; TCGA KIRC -0.32; TCGA KIRP -0.273; TCGA LGG -0.078; TCGA LUAD -0.24; TCGA LUSC -0.215; TCGA PRAD -0.747; TCGA SARC -0.149 |
hsa-miR-34a-5p | PLEKHM3 | 12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.139; TCGA BRCA -0.206; TCGA HNSC -0.262; TCGA KIRC -0.154; TCGA KIRP -0.14; TCGA LUAD -0.158; TCGA PAAD -0.239; TCGA PRAD -0.451; TCGA SARC -0.121; TCGA THCA -0.204; TCGA STAD -0.343; TCGA UCEC -0.236 |
hsa-miR-34a-5p | KIAA1462 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.43; TCGA BRCA -0.129; TCGA CESC -0.298; TCGA COAD -0.304; TCGA HNSC -0.299; TCGA KIRP -0.346; TCGA LUAD -0.205; TCGA PAAD -0.249; TCGA STAD -0.183; TCGA UCEC -0.218 |
hsa-miR-34a-5p | DAAM1 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.315; TCGA CESC -0.326; TCGA COAD -0.118; TCGA ESCA -0.332; TCGA HNSC -0.568; TCGA KIRC -0.454; TCGA KIRP -0.285; TCGA LUAD -0.168; TCGA PAAD -0.285; TCGA PRAD -0.501; TCGA SARC -0.348; TCGA THCA -0.211; TCGA STAD -0.272 |
hsa-miR-34a-5p | TMEM55A | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.342; TCGA CESC -0.471; TCGA COAD -0.186; TCGA HNSC -0.275; TCGA KIRC -0.161; TCGA KIRP -0.13; TCGA LUAD -0.198; TCGA LUSC -0.214; TCGA STAD -0.515; TCGA UCEC -0.258 |
hsa-miR-34a-5p | STRN3 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.17; TCGA CESC -0.111; TCGA COAD -0.07; TCGA ESCA -0.159; TCGA HNSC -0.219; TCGA KIRC -0.116; TCGA KIRP -0.093; TCGA LGG -0.075; TCGA LIHC -0.141; TCGA PRAD -0.222; TCGA SARC -0.156; TCGA THCA -0.081; TCGA STAD -0.2 |
hsa-miR-34a-5p | ZFHX4 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.904; TCGA BRCA -0.169; TCGA CESC -0.44; TCGA COAD -0.423; TCGA ESCA -0.708; TCGA HNSC -0.373; TCGA LGG -0.195; TCGA LUAD -0.292; TCGA LUSC -0.757; TCGA PAAD -0.383; TCGA PRAD -0.351; TCGA THCA -0.301; TCGA STAD -0.685; TCGA UCEC -0.519 |
hsa-miR-34a-5p | SATB1 | 10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.129; TCGA BRCA -0.155; TCGA KIRC -0.299; TCGA KIRP -0.114; TCGA LGG -0.262; TCGA LIHC -0.374; TCGA PAAD -0.38; TCGA PRAD -0.171; TCGA THCA -0.077; TCGA STAD -0.578 |
hsa-miR-34a-5p | TCF12 | 11 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.16; TCGA HNSC -0.2; TCGA KIRP -0.151; TCGA LGG -0.466; TCGA LIHC -0.111; TCGA LUAD -0.183; TCGA LUSC -0.184; TCGA PRAD -0.295; TCGA SARC -0.08; TCGA THCA -0.084; TCGA STAD -0.121 |
hsa-miR-34a-5p | S1PR3 | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.229; TCGA COAD -0.407; TCGA ESCA -0.718; TCGA HNSC -0.169; TCGA KIRC -0.175; TCGA KIRP -0.541; TCGA LIHC -0.16; TCGA LUAD -0.189; TCGA SARC -0.21; TCGA STAD -0.592; TCGA UCEC -0.138 |
hsa-miR-34a-5p | RNF41 | 15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.094; TCGA BRCA -0.08; TCGA CESC -0.071; TCGA COAD -0.066; TCGA HNSC -0.077; TCGA KIRC -0.072; TCGA KIRP -0.051; TCGA LGG -0.052; TCGA LIHC -0.063; TCGA LUAD -0.18; TCGA LUSC -0.102; TCGA OV -0.095; TCGA PAAD -0.137; TCGA PRAD -0.139; TCGA UCEC -0.08 |
hsa-miR-34a-5p | RASL12 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.633; TCGA BRCA -0.205; TCGA COAD -0.382; TCGA ESCA -0.547; TCGA HNSC -0.142; TCGA KIRP -0.193; TCGA SARC -0.803; TCGA THCA -0.075; TCGA STAD -0.487; TCGA UCEC -0.277 |
hsa-miR-34a-5p | STK38L | 13 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.205; TCGA BRCA -0.105; TCGA KIRC -0.152; TCGA KIRP -0.189; TCGA LIHC -0.231; TCGA LUAD -0.186; TCGA LUSC -0.303; TCGA OV -0.126; TCGA PRAD -0.095; TCGA SARC -0.209; TCGA THCA -0.05; TCGA STAD -0.135; TCGA UCEC -0.112 |
hsa-miR-34a-5p | DIXDC1 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.723; TCGA BRCA -0.091; TCGA COAD -0.265; TCGA ESCA -0.372; TCGA HNSC -0.199; TCGA LUAD -0.234; TCGA OV -0.09; TCGA PAAD -0.321; TCGA PRAD -0.18; TCGA SARC -0.444; TCGA THCA -0.17; TCGA STAD -0.674; TCGA UCEC -0.169 |
hsa-miR-34a-5p | NAV3 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.718; TCGA BRCA -0.184; TCGA CESC -0.677; TCGA COAD -0.294; TCGA ESCA -0.869; TCGA HNSC -0.863; TCGA LUAD -0.188; TCGA PAAD -0.461; TCGA THCA -0.326; TCGA STAD -0.591; TCGA UCEC -0.254 |
hsa-miR-34a-5p | GMFB | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; OV; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.091; TCGA CESC -0.114; TCGA COAD -0.092; TCGA HNSC -0.175; TCGA KIRC -0.217; TCGA LUAD -0.241; TCGA OV -0.075; TCGA PRAD -0.184; TCGA UCEC -0.066 |
hsa-miR-34a-5p | AR | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.286; TCGA CESC -0.419; TCGA COAD -0.498; TCGA ESCA -0.663; TCGA HNSC -0.406; TCGA PRAD -0.723; TCGA SARC -0.724; TCGA THCA -0.854; TCGA STAD -0.916 |
hsa-miR-34a-5p | CRY2 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.17; TCGA BRCA -0.133; TCGA ESCA -0.164; TCGA HNSC -0.074; TCGA KIRC -0.234; TCGA LGG -0.092; TCGA PAAD -0.184; TCGA SARC -0.09; TCGA THCA -0.274; TCGA STAD -0.202 |
hsa-miR-34a-5p | ANK2 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.918; TCGA BRCA -0.316; TCGA COAD -0.492; TCGA ESCA -0.771; TCGA KIRC -0.481; TCGA KIRP -0.398; TCGA LIHC -0.382; TCGA LUAD -0.15; TCGA PAAD -0.857; TCGA THCA -0.939; TCGA STAD -0.905 |
hsa-miR-34a-5p | FGD6 | 9 cancers: BLCA; CESC; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.278; TCGA CESC -0.328; TCGA HNSC -0.264; TCGA LIHC -0.208; TCGA LUSC -0.169; TCGA PRAD -0.261; TCGA SARC -0.183; TCGA THCA -0.062; TCGA STAD -0.186 |
hsa-miR-34a-5p | ZMYND11 | 12 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.098; TCGA BRCA -0.073; TCGA KIRC -0.219; TCGA KIRP -0.116; TCGA LGG -0.17; TCGA LUAD -0.096; TCGA OV -0.088; TCGA PAAD -0.136; TCGA PRAD -0.222; TCGA THCA -0.16; TCGA STAD -0.212; TCGA UCEC -0.078 |
hsa-miR-34a-5p | WASF1 | 14 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.28; TCGA COAD -0.216; TCGA ESCA -0.552; TCGA KIRP -0.129; TCGA LGG -0.166; TCGA LIHC -0.177; TCGA LUAD -0.22; TCGA LUSC -0.425; TCGA OV -0.238; TCGA PAAD -0.397; TCGA PRAD -0.162; TCGA SARC -0.178; TCGA STAD -0.54; TCGA UCEC -0.295 |
hsa-miR-34a-5p | KIT | 13 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.312; TCGA BRCA -0.445; TCGA ESCA -0.421; TCGA KIRC -0.713; TCGA KIRP -0.664; TCGA LIHC -0.16; TCGA LUAD -0.262; TCGA OV -0.203; TCGA PAAD -0.453; TCGA PRAD -0.259; TCGA THCA -1.123; TCGA STAD -0.557; TCGA UCEC -0.158 |
hsa-miR-34a-5p | XYLT1 | 9 cancers: BLCA; BRCA; HNSC; LIHC; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.249; TCGA BRCA -0.162; TCGA HNSC -0.416; TCGA LIHC -0.19; TCGA LUSC -0.34; TCGA PRAD -0.396; TCGA THCA -0.165; TCGA STAD -0.169; TCGA UCEC -0.174 |
hsa-miR-34a-5p | PLN | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -1.198; TCGA CESC -0.512; TCGA COAD -0.813; TCGA ESCA -0.974; TCGA HNSC -0.306; TCGA KIRC -0.18; TCGA KIRP -0.502; TCGA LGG -0.18; TCGA LUAD -0.268; TCGA PAAD -0.474; TCGA SARC -0.896; TCGA THCA -0.38; TCGA STAD -1.228; TCGA UCEC -0.43 |
hsa-miR-34a-5p | SCML2 | 12 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.56; TCGA COAD -0.338; TCGA KIRC -0.235; TCGA KIRP -0.139; TCGA LGG -0.252; TCGA LUAD -0.411; TCGA LUSC -0.605; TCGA PAAD -0.693; TCGA SARC -0.364; TCGA THCA -0.514; TCGA STAD -0.4; TCGA UCEC -0.269 |
hsa-miR-34a-5p | PDGFRB | 9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; THCA; STAD | MirTarget | TCGA BLCA -0.368; TCGA BRCA -0.092; TCGA CESC -0.313; TCGA COAD -0.211; TCGA HNSC -0.417; TCGA KIRP -0.516; TCGA LUAD -0.088; TCGA THCA -0.086; TCGA STAD -0.148 |
hsa-miR-34a-5p | ZNF281 | 13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA | MirTarget; miRNATAP | TCGA BLCA -0.302; TCGA BRCA -0.164; TCGA COAD -0.222; TCGA HNSC -0.527; TCGA KIRC -0.136; TCGA KIRP -0.426; TCGA LGG -0.181; TCGA LIHC -0.195; TCGA LUAD -0.202; TCGA LUSC -0.148; TCGA PRAD -0.612; TCGA SARC -0.322; TCGA THCA -0.208 |
hsa-miR-34a-5p | SCN2B | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.945; TCGA BRCA -0.317; TCGA CESC -0.552; TCGA COAD -0.52; TCGA ESCA -0.956; TCGA HNSC -0.465; TCGA KIRC -0.904; TCGA STAD -1.131; TCGA UCEC -0.777 |
hsa-miR-34a-5p | ZNF641 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.214; TCGA BRCA -0.212; TCGA CESC -0.244; TCGA COAD -0.157; TCGA ESCA -0.122; TCGA HNSC -0.261; TCGA KIRC -0.244; TCGA KIRP -0.232; TCGA LGG -0.053; TCGA LIHC -0.221; TCGA LUAD -0.174; TCGA PAAD -0.223; TCGA PRAD -0.503; TCGA SARC -0.247; TCGA THCA -0.151; TCGA STAD -0.167 |
hsa-miR-34a-5p | COL12A1 | 9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.279; TCGA CESC -0.585; TCGA COAD -0.278; TCGA HNSC -0.752; TCGA KIRP -0.368; TCGA LIHC -0.255; TCGA LUAD -0.282; TCGA LUSC -0.48; TCGA STAD -0.24 |
hsa-miR-34a-5p | AKAP6 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.911; TCGA BRCA -0.135; TCGA COAD -0.379; TCGA ESCA -0.751; TCGA HNSC -0.504; TCGA KIRC -0.391; TCGA LGG -0.201; TCGA PAAD -0.778; TCGA PRAD -0.186; TCGA SARC -0.613; TCGA THCA -0.071; TCGA STAD -1.056 |
hsa-miR-34a-5p | ADAM22 | 14 cancers: BLCA; BRCA; COAD; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.323; TCGA BRCA -0.327; TCGA COAD -0.227; TCGA KIRP -0.361; TCGA LGG -0.279; TCGA LIHC -0.295; TCGA LUAD -0.303; TCGA LUSC -0.514; TCGA PAAD -0.465; TCGA PRAD -0.502; TCGA SARC -0.721; TCGA THCA -0.665; TCGA STAD -0.295; TCGA UCEC -0.19 |
hsa-miR-34a-5p | CNST | 10 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.148; TCGA COAD -0.076; TCGA ESCA -0.123; TCGA KIRC -0.103; TCGA KIRP -0.184; TCGA LUAD -0.148; TCGA PRAD -0.207; TCGA SARC -0.179; TCGA THCA -0.205; TCGA STAD -0.175 |
hsa-miR-34a-5p | RET | 15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.28; TCGA CESC -0.581; TCGA COAD -0.428; TCGA ESCA -0.739; TCGA HNSC -0.536; TCGA KIRC -0.322; TCGA KIRP -0.287; TCGA LGG -0.366; TCGA LIHC -0.873; TCGA LUAD -0.412; TCGA LUSC -0.448; TCGA PAAD -0.466; TCGA THCA -0.209; TCGA STAD -0.625; TCGA UCEC -0.473 |
hsa-miR-34a-5p | FAT4 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.551; TCGA BRCA -0.355; TCGA CESC -0.386; TCGA COAD -0.361; TCGA HNSC -0.398; TCGA KIRP -0.368; TCGA LIHC -0.211; TCGA LUAD -0.148; TCGA PAAD -0.515; TCGA PRAD -0.341; TCGA SARC -0.224; TCGA THCA -0.365; TCGA STAD -0.472 |
hsa-miR-34a-5p | CLOCK | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.199; TCGA BRCA -0.11; TCGA COAD -0.155; TCGA HNSC -0.349; TCGA KIRC -0.28; TCGA KIRP -0.312; TCGA LIHC -0.156; TCGA LUAD -0.107; TCGA PRAD -0.664; TCGA SARC -0.215; TCGA THCA -0.156; TCGA STAD -0.082 |
hsa-miR-34a-5p | PPP2R3A | 10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.337; TCGA CESC -0.327; TCGA ESCA -0.718; TCGA HNSC -0.392; TCGA LIHC -0.266; TCGA LUSC -0.15; TCGA PRAD -0.234; TCGA SARC -0.166; TCGA STAD -0.546; TCGA UCEC -0.248 |
hsa-miR-34a-5p | CYTH3 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.298; TCGA CESC -0.191; TCGA COAD -0.099; TCGA ESCA -0.225; TCGA HNSC -0.353; TCGA KIRC -0.13; TCGA KIRP -0.099; TCGA PRAD -0.139; TCGA THCA -0.352; TCGA STAD -0.261; TCGA UCEC -0.123 |
hsa-miR-34a-5p | FAM168A | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.36; TCGA BRCA -0.19; TCGA CESC -0.194; TCGA COAD -0.176; TCGA ESCA -0.26; TCGA HNSC -0.471; TCGA KIRC -0.25; TCGA KIRP -0.229; TCGA LGG -0.168; TCGA LUAD -0.198; TCGA LUSC -0.225; TCGA PRAD -0.626; TCGA SARC -0.17; TCGA STAD -0.154 |
hsa-miR-34a-5p | NGFR | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.651; TCGA BRCA -0.494; TCGA CESC -0.867; TCGA COAD -0.523; TCGA ESCA -1.41; TCGA KIRP -0.213; TCGA LIHC -0.558; TCGA LUAD -0.189; TCGA LUSC -0.361; TCGA PAAD -0.599; TCGA STAD -0.943; TCGA UCEC -0.294 |
hsa-miR-34a-5p | NTN1 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.605; TCGA BRCA -0.196; TCGA COAD -0.313; TCGA ESCA -0.653; TCGA KIRC -0.629; TCGA KIRP -0.505; TCGA LGG -0.134; TCGA LUSC -0.269; TCGA SARC -0.277; TCGA THCA -0.261; TCGA STAD -0.782 |
hsa-miR-34a-5p | POLR1A | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD | mirMAP | TCGA BLCA -0.121; TCGA BRCA -0.07; TCGA CESC -0.138; TCGA HNSC -0.305; TCGA KIRC -0.157; TCGA KIRP -0.07; TCGA LGG -0.125; TCGA LUAD -0.079; TCGA LUSC -0.283; TCGA PRAD -0.179 |
hsa-miR-34a-5p | EVC | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.417; TCGA BRCA -0.11; TCGA CESC -0.585; TCGA COAD -0.279; TCGA ESCA -0.781; TCGA HNSC -0.33; TCGA KIRC -0.274; TCGA LIHC -0.488; TCGA PRAD -0.159; TCGA THCA -0.082; TCGA STAD -0.5; TCGA UCEC -0.16 |
hsa-miR-34a-5p | ERC1 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.351; TCGA BRCA -0.145; TCGA CESC -0.204; TCGA COAD -0.097; TCGA ESCA -0.307; TCGA HNSC -0.363; TCGA KIRC -0.135; TCGA KIRP -0.069; TCGA LGG -0.084; TCGA LIHC -0.101; TCGA LUAD -0.145; TCGA LUSC -0.133; TCGA PAAD -0.314; TCGA PRAD -0.204; TCGA SARC -0.114; TCGA THCA -0.09; TCGA STAD -0.212; TCGA UCEC -0.066 |
hsa-miR-34a-5p | GNAO1 | 12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.913; TCGA COAD -0.59; TCGA ESCA -0.638; TCGA HNSC -0.346; TCGA KIRC -0.21; TCGA KIRP -0.511; TCGA LGG -0.099; TCGA LIHC -0.342; TCGA PAAD -0.825; TCGA SARC -0.461; TCGA STAD -0.99; TCGA UCEC -0.207 |
hsa-miR-34a-5p | MAPK1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.114; TCGA CESC -0.089; TCGA COAD -0.055; TCGA ESCA -0.1; TCGA HNSC -0.234; TCGA KIRP -0.069; TCGA LUAD -0.106; TCGA PRAD -0.191; TCGA SARC -0.06; TCGA STAD -0.074 |
hsa-miR-34a-5p | PPM1F | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.062; TCGA BRCA -0.086; TCGA CESC -0.173; TCGA ESCA -0.204; TCGA HNSC -0.081; TCGA PAAD -0.175; TCGA THCA -0.109; TCGA STAD -0.142; TCGA UCEC -0.13 |
hsa-miR-34a-5p | RGP1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC | mirMAP | TCGA BLCA -0.267; TCGA BRCA -0.173; TCGA CESC -0.183; TCGA HNSC -0.564; TCGA KIRC -0.411; TCGA KIRP -0.148; TCGA LUAD -0.178; TCGA LUSC -0.202; TCGA PRAD -0.5; TCGA SARC -0.259 |
hsa-miR-34a-5p | IGFBP5 | 13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.664; TCGA BRCA -0.173; TCGA COAD -0.339; TCGA ESCA -0.482; TCGA KIRC -0.429; TCGA KIRP -0.501; TCGA LIHC -0.163; TCGA LUAD -0.237; TCGA LUSC -0.33; TCGA PRAD -0.223; TCGA SARC -0.3; TCGA THCA -0.201; TCGA STAD -0.471 |
hsa-miR-34a-5p | NFIC | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.433; TCGA BRCA -0.119; TCGA ESCA -0.39; TCGA HNSC -0.308; TCGA KIRC -0.24; TCGA KIRP -0.29; TCGA PRAD -0.399; TCGA SARC -0.324; TCGA THCA -0.153; TCGA STAD -0.197 |
hsa-miR-34a-5p | WTIP | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; STAD; UCEC | mirMAP | TCGA BLCA -0.11; TCGA BRCA -0.132; TCGA CESC -0.26; TCGA COAD -0.186; TCGA ESCA -0.343; TCGA KIRC -0.212; TCGA KIRP -0.131; TCGA LIHC -0.201; TCGA STAD -0.279; TCGA UCEC -0.283 |
hsa-miR-34a-5p | ITPKB | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.248; TCGA BRCA -0.09; TCGA ESCA -0.419; TCGA HNSC -0.107; TCGA KIRC -0.288; TCGA KIRP -0.155; TCGA LIHC -0.107; TCGA PRAD -0.066; TCGA SARC -0.105; TCGA STAD -0.48 |
hsa-miR-34a-5p | SLC16A2 | 9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.556; TCGA CESC -0.81; TCGA HNSC -0.458; TCGA KIRC -0.351; TCGA KIRP -0.41; TCGA LGG -0.075; TCGA THCA -0.674; TCGA STAD -0.227; TCGA UCEC -0.198 |
hsa-miR-34a-5p | NFASC | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.586; TCGA CESC -0.414; TCGA ESCA -0.797; TCGA HNSC -0.387; TCGA KIRC -0.664; TCGA KIRP -0.555; TCGA LUAD -0.143; TCGA PAAD -0.738; TCGA SARC -0.715; TCGA THCA -0.426; TCGA STAD -0.873 |
hsa-miR-34a-5p | FOXK1 | 9 cancers: BLCA; BRCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.133; TCGA BRCA -0.108; TCGA HNSC -0.155; TCGA LGG -0.071; TCGA LUSC -0.158; TCGA PAAD -0.254; TCGA PRAD -0.108; TCGA SARC -0.145; TCGA UCEC -0.168 |
hsa-miR-34a-5p | MECP2 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.084; TCGA BRCA -0.072; TCGA ESCA -0.092; TCGA HNSC -0.051; TCGA KIRC -0.18; TCGA KIRP -0.124; TCGA PAAD -0.187; TCGA PRAD -0.129; TCGA SARC -0.098; TCGA STAD -0.161; TCGA UCEC -0.115 |
hsa-miR-34a-5p | SIK2 | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.172; TCGA BRCA -0.142; TCGA HNSC -0.134; TCGA KIRC -0.259; TCGA KIRP -0.15; TCGA LUAD -0.203; TCGA PRAD -0.17; TCGA SARC -0.084; TCGA THCA -0.142; TCGA STAD -0.104 |
hsa-miR-34a-5p | DIRAS1 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.654; TCGA CESC -0.411; TCGA COAD -0.382; TCGA ESCA -0.972; TCGA HNSC -0.263; TCGA KIRC -0.875; TCGA LUSC -0.416; TCGA PAAD -0.714; TCGA SARC -0.597; TCGA STAD -0.67; TCGA UCEC -0.311 |
hsa-miR-34a-5p | ITSN1 | 9 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.166; TCGA BRCA -0.12; TCGA HNSC -0.158; TCGA LGG -0.102; TCGA LIHC -0.092; TCGA LUAD -0.072; TCGA PRAD -0.152; TCGA STAD -0.143; TCGA UCEC -0.08 |
hsa-miR-34a-5p | C17orf51 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.247; TCGA BRCA -0.176; TCGA ESCA -0.335; TCGA HNSC -0.23; TCGA KIRC -0.116; TCGA PAAD -0.495; TCGA PRAD -0.094; TCGA SARC -0.097; TCGA STAD -0.307; TCGA UCEC -0.256 |
hsa-miR-34a-5p | PLXNA4 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.688; TCGA BRCA -0.189; TCGA COAD -0.384; TCGA ESCA -0.52; TCGA HNSC -0.507; TCGA KIRC -0.435; TCGA KIRP -0.424; TCGA LIHC -0.503; TCGA PAAD -0.602; TCGA PRAD -0.18; TCGA SARC -0.615; TCGA STAD -0.621; TCGA UCEC -0.444 |
hsa-miR-34a-5p | BNC2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.803; TCGA BRCA -0.127; TCGA CESC -0.308; TCGA COAD -0.378; TCGA ESCA -0.644; TCGA HNSC -0.182; TCGA LUAD -0.193; TCGA PRAD -0.176; TCGA SARC -0.183; TCGA THCA -0.373; TCGA STAD -0.741; TCGA UCEC -0.477 |
hsa-miR-34a-5p | FAT3 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.238; TCGA BRCA -0.185; TCGA COAD -0.301; TCGA ESCA -0.865; TCGA KIRP -0.299; TCGA LGG -0.087; TCGA LIHC -0.404; TCGA LUAD -0.336; TCGA PRAD -0.285; TCGA SARC -1.018; TCGA STAD -1.175; TCGA UCEC -0.275 |
hsa-miR-34a-5p | FOXN2 | 9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; UCEC | miRNATAP | TCGA BLCA -0.114; TCGA COAD -0.162; TCGA HNSC -0.243; TCGA KIRP -0.211; TCGA LGG -0.138; TCGA LIHC -0.109; TCGA LUAD -0.257; TCGA PRAD -0.372; TCGA UCEC -0.121 |
hsa-miR-34a-5p | PPM1A | 12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.094; TCGA CESC -0.113; TCGA ESCA -0.143; TCGA HNSC -0.116; TCGA KIRC -0.287; TCGA LIHC -0.067; TCGA LUAD -0.145; TCGA PAAD -0.094; TCGA PRAD -0.094; TCGA SARC -0.138; TCGA STAD -0.2; TCGA UCEC -0.08 |
hsa-miR-34a-5p | PEG10 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.705; TCGA BRCA -0.273; TCGA COAD -0.847; TCGA ESCA -0.554; TCGA KIRC -0.554; TCGA KIRP -0.428; TCGA LGG -0.192; TCGA LIHC -0.861; TCGA LUAD -0.371; TCGA PAAD -0.436; TCGA PRAD -0.216; TCGA STAD -0.945 |
hsa-miR-34a-5p | TNRC6B | 12 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.089; TCGA ESCA -0.109; TCGA HNSC -0.101; TCGA KIRC -0.115; TCGA KIRP -0.073; TCGA LGG -0.141; TCGA LIHC -0.069; TCGA PAAD -0.123; TCGA PRAD -0.242; TCGA SARC -0.117; TCGA THCA -0.141; TCGA STAD -0.094 |
hsa-miR-34a-5p | FOXN3 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.29; TCGA BRCA -0.188; TCGA ESCA -0.3; TCGA HNSC -0.221; TCGA KIRC -0.104; TCGA LGG -0.105; TCGA LUAD -0.121; TCGA PAAD -0.187; TCGA PRAD -0.074; TCGA SARC -0.236; TCGA STAD -0.318 |
hsa-miR-34a-5p | PURB | 9 cancers: BLCA; HNSC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.067; TCGA HNSC -0.177; TCGA KIRP -0.082; TCGA LGG -0.054; TCGA PAAD -0.094; TCGA PRAD -0.114; TCGA SARC -0.1; TCGA STAD -0.151; TCGA UCEC -0.105 |
hsa-miR-34a-5p | KLF7 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.378; TCGA BRCA -0.157; TCGA CESC -0.507; TCGA COAD -0.189; TCGA ESCA -0.648; TCGA HNSC -0.599; TCGA KIRC -0.264; TCGA KIRP -0.403; TCGA LIHC -0.263; TCGA LUAD -0.132; TCGA LUSC -0.217; TCGA PRAD -0.351; TCGA SARC -0.171; TCGA THCA -0.102; TCGA STAD -0.345; TCGA UCEC -0.111 |
hsa-miR-34a-5p | GFRA1 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.469; TCGA BRCA -0.662; TCGA CESC -0.528; TCGA COAD -0.555; TCGA ESCA -0.528; TCGA HNSC -0.247; TCGA LGG -0.455; TCGA PAAD -0.558; TCGA THCA -1.015; TCGA STAD -0.947; TCGA UCEC -0.635 |
hsa-miR-34a-5p | SNX15 | 9 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.06; TCGA ESCA -0.16; TCGA HNSC -0.17; TCGA KIRC -0.229; TCGA KIRP -0.054; TCGA LGG -0.093; TCGA THCA -0.053; TCGA STAD -0.084; TCGA UCEC -0.075 |
hsa-miR-34a-5p | PROX1 | 11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA | miRNATAP | TCGA BLCA -0.351; TCGA BRCA -0.361; TCGA HNSC -0.644; TCGA KIRC -1.159; TCGA KIRP -0.854; TCGA LGG -0.207; TCGA LIHC -0.251; TCGA LUAD -0.478; TCGA LUSC -0.507; TCGA PRAD -0.714; TCGA THCA -0.935 |
hsa-miR-34a-5p | PAFAH1B2 | 12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA | miRNATAP | TCGA BLCA -0.163; TCGA COAD -0.2; TCGA HNSC -0.48; TCGA KIRC -0.276; TCGA KIRP -0.188; TCGA LGG -0.078; TCGA LIHC -0.144; TCGA LUAD -0.309; TCGA LUSC -0.272; TCGA PRAD -0.573; TCGA SARC -0.113; TCGA THCA -0.103 |
hsa-miR-34a-5p | CCDC50 | 11 cancers: BLCA; BRCA; CESC; COAD; LGG; LUAD; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.18; TCGA BRCA -0.109; TCGA CESC -0.15; TCGA COAD -0.086; TCGA LGG -0.128; TCGA LUAD -0.23; TCGA PAAD -0.15; TCGA SARC -0.052; TCGA THCA -0.122; TCGA STAD -0.279; TCGA UCEC -0.183 |
hsa-miR-34a-5p | ARID4A | 15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.091; TCGA BRCA -0.073; TCGA CESC -0.099; TCGA COAD -0.082; TCGA HNSC -0.106; TCGA KIRC -0.161; TCGA KIRP -0.225; TCGA LGG -0.146; TCGA LIHC -0.181; TCGA LUAD -0.096; TCGA PRAD -0.252; TCGA SARC -0.166; TCGA THCA -0.098; TCGA STAD -0.133; TCGA UCEC -0.093 |
hsa-miR-34a-5p | MCFD2 | 12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.193; TCGA CESC -0.092; TCGA COAD -0.092; TCGA HNSC -0.226; TCGA KIRP -0.073; TCGA LUAD -0.15; TCGA OV -0.059; TCGA PAAD -0.229; TCGA PRAD -0.252; TCGA THCA -0.123; TCGA STAD -0.12; TCGA UCEC -0.12 |
hsa-miR-34a-5p | SMAD4 | 13 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.122; TCGA BRCA -0.097; TCGA KIRC -0.149; TCGA KIRP -0.066; TCGA LGG -0.161; TCGA LIHC -0.106; TCGA LUAD -0.188; TCGA PAAD -0.3; TCGA PRAD -0.103; TCGA SARC -0.181; TCGA THCA -0.106; TCGA STAD -0.136; TCGA UCEC -0.116 |
hsa-miR-34a-5p | TSHZ2 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.408; TCGA BRCA -0.349; TCGA COAD -0.385; TCGA ESCA -0.356; TCGA HNSC -0.328; TCGA KIRP -0.771; TCGA LUAD -0.162; TCGA PRAD -0.387; TCGA THCA -0.33; TCGA STAD -0.37 |
hsa-miR-34a-5p | SOX6 | 10 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LIHC; LUSC; PAAD; SARC; STAD | miRNATAP | TCGA BLCA -0.359; TCGA BRCA -0.426; TCGA HNSC -0.226; TCGA KIRC -0.31; TCGA LGG -0.457; TCGA LIHC -0.42; TCGA LUSC -0.367; TCGA PAAD -0.376; TCGA SARC -0.358; TCGA STAD -0.338 |
hsa-miR-34a-5p | RORA | 9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.302; TCGA BRCA -0.098; TCGA COAD -0.342; TCGA HNSC -0.199; TCGA KIRP -0.123; TCGA PAAD -0.424; TCGA PRAD -0.244; TCGA THCA -0.098; TCGA STAD -0.363 |
hsa-miR-34a-5p | SLC6A17 | 13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.368; TCGA COAD -0.425; TCGA ESCA -0.72; TCGA HNSC -0.394; TCGA KIRC -0.95; TCGA KIRP -0.813; TCGA LUAD -0.347; TCGA LUSC -0.483; TCGA PAAD -0.792; TCGA SARC -0.407; TCGA THCA -0.215; TCGA STAD -0.311; TCGA UCEC -0.261 |
hsa-miR-34a-5p | PLCB1 | 15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.12; TCGA BRCA -0.16; TCGA COAD -0.292; TCGA HNSC -0.213; TCGA KIRC -0.161; TCGA KIRP -0.471; TCGA LGG -0.237; TCGA LIHC -0.202; TCGA LUAD -0.262; TCGA LUSC -0.191; TCGA OV -0.212; TCGA PAAD -0.324; TCGA PRAD -0.309; TCGA THCA -0.139; TCGA STAD -0.494 |
hsa-miR-34a-5p | CAMSAP1 | 9 cancers: BLCA; BRCA; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.065; TCGA BRCA -0.068; TCGA ESCA -0.18; TCGA LGG -0.119; TCGA LUAD -0.057; TCGA LUSC -0.151; TCGA PRAD -0.112; TCGA SARC -0.147; TCGA STAD -0.097 |
hsa-miR-34a-5p | PRKD1 | 13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.269; TCGA CESC -0.314; TCGA COAD -0.435; TCGA ESCA -0.675; TCGA KIRC -0.372; TCGA KIRP -0.13; TCGA LGG -0.163; TCGA PAAD -0.503; TCGA PRAD -0.371; TCGA SARC -0.308; TCGA THCA -0.258; TCGA STAD -0.52; TCGA UCEC -0.213 |
hsa-miR-34a-5p | UBE2G1 | 10 cancers: BLCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.093; TCGA HNSC -0.143; TCGA KIRC -0.054; TCGA LIHC -0.129; TCGA LUAD -0.164; TCGA LUSC -0.125; TCGA OV -0.056; TCGA PAAD -0.162; TCGA PRAD -0.191; TCGA STAD -0.085 |
hsa-miR-34a-5p | SPEN | 9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA | miRNATAP | TCGA BLCA -0.059; TCGA BRCA -0.094; TCGA HNSC -0.191; TCGA KIRC -0.164; TCGA KIRP -0.126; TCGA LGG -0.174; TCGA PRAD -0.232; TCGA SARC -0.118; TCGA THCA -0.092 |
hsa-miR-34a-5p | GRID1 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.177; TCGA BRCA -0.231; TCGA COAD -0.211; TCGA HNSC -0.274; TCGA KIRP -0.555; TCGA LGG -0.21; TCGA PAAD -0.347; TCGA THCA -0.115; TCGA STAD -0.6; TCGA UCEC -0.24 |
hsa-miR-34a-5p | PRKG1 | 15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.92; TCGA CESC -0.407; TCGA COAD -0.604; TCGA ESCA -0.541; TCGA HNSC -0.747; TCGA KIRC -0.391; TCGA KIRP -0.56; TCGA LIHC -0.361; TCGA LUAD -0.424; TCGA LUSC -0.27; TCGA PRAD -0.681; TCGA SARC -0.425; TCGA THCA -0.761; TCGA STAD -0.614; TCGA UCEC -0.233 |
hsa-miR-34a-5p | PRKAA2 | 9 cancers: BLCA; COAD; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.698; TCGA COAD -0.681; TCGA KIRC -0.285; TCGA KIRP -0.18; TCGA PRAD -0.152; TCGA SARC -0.743; TCGA THCA -0.098; TCGA STAD -1.326; TCGA UCEC -0.124 |
hsa-miR-34a-5p | TOPORS | 12 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.095; TCGA BRCA -0.091; TCGA KIRC -0.216; TCGA KIRP -0.166; TCGA LGG -0.109; TCGA LUAD -0.126; TCGA PAAD -0.144; TCGA PRAD -0.274; TCGA SARC -0.128; TCGA THCA -0.106; TCGA STAD -0.076; TCGA UCEC -0.079 |
hsa-miR-34a-5p | RELN | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.795; TCGA BRCA -0.695; TCGA COAD -0.583; TCGA ESCA -1.305; TCGA HNSC -0.669; TCGA LUAD -0.493; TCGA PAAD -0.926; TCGA PRAD -0.301; TCGA SARC -0.445; TCGA THCA -1.508; TCGA STAD -0.904; TCGA UCEC -0.44 |
hsa-miR-34a-5p | C3orf70 | 10 cancers: BLCA; COAD; ESCA; KIRP; LUAD; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.465; TCGA COAD -0.228; TCGA ESCA -0.375; TCGA KIRP -0.48; TCGA LUAD -0.337; TCGA PAAD -0.247; TCGA SARC -0.58; TCGA THCA -0.136; TCGA STAD -0.935; TCGA UCEC -0.456 |
hsa-miR-34a-5p | PID1 | 11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.513; TCGA HNSC -0.174; TCGA KIRC -0.266; TCGA KIRP -0.213; TCGA LGG -0.313; TCGA LIHC -0.22; TCGA LUAD -0.196; TCGA PAAD -0.438; TCGA THCA -0.677; TCGA STAD -0.626; TCGA UCEC -0.23 |
hsa-miR-34a-5p | RIMS4 | 9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.244; TCGA BRCA -0.272; TCGA COAD -0.417; TCGA KIRC -0.489; TCGA KIRP -0.498; TCGA PRAD -0.188; TCGA THCA -0.56; TCGA STAD -0.583; TCGA UCEC -0.297 |
hsa-miR-34a-5p | CTDSP2 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.22; TCGA BRCA -0.144; TCGA CESC -0.175; TCGA HNSC -0.167; TCGA KIRC -0.132; TCGA KIRP -0.216; TCGA LIHC -0.063; TCGA LUSC -0.085; TCGA PAAD -0.163; TCGA PRAD -0.166; TCGA THCA -0.069; TCGA STAD -0.157; TCGA UCEC -0.196 |
hsa-miR-34a-5p | PRKACB | 10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.239; TCGA ESCA -0.257; TCGA HNSC -0.188; TCGA KIRC -0.156; TCGA KIRP -0.078; TCGA LUAD -0.25; TCGA PRAD -0.142; TCGA SARC -0.087; TCGA THCA -0.298; TCGA STAD -0.376 |
hsa-miR-34a-5p | JMJD1C | 13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.157; TCGA BRCA -0.099; TCGA COAD -0.063; TCGA HNSC -0.298; TCGA KIRC -0.148; TCGA KIRP -0.205; TCGA LGG -0.271; TCGA LIHC -0.097; TCGA LUAD -0.142; TCGA PRAD -0.334; TCGA THCA -0.186; TCGA STAD -0.173; TCGA UCEC -0.115 |
hsa-miR-34a-5p | SHOC2 | 9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.07; TCGA CESC -0.108; TCGA COAD -0.06; TCGA HNSC -0.135; TCGA KIRP -0.125; TCGA LUAD -0.164; TCGA PRAD -0.194; TCGA THCA -0.063; TCGA STAD -0.071 |
hsa-miR-34a-5p | AFF4 | 9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.107; TCGA HNSC -0.267; TCGA KIRC -0.094; TCGA KIRP -0.11; TCGA LGG -0.108; TCGA LIHC -0.074; TCGA PRAD -0.302; TCGA SARC -0.095; TCGA STAD -0.167 |
hsa-miR-34a-5p | ZNF304 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.066; TCGA BRCA -0.125; TCGA CESC -0.621; TCGA COAD -0.366; TCGA HNSC -0.193; TCGA KIRC -0.187; TCGA KIRP -0.163; TCGA LUAD -0.108; TCGA PAAD -0.321; TCGA PRAD -0.304; TCGA SARC -0.175; TCGA THCA -0.115; TCGA STAD -0.226 |
hsa-miR-34a-5p | ZNF532 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.347; TCGA BRCA -0.105; TCGA CESC -0.283; TCGA COAD -0.201; TCGA ESCA -0.365; TCGA HNSC -0.187; TCGA KIRP -0.155; TCGA LGG -0.076; TCGA LIHC -0.22; TCGA LUSC -0.193; TCGA PRAD -0.168; TCGA SARC -0.14; TCGA STAD -0.285; TCGA UCEC -0.136 |
hsa-miR-34a-5p | TAF4B | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC | miRNATAP | TCGA BLCA -0.378; TCGA BRCA -0.237; TCGA CESC -0.277; TCGA COAD -0.179; TCGA HNSC -0.137; TCGA KIRC -0.09; TCGA KIRP -0.194; TCGA LIHC -0.278; TCGA LUAD -0.118; TCGA LUSC -0.305; TCGA PAAD -0.296; TCGA PRAD -0.27; TCGA UCEC -0.289 |
hsa-miR-34a-5p | PDZRN3 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; PAAD; SARC; STAD | miRNATAP | TCGA BLCA -0.741; TCGA BRCA -0.176; TCGA CESC -0.32; TCGA ESCA -0.623; TCGA HNSC -0.231; TCGA KIRC -0.524; TCGA LGG -0.132; TCGA LIHC -0.531; TCGA LUAD -0.175; TCGA PAAD -0.429; TCGA SARC -0.412; TCGA STAD -0.835 |
hsa-miR-34a-5p | SNAP25 | 9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; PAAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.478; TCGA COAD -0.727; TCGA ESCA -0.524; TCGA LIHC -0.337; TCGA LUAD -0.258; TCGA PAAD -0.868; TCGA SARC -0.554; TCGA STAD -1.001; TCGA UCEC -0.733 |
hsa-miR-34a-5p | ADNP | 14 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BRCA -0.077; TCGA HNSC -0.134; TCGA KIRC -0.106; TCGA KIRP -0.144; TCGA LGG -0.104; TCGA LIHC -0.114; TCGA LUAD -0.111; TCGA LUSC -0.153; TCGA OV -0.09; TCGA PAAD -0.127; TCGA PRAD -0.284; TCGA SARC -0.131; TCGA THCA -0.081; TCGA UCEC -0.127 |
hsa-miR-34a-5p | BCLAF1 | 11 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BRCA -0.059; TCGA KIRC -0.129; TCGA KIRP -0.137; TCGA LGG -0.066; TCGA LIHC -0.1; TCGA LUAD -0.089; TCGA OV -0.056; TCGA PAAD -0.177; TCGA PRAD -0.22; TCGA SARC -0.059; TCGA THCA -0.092 |
hsa-miR-34a-5p | HNRNPUL1 | 10 cancers: BRCA; KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; SARC; UCEC | miRNAWalker2 validate | TCGA BRCA -0.06; TCGA KIRP -0.088; TCGA LGG -0.103; TCGA LIHC -0.072; TCGA LUAD -0.085; TCGA OV -0.062; TCGA PAAD -0.09; TCGA PRAD -0.139; TCGA SARC -0.119; TCGA UCEC -0.058 |
hsa-miR-34a-5p | JAG1 | 9 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.11; TCGA CESC -0.403; TCGA HNSC -0.322; TCGA KIRP -0.207; TCGA LIHC -0.193; TCGA LUAD -0.235; TCGA LUSC -0.387; TCGA PRAD -0.436; TCGA SARC -0.127 |
hsa-miR-34a-5p | KBTBD6 | 15 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.078; TCGA CESC -0.098; TCGA COAD -0.138; TCGA HNSC -0.12; TCGA KIRC -0.123; TCGA KIRP -0.118; TCGA LGG -0.105; TCGA LIHC -0.111; TCGA LUAD -0.175; TCGA LUSC -0.242; TCGA OV -0.205; TCGA PAAD -0.374; TCGA PRAD -0.265; TCGA THCA -0.086; TCGA STAD -0.083 |
hsa-miR-34a-5p | NOTCH1 | 9 cancers: BRCA; CESC; ESCA; KIRP; LGG; LIHC; LUSC; PRAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.082; TCGA CESC -0.232; TCGA ESCA -0.219; TCGA KIRP -0.188; TCGA LGG -0.283; TCGA LIHC -0.239; TCGA LUSC -0.173; TCGA PRAD -0.123; TCGA UCEC -0.077 |
hsa-miR-34a-5p | SMARCC1 | 9 cancers: BRCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC | miRNAWalker2 validate | TCGA BRCA -0.061; TCGA KIRC -0.226; TCGA KIRP -0.113; TCGA LGG -0.186; TCGA LUAD -0.122; TCGA LUSC -0.21; TCGA OV -0.064; TCGA PRAD -0.166; TCGA SARC -0.147 |
hsa-miR-34a-5p | TFAM | 11 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.076; TCGA COAD -0.127; TCGA KIRC -0.192; TCGA KIRP -0.096; TCGA LGG -0.156; TCGA LIHC -0.078; TCGA LUAD -0.281; TCGA LUSC -0.109; TCGA OV -0.107; TCGA PRAD -0.245; TCGA UCEC -0.108 |
hsa-miR-34a-5p | TXNIP | 9 cancers: BRCA; KIRC; KIRP; LGG; LIHC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.188; TCGA KIRC -0.15; TCGA KIRP -0.12; TCGA LGG -0.148; TCGA LIHC -0.241; TCGA PRAD -0.156; TCGA THCA -0.171; TCGA STAD -0.366; TCGA UCEC -0.125 |
hsa-miR-34a-5p | UBA2 | 11 cancers: BRCA; COAD; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNAWalker2 validate | TCGA BRCA -0.064; TCGA COAD -0.137; TCGA KIRP -0.101; TCGA LGG -0.117; TCGA LIHC -0.085; TCGA LUAD -0.238; TCGA LUSC -0.153; TCGA OV -0.128; TCGA PRAD -0.142; TCGA SARC -0.137; TCGA UCEC -0.123 |
hsa-miR-34a-5p | UHRF1BP1 | 9 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD | miRNAWalker2 validate | TCGA BRCA -0.084; TCGA COAD -0.072; TCGA HNSC -0.125; TCGA KIRC -0.087; TCGA KIRP -0.087; TCGA LGG -0.159; TCGA LUAD -0.078; TCGA LUSC -0.096; TCGA PRAD -0.241 |
hsa-miR-34a-5p | FAM117B | 10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC | MirTarget | TCGA BRCA -0.131; TCGA KIRC -0.151; TCGA KIRP -0.142; TCGA LGG -0.232; TCGA LIHC -0.267; TCGA LUAD -0.115; TCGA LUSC -0.236; TCGA OV -0.15; TCGA PRAD -0.296; TCGA SARC -0.074 |
hsa-miR-34a-5p | MSL2 | 11 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.071; TCGA KIRP -0.062; TCGA LGG -0.135; TCGA LIHC -0.098; TCGA LUAD -0.062; TCGA LUSC -0.093; TCGA PAAD -0.133; TCGA PRAD -0.143; TCGA SARC -0.106; TCGA THCA -0.125; TCGA UCEC -0.094 |
hsa-miR-34a-5p | IGSF3 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.101; TCGA CESC -0.34; TCGA ESCA -0.533; TCGA HNSC -0.286; TCGA KIRC -0.271; TCGA KIRP -0.122; TCGA LUSC -0.268; TCGA PRAD -0.275; TCGA SARC -0.26; TCGA STAD -0.236; TCGA UCEC -0.15 |
hsa-miR-34a-5p | MON2 | 9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; PRAD; THCA; STAD | MirTarget | TCGA BRCA -0.062; TCGA CESC -0.093; TCGA HNSC -0.108; TCGA KIRC -0.069; TCGA KIRP -0.152; TCGA LIHC -0.117; TCGA PRAD -0.148; TCGA THCA -0.141; TCGA STAD -0.073 |
hsa-miR-34a-5p | BAZ2A | 9 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.065; TCGA CESC -0.107; TCGA HNSC -0.198; TCGA KIRP -0.113; TCGA LGG -0.122; TCGA LIHC -0.066; TCGA LUSC -0.098; TCGA PRAD -0.232; TCGA UCEC -0.068 |
hsa-miR-34a-5p | ANKS1A | 14 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.101; TCGA COAD -0.064; TCGA ESCA -0.119; TCGA HNSC -0.205; TCGA KIRC -0.247; TCGA KIRP -0.15; TCGA LIHC -0.087; TCGA LUAD -0.109; TCGA PAAD -0.128; TCGA PRAD -0.126; TCGA SARC -0.084; TCGA THCA -0.14; TCGA STAD -0.239; TCGA UCEC -0.082 |
hsa-miR-34a-5p | MYNN | 13 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BRCA -0.054; TCGA COAD -0.086; TCGA KIRC -0.099; TCGA KIRP -0.109; TCGA LGG -0.086; TCGA LIHC -0.076; TCGA LUAD -0.2; TCGA LUSC -0.205; TCGA OV -0.091; TCGA PRAD -0.201; TCGA SARC -0.093; TCGA THCA -0.118; TCGA UCEC -0.094 |
hsa-miR-34a-5p | ZBTB9 | 10 cancers: BRCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; THCA; UCEC | MirTarget | TCGA BRCA -0.071; TCGA HNSC -0.058; TCGA KIRC -0.12; TCGA LGG -0.073; TCGA LUAD -0.058; TCGA LUSC -0.162; TCGA OV -0.069; TCGA PAAD -0.148; TCGA THCA -0.065; TCGA UCEC -0.062 |
hsa-miR-34a-5p | FRMD4A | 11 cancers: BRCA; CESC; ESCA; KIRP; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.097; TCGA CESC -0.186; TCGA ESCA -0.3; TCGA KIRP -0.226; TCGA LGG -0.101; TCGA LIHC -0.196; TCGA LUAD -0.086; TCGA PRAD -0.118; TCGA THCA -0.245; TCGA STAD -0.208; TCGA UCEC -0.082 |
hsa-miR-34a-5p | PKIA | 13 cancers: BRCA; CESC; COAD; KIRC; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.176; TCGA CESC -0.451; TCGA COAD -0.587; TCGA KIRC -0.5; TCGA LGG -0.073; TCGA LIHC -0.362; TCGA LUAD -0.204; TCGA OV -0.35; TCGA PRAD -0.221; TCGA SARC -0.281; TCGA THCA -0.46; TCGA STAD -0.666; TCGA UCEC -0.637 |
hsa-miR-34a-5p | PRKCQ | 9 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; THCA | MirTarget | TCGA BRCA -0.177; TCGA CESC -0.397; TCGA ESCA -0.417; TCGA KIRC -0.436; TCGA KIRP -0.457; TCGA LIHC -0.305; TCGA LUAD -0.164; TCGA PAAD -0.531; TCGA THCA -0.406 |
hsa-miR-34a-5p | LRRC55 | 9 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.255; TCGA COAD -0.392; TCGA HNSC -0.311; TCGA KIRC -0.503; TCGA KIRP -0.592; TCGA LIHC -0.725; TCGA LUSC -0.375; TCGA STAD -0.373; TCGA UCEC -0.187 |
hsa-miR-34a-5p | LRP4 | 10 cancers: BRCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; OV; SARC; STAD | MirTarget | TCGA BRCA -0.253; TCGA CESC -0.329; TCGA HNSC -0.259; TCGA KIRP -0.261; TCGA LGG -0.174; TCGA LUAD -0.229; TCGA LUSC -0.394; TCGA OV -0.221; TCGA SARC -0.136; TCGA STAD -0.309 |
hsa-miR-34a-5p | ZMIZ1 | 13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.084; TCGA CESC -0.158; TCGA ESCA -0.154; TCGA HNSC -0.25; TCGA KIRC -0.15; TCGA KIRP -0.098; TCGA LGG -0.221; TCGA LIHC -0.185; TCGA LUAD -0.124; TCGA PRAD -0.124; TCGA THCA -0.095; TCGA STAD -0.173; TCGA UCEC -0.235 |
hsa-miR-34a-5p | TBC1D5 | 9 cancers: BRCA; KIRC; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.064; TCGA KIRC -0.201; TCGA LGG -0.121; TCGA LUAD -0.081; TCGA PAAD -0.131; TCGA PRAD -0.198; TCGA THCA -0.069; TCGA STAD -0.065; TCGA UCEC -0.056 |
hsa-miR-34a-5p | ADCY1 | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BRCA -0.242; TCGA CESC -0.349; TCGA COAD -0.25; TCGA ESCA -0.701; TCGA HNSC -0.22; TCGA KIRC -0.555; TCGA KIRP -0.529; TCGA LIHC -0.745; TCGA LUSC -0.284; TCGA PAAD -0.567; TCGA PRAD -0.317; TCGA THCA -0.254; TCGA STAD -0.159 |
hsa-miR-34a-5p | IGF2 | 10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.242; TCGA ESCA -0.473; TCGA HNSC -0.347; TCGA KIRC -0.581; TCGA KIRP -0.436; TCGA LIHC -1.257; TCGA LUSC -0.563; TCGA THCA -0.323; TCGA STAD -0.551; TCGA UCEC -0.693 |
hsa-miR-34a-5p | CRTC1 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LGG; PAAD; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.071; TCGA ESCA -0.13; TCGA KIRC -0.237; TCGA KIRP -0.182; TCGA LGG -0.125; TCGA PAAD -0.195; TCGA SARC -0.06; TCGA STAD -0.108; TCGA UCEC -0.076 |
hsa-miR-34a-5p | EPHA4 | 9 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.153; TCGA CESC -0.362; TCGA ESCA -0.433; TCGA KIRC -0.311; TCGA KIRP -0.309; TCGA LIHC -0.158; TCGA SARC -0.243; TCGA STAD -0.516; TCGA UCEC -0.4 |
hsa-miR-34a-5p | EEA1 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRP; LUAD; PAAD; PRAD; STAD | miRNATAP | TCGA BRCA -0.077; TCGA CESC -0.247; TCGA COAD -0.1; TCGA HNSC -0.271; TCGA KIRP -0.125; TCGA LUAD -0.181; TCGA PAAD -0.19; TCGA PRAD -0.331; TCGA STAD -0.153 |
hsa-miR-34a-5p | EFNB3 | 12 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.22; TCGA ESCA -0.59; TCGA HNSC -0.204; TCGA KIRC -0.263; TCGA KIRP -0.487; TCGA LGG -0.166; TCGA LIHC -0.58; TCGA LUAD -0.197; TCGA LUSC -0.321; TCGA PAAD -0.557; TCGA STAD -0.244; TCGA UCEC -0.455 |
hsa-miR-34a-5p | ALS2 | 9 cancers: CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA | miRNAWalker2 validate | TCGA CESC -0.09; TCGA HNSC -0.073; TCGA KIRC -0.103; TCGA KIRP -0.163; TCGA LIHC -0.182; TCGA LUAD -0.079; TCGA LUSC -0.192; TCGA PRAD -0.178; TCGA THCA -0.05 |
hsa-miR-34a-5p | KTN1 | 10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.225; TCGA ESCA -0.224; TCGA HNSC -0.296; TCGA KIRC -0.305; TCGA KIRP -0.187; TCGA LUAD -0.199; TCGA PRAD -0.183; TCGA SARC -0.08; TCGA STAD -0.107; TCGA UCEC -0.064 |
hsa-miR-34a-5p | RTN4 | 9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.192; TCGA ESCA -0.197; TCGA HNSC -0.248; TCGA KIRC -0.133; TCGA KIRP -0.06; TCGA LUAD -0.083; TCGA PRAD -0.118; TCGA STAD -0.212; TCGA UCEC -0.074 |
hsa-miR-34a-5p | XRN1 | 10 cancers: CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; THCA; UCEC | miRNAWalker2 validate | TCGA CESC -0.124; TCGA HNSC -0.158; TCGA KIRC -0.063; TCGA KIRP -0.172; TCGA LGG -0.136; TCGA LIHC -0.151; TCGA LUAD -0.101; TCGA PRAD -0.262; TCGA THCA -0.089; TCGA UCEC -0.079 |
hsa-miR-34a-5p | YY1 | 13 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNAWalker2 validate; miRTarBase | TCGA CESC -0.099; TCGA COAD -0.072; TCGA ESCA -0.081; TCGA HNSC -0.157; TCGA KIRC -0.077; TCGA KIRP -0.133; TCGA LIHC -0.058; TCGA LUAD -0.15; TCGA LUSC -0.107; TCGA OV -0.052; TCGA PRAD -0.154; TCGA SARC -0.063; TCGA UCEC -0.088 |
hsa-miR-34a-5p | DNM1L | 11 cancers: CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA CESC -0.102; TCGA HNSC -0.111; TCGA KIRC -0.11; TCGA KIRP -0.084; TCGA LUAD -0.133; TCGA LUSC -0.186; TCGA PAAD -0.102; TCGA PRAD -0.09; TCGA SARC -0.052; TCGA STAD -0.092; TCGA UCEC -0.065 |
hsa-miR-34a-5p | NOS1 | 12 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.501; TCGA COAD -0.712; TCGA ESCA -1.727; TCGA HNSC -0.738; TCGA KIRC -1.32; TCGA KIRP -0.814; TCGA LUAD -0.525; TCGA PAAD -0.514; TCGA PRAD -0.864; TCGA THCA -0.749; TCGA STAD -1.281; TCGA UCEC -0.4 |
hsa-miR-34a-5p | WSCD2 | 10 cancers: CESC; COAD; ESCA; KIRC; KIRP; LUSC; SARC; THCA; STAD; UCEC | miRNATAP | TCGA CESC -0.57; TCGA COAD -0.704; TCGA ESCA -1.136; TCGA KIRC -1.11; TCGA KIRP -0.726; TCGA LUSC -0.479; TCGA SARC -0.499; TCGA THCA -1.918; TCGA STAD -1.1; TCGA UCEC -0.742 |
hsa-miR-34a-5p | TANC2 | 10 cancers: CESC; ESCA; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA CESC -0.225; TCGA ESCA -0.272; TCGA HNSC -0.386; TCGA KIRP -0.197; TCGA LGG -0.174; TCGA LIHC -0.252; TCGA PAAD -0.2; TCGA PRAD -0.156; TCGA STAD -0.185; TCGA UCEC -0.327 |
hsa-miR-34a-5p | E2F5 | 9 cancers: COAD; KIRC; KIRP; LGG; LUAD; OV; PRAD; THCA; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA COAD -0.242; TCGA KIRC -0.195; TCGA KIRP -0.137; TCGA LGG -0.211; TCGA LUAD -0.192; TCGA OV -0.134; TCGA PRAD -0.166; TCGA THCA -0.121; TCGA UCEC -0.118 |
hsa-miR-34a-5p | GTF3C3 | 9 cancers: COAD; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC | miRNAWalker2 validate | TCGA COAD -0.073; TCGA HNSC -0.075; TCGA KIRC -0.11; TCGA LGG -0.109; TCGA LUAD -0.133; TCGA LUSC -0.247; TCGA OV -0.066; TCGA PRAD -0.307; TCGA SARC -0.091 |
hsa-miR-34a-5p | RBM12 | 11 cancers: COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; UCEC | miRNAWalker2 validate | TCGA COAD -0.061; TCGA HNSC -0.086; TCGA KIRC -0.142; TCGA KIRP -0.144; TCGA LGG -0.161; TCGA LIHC -0.093; TCGA LUAD -0.141; TCGA LUSC -0.103; TCGA PRAD -0.184; TCGA THCA -0.083; TCGA UCEC -0.052 |
hsa-miR-34a-5p | INA | 9 cancers: COAD; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA COAD -0.855; TCGA ESCA -1.013; TCGA KIRP -0.395; TCGA LGG -0.445; TCGA LUAD -0.327; TCGA LUSC -0.725; TCGA PAAD -0.875; TCGA PRAD -0.527; TCGA STAD -0.905 |
hsa-miR-34a-5p | CTNND2 | 10 cancers: COAD; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; STAD | MirTarget | TCGA COAD -0.497; TCGA KIRC -0.545; TCGA KIRP -0.459; TCGA LGG -0.05; TCGA LIHC -1.449; TCGA LUAD -0.595; TCGA PAAD -0.669; TCGA PRAD -0.208; TCGA THCA -0.265; TCGA STAD -0.44 |
hsa-miR-34a-5p | KIF1A | 11 cancers: COAD; ESCA; KIRC; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA COAD -0.697; TCGA ESCA -0.931; TCGA KIRC -0.788; TCGA LIHC -0.53; TCGA LUSC -1.14; TCGA PAAD -0.915; TCGA PRAD -0.247; TCGA SARC -0.363; TCGA THCA -0.515; TCGA STAD -1.025; TCGA UCEC -0.387 |
hsa-miR-34a-5p | SLC7A2 | 9 cancers: COAD; ESCA; KIRP; LIHC; LUAD; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA COAD -0.4; TCGA ESCA -0.461; TCGA KIRP -0.446; TCGA LIHC -0.559; TCGA LUAD -0.494; TCGA PAAD -0.86; TCGA PRAD -0.105; TCGA STAD -0.725; TCGA UCEC -0.302 |
hsa-miR-34a-5p | ITCH | 9 cancers: COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; STAD; UCEC | miRNATAP | TCGA COAD -0.105; TCGA HNSC -0.201; TCGA KIRC -0.144; TCGA KIRP -0.1; TCGA LIHC -0.139; TCGA LUAD -0.118; TCGA PRAD -0.256; TCGA STAD -0.06; TCGA UCEC -0.081 |
hsa-miR-34a-5p | POLR2A | 9 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; THCA | miRNAWalker2 validate | TCGA ESCA -0.132; TCGA HNSC -0.235; TCGA KIRC -0.14; TCGA KIRP -0.08; TCGA LGG -0.056; TCGA LIHC -0.069; TCGA LUSC -0.15; TCGA PRAD -0.182; TCGA THCA -0.071 |
hsa-miR-34a-5p | ERLIN1 | 9 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD | miRNAWalker2 validate | TCGA HNSC -0.081; TCGA KIRC -0.068; TCGA KIRP -0.182; TCGA LGG -0.088; TCGA LIHC -0.162; TCGA LUAD -0.245; TCGA LUSC -0.133; TCGA OV -0.056; TCGA PRAD -0.096 |
hsa-miR-34a-5p | PRPF40A | 9 cancers: HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | miRNAWalker2 validate | TCGA HNSC -0.054; TCGA KIRP -0.118; TCGA LGG -0.126; TCGA LIHC -0.062; TCGA LUAD -0.121; TCGA LUSC -0.114; TCGA OV -0.062; TCGA PRAD -0.21; TCGA UCEC -0.08 |
hsa-miR-34a-5p | PUM2 | 13 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA HNSC -0.054; TCGA KIRC -0.089; TCGA KIRP -0.121; TCGA LGG -0.089; TCGA LIHC -0.095; TCGA LUAD -0.097; TCGA LUSC -0.138; TCGA OV -0.059; TCGA PRAD -0.169; TCGA SARC -0.095; TCGA THCA -0.075; TCGA STAD -0.084; TCGA UCEC -0.056 |
hsa-miR-34a-5p | WBP11 | 11 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRNAWalker2 validate | TCGA HNSC -0.072; TCGA KIRC -0.1; TCGA KIRP -0.075; TCGA LGG -0.051; TCGA LIHC -0.061; TCGA LUAD -0.132; TCGA LUSC -0.193; TCGA OV -0.127; TCGA PAAD -0.208; TCGA PRAD -0.138; TCGA UCEC -0.07 |
hsa-miR-34a-5p | PIP5K1A | 10 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC | MirTarget; miRNATAP | TCGA HNSC -0.127; TCGA KIRC -0.11; TCGA KIRP -0.12; TCGA LGG -0.057; TCGA LIHC -0.074; TCGA LUAD -0.073; TCGA LUSC -0.123; TCGA PRAD -0.211; TCGA SARC -0.109; TCGA UCEC -0.084 |
hsa-miR-34a-5p | GPR158 | 9 cancers: HNSC; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA HNSC -0.502; TCGA LGG -0.224; TCGA LUAD -0.351; TCGA OV -0.727; TCGA PAAD -0.648; TCGA PRAD -0.366; TCGA THCA -0.598; TCGA STAD -0.296; TCGA UCEC -0.56 |
hsa-miR-34a-5p | PPP1R15B | 9 cancers: HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA HNSC -0.087; TCGA KIRC -0.074; TCGA KIRP -0.134; TCGA LIHC -0.103; TCGA LUAD -0.124; TCGA PRAD -0.203; TCGA SARC -0.064; TCGA THCA -0.204; TCGA UCEC -0.072 |
hsa-miR-34a-5p | CACNA2D2 | 10 cancers: KIRC; KIRP; LGG; LIHC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA KIRC -0.738; TCGA KIRP -0.316; TCGA LGG -0.184; TCGA LIHC -0.228; TCGA OV -0.291; TCGA PAAD -0.828; TCGA PRAD -0.275; TCGA THCA -0.33; TCGA STAD -0.456; TCGA UCEC -0.676 |
hsa-miR-34a-5p | YTHDC1 | 9 cancers: KIRC; LGG; LIHC; OV; PAAD; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA KIRC -0.057; TCGA LGG -0.106; TCGA LIHC -0.106; TCGA OV -0.056; TCGA PAAD -0.066; TCGA PRAD -0.073; TCGA SARC -0.085; TCGA THCA -0.118; TCGA UCEC -0.051 |
hsa-miR-34a-5p | TAF5 | 10 cancers: KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC | miRNATAP | TCGA KIRP -0.147; TCGA LGG -0.17; TCGA LIHC -0.106; TCGA LUAD -0.173; TCGA LUSC -0.208; TCGA OV -0.088; TCGA PAAD -0.128; TCGA SARC -0.069; TCGA THCA -0.138; TCGA UCEC -0.094 |
Enriched cancer pathways of putative targets