microRNA information: hsa-miR-34b-5p

SectionIDlink
Mature name: hsa-miR-34b-5pmiRbase
Accession: MIMAT0000685miRbase
Precursor name: hsa-mir-34b miRbase
Precursor accession: MI0000742miRbase
Symbol: MIR34BHGNC
RefSeq ID: NR_029839GenBank
Sequence: UAGGCAGUGUCAUUAGCUGAUUG



Reported expression in cancers: hsa-miR-34b-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-34b-5p

acute myeloid leukemiaupregulation"We found that miR-34b was developmentally upregula ......"27296951
hsa-miR-34b-5p

colorectal cancerdownregulation"The miR-34 family members described as potential t ......"23183747RNA-Seq
hsa-miR-34b-5p

gastric cancerdownregulation"We found that miR-34b and miR-34c are epigenetical ......"20924086
hsa-miR-34b-5p

gastric cancerdownregulation"Epigenetic regulation of miR 34b and miR 129 expre ......"21960261
hsa-miR-34b-5p

head and neck cancerderegulation"2012;488:686-91 including 7 consistently up-regula ......"24422025
hsa-miR-34b-5p

liver cancerdownregulation"Methylation associated silencing of microRNA 34b i ......"24704024Reverse transcription PCR
hsa-miR-34b-5p

lung cancerdownregulation"The miR-34 family consists of tumor-suppressive mi ......"23805317
hsa-miR-34b-5p

lung squamous cell cancerdownregulation"We have analyzed the impact of miR-34 expression o ......"19736307Reverse transcription PCR
hsa-miR-34b-5p

lung squamous cell cancerdownregulation"The miR-34 family is comprised of tumor-suppressiv ......"22047961
hsa-miR-34b-5p

pancreatic cancerdownregulation"In human specimens we found that miR-34b was down- ......"23305226
hsa-miR-34b-5p

prostate cancerdownregulation"Using novel high throughput technologies we identi ......"23573364
hsa-miR-34b-5p

thyroid cancerdownregulation"In this study we evaluated miRNA expression as a m ......"21537871Microarray
hsa-miR-34b-5p

thyroid cancerupregulation"Additionally the relative expression levels of miR ......"26402809Reverse transcription PCR; qPCR



Reported cancer pathway affected by hsa-miR-34b-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-34b-5p

acute myeloid leukemiacell cycle pathway"miR 34b targets cyclic AMP responsive element bind ......"19258499
hsa-miR-34b-5p

acute myeloid leukemiaApoptosis pathway"miR 34b Targets HSF1 to Suppress Cell Survival in ......"27296951Luciferase
hsa-miR-34b-5p

breast cancercell cycle pathway"Effects on potential targets were analyzed with qP ......"25064703Western blot
hsa-miR-34b-5p

cervical and endocervical cancercell cycle pathway; Apoptosis pathway"miR-34 family members can form a p53-miR-34 positi ......"26619844
hsa-miR-34b-5p

colorectal cancerApoptosis pathway"The miR-34 family members described as potential t ......"23183747
hsa-miR-34b-5p

colorectal cancerWnt signaling pathway"p53 regulates nuclear GSK 3 levels through miR 34 ......"23624843
hsa-miR-34b-5p

colorectal cancercell cycle pathway; Apoptosis pathway"The microRNA miR-34 family is a direct transcripti ......"24337371
hsa-miR-34b-5p

gastric cancercell cycle pathway; Apoptosis pathway"Restoration of tumor suppressor miR 34 inhibits hu ......"18803879Western blot
hsa-miR-34b-5p

gastric cancerApoptosis pathway"In order to identify miRNA signatures for gastric ......"22112324
hsa-miR-34b-5p

kidney renal cell cancercell cycle pathway; Apoptosis pathway"Members of the miR-34 family have been shown to be ......"24503183Luciferase
hsa-miR-34b-5p

liver cancercell cycle pathway; Apoptosis pathway"The miR-34 family members are direct transcription ......"20309940
hsa-miR-34b-5p

lung squamous cell cancercell cycle pathway; Apoptosis pathway"Effect of miR 34b overexpression on the radiosensi ......"22593438Flow cytometry
hsa-miR-34b-5p

melanomacell cycle pathway"Subsequently uveal melanoma cell proliferation was ......"22419847Flow cytometry; Cell migration assay; Luciferase; Western blot
hsa-miR-34b-5p

ovarian cancerApoptosis pathway"Frequent downregulation of miR 34 family in human ......"20145172
hsa-miR-34b-5p

ovarian cancercell cycle pathway"To investigate the effects of miR-449 and miR-34 o ......"21321636Western blot
hsa-miR-34b-5p

ovarian cancerApoptosis pathway"Estrogen combined with progesterone decreases cell ......"24643702MTT assay; Western blot
hsa-miR-34b-5p

ovarian cancercell cycle pathway"The effect of miR-449 and miR-34 on the growth cel ......"26770455Flow cytometry; Cell Proliferation Assay
hsa-miR-34b-5p

ovarian cancercell cycle pathway; Apoptosis pathway"An increasing body of evidence shows that miR-34 f ......"26879132
hsa-miR-34b-5p

pancreatic cancercell cycle pathway; Apoptosis pathway"MicroRNA miR 34 inhibits human pancreatic cancer t ......"19714243
hsa-miR-34b-5p

prostate cancerApoptosis pathway"Importantly DOX did not induce miR-34 in LNCaP gro ......"18497571
hsa-miR-34b-5p

prostate cancercell cycle pathway; Apoptosis pathway"This study was undertaken to investigate the statu ......"23147995Colony formation



Reported cancer prognosis affected by hsa-miR-34b-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-34b-5p

acute myeloid leukemiapoor survival"miR 34b Targets HSF1 to Suppress Cell Survival in ......"27296951Luciferase
hsa-miR-34b-5p

bladder cancerworse prognosis"miR 34 is associated with poor prognosis of patien ......"24078448
hsa-miR-34b-5p

bladder cancerdrug resistance"Focusing on the major obstacle regarding MIBC pati ......"27586262
hsa-miR-34b-5p

breast cancerdrug resistance; poor survival"The mir 34 microRNA is required for the DNA damage ......"19421141
hsa-miR-34b-5p

breast cancerprogression"In the present study we identified the estrogen-re ......"22113133Luciferase
hsa-miR-34b-5p

breast cancerpoor survival"MiR 34b is associated with clinical outcome in tri ......"22439831
hsa-miR-34b-5p

breast cancermetastasis"Our results demonstrate that miR-34a/c functions a ......"23001043
hsa-miR-34b-5p

breast cancerdrug resistance"We used RNAi-mediated p53 knockdown KD and antagom ......"25123132RNAi
hsa-miR-34b-5p

breast cancertumorigenesis; drug resistance"Aberrant methylation of miR 34b is associated with ......"25398683
hsa-miR-34b-5p

colon cancermetastasis"Expression of miR 34 is lost in colon cancer which ......"22992310
hsa-miR-34b-5p

colon cancerworse prognosis; staging; tumorigenesis; progression"Increased microRNA 34b and 34c predominantly expre ......"25894979
hsa-miR-34b-5p

colorectal cancermetastasis"Members of the miR-34 family are induced by the tu ......"24642471
hsa-miR-34b-5p

gastric cancerpoor survival; differentiation"Restoration of tumor suppressor miR 34 inhibits hu ......"18803879Western blot
hsa-miR-34b-5p

gastric cancerdrug resistance"In order to identify miRNA signatures for gastric ......"22112324
hsa-miR-34b-5p

gastric cancertumorigenesis"Previous studies have demonstrated that miR-34 fam ......"25658980
hsa-miR-34b-5p

liver cancertumorigenesis"Numerous studies have focused on the association b ......"23632240
hsa-miR-34b-5p

liver cancertumorigenesis"Previous studies have focused on the association o ......"23935875
hsa-miR-34b-5p

liver cancertumorigenesis"Methylation associated silencing of microRNA 34b i ......"24704024
hsa-miR-34b-5p

lung cancertumorigenesis"The microRNA-34 mir-34 gene family members are dow ......"22964582
hsa-miR-34b-5p

lung squamous cell cancerdrug resistance; poor survival"The miR-34 family is composed of three miRNAs miR- ......"19736307
hsa-miR-34b-5p

lung squamous cell cancerstaging; recurrence"Recently miR-34 family has been shown to be part o ......"21383543
hsa-miR-34b-5p

lung squamous cell cancerdrug resistance; poor survival"Effect of miR 34b overexpression on the radiosensi ......"22593438Flow cytometry
hsa-miR-34b-5p

lung squamous cell cancerpoor survival"Systemic nanodelivery of miR-34 and let-7 suppress ......"25174400
hsa-miR-34b-5p

lung squamous cell cancermetastasis"The differentially expressed microRNAs associated ......"25628919
hsa-miR-34b-5p

lung squamous cell cancerprogression"We found that miR-34b and miR-520h might play impo ......"25702651
hsa-miR-34b-5p

lung squamous cell cancermetastasis; worse prognosis; tumorigenesis"Combined Effect of Metastasis Related MicroRNA miR ......"27444357
hsa-miR-34b-5p

melanomamotility; staging"Epigenetic regulation of microRNA genes and the ro ......"21949788
hsa-miR-34b-5p

melanomacell migration"Subsequently uveal melanoma cell proliferation was ......"22419847Flow cytometry; Cell migration assay; Luciferase; Western blot
hsa-miR-34b-5p

ovarian cancermotility; staging; progression"Frequent downregulation of miR 34 family in human ......"20145172
hsa-miR-34b-5p

ovarian cancerstaging"The aim of this study was to investigate whether m ......"22340095Western blot
hsa-miR-34b-5p

ovarian cancerpoor survival"Estrogen combined with progesterone decreases cell ......"24643702MTT assay; Western blot
hsa-miR-34b-5p

pancreatic cancerpoor survival"MicroRNA miR 34 inhibits human pancreatic cancer t ......"19714243
hsa-miR-34b-5p

pancreatic cancermetastasis; staging; poor survival; progression"MicroRNA 34b inhibits pancreatic cancer metastasis ......"23305226Luciferase
hsa-miR-34b-5p

prostate cancerpoor survival; recurrence"This study was undertaken to investigate the statu ......"23147995Colony formation
hsa-miR-34b-5p

prostate cancermotility"miR 34 cooperates with p53 in suppression of prost ......"24630988
hsa-miR-34b-5p

prostate cancerstaging; progression"Here we used an integrated discovery platform comb ......"26107383
hsa-miR-34b-5p

sarcomadrug resistance"The present study aimed to employ the miRNA respon ......"25335093Luciferase
hsa-miR-34b-5p

thyroid cancermetastasis; recurrence"In this study we evaluated miRNA expression as a m ......"21537871



Reported gene related to hsa-miR-34b-5p

miRNAcancergenereportingPUBMED
hsa-miR-34b-5p

breast cancerTP53"As expected p53 loss caused downregulation of esta ......"25123132
hsa-miR-34b-5p

breast cancerTP53"In particular mammalian miR-34 is upregulated by p ......"19421141
hsa-miR-34b-5p

breast cancerTP53"Recent studies have shown that p53 upregulates miR ......"23292869
hsa-miR-34b-5p

breast cancerTP53"Downregulation of nuclear FOXO3a decreased the exp ......"25647415
hsa-miR-34b-5p

breast cancerTP53"Further validation indicated that estrogen's inhib ......"22113133
hsa-miR-34b-5p

colon cancerTP53"To elucidate the roles of miR-34 family in colon c ......"25894979
hsa-miR-34b-5p

colorectal cancerTP53"Members of the miR-34 family are induced by the tu ......"24642471
hsa-miR-34b-5p

colorectal cancerTP53"We found that miRNA-34b miR-34b and miR-34c two co ......"18519671
hsa-miR-34b-5p

colorectal cancerTP53"The microRNA miR-34 family is a direct transcripti ......"24337371
hsa-miR-34b-5p

colorectal cancerTP53"p53 regulates nuclear GSK 3 levels through miR 34 ......"23624843
hsa-miR-34b-5p

gastric cancerTP53"Restoration of tumor suppressor miR 34 inhibits hu ......"18803879
hsa-miR-34b-5p

head and neck cancerTP53"Among these we found well studied molecules such a ......"24209638
hsa-miR-34b-5p

kidney renal cell cancerTP53"Members of the miR-34 family have been shown to be ......"24503183
hsa-miR-34b-5p

liver cancerTP53"Numerous studies have focused on the association b ......"23632240
hsa-miR-34b-5p

liver cancerTP53"The miR-34 family members are direct transcription ......"20309940
hsa-miR-34b-5p

lung squamous cell cancerTP53"Recently miR-34 family has been shown to be part o ......"21383543
hsa-miR-34b-5p

lung squamous cell cancerTP53"The miR-34 family under-expressed in-non small cel ......"22593438
hsa-miR-34b-5p

ovarian cancerTP53"The miR-34 family is directly transactivated by tu ......"25895459
hsa-miR-34b-5p

ovarian cancerTP53"The miR-34 family is directly transactivated by tu ......"20145172
hsa-miR-34b-5p

ovarian cancerTP53"To investigate the effects of miR-449 and miR-34 o ......"21321636
hsa-miR-34b-5p

ovarian cancerTP53"The expressions of miR-449a/b miR-34b and miR-34c ......"22340095
hsa-miR-34b-5p

pancreatic cancerTP53"Transcription of the three miRNA miR-34 family mem ......"19714243
hsa-miR-34b-5p

prostate cancerTP53"miR 34 cooperates with p53 in suppression of prost ......"24630988
hsa-miR-34b-5p

gastric cancerBCL2"miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......"18803879
hsa-miR-34b-5p

lung cancerBCL2"Tumors harvested from these lungs have elevated le ......"22964582
hsa-miR-34b-5p

ovarian cancerBCL2"Estrogen combined with progesterone decreases cell ......"24643702
hsa-miR-34b-5p

pancreatic cancerBCL2"Among the target proteins regulated by miR-34 are ......"19714243
hsa-miR-34b-5p

acute myeloid leukemiaAPRT"miR 34b targets cyclic AMP responsive element bind ......"19258499
hsa-miR-34b-5p

colorectal cancerAXIN2"p53 regulates nuclear GSK 3 levels through miR 34 ......"23624843
hsa-miR-34b-5p

gastric cancerCASP3"The effects of miR-34 restoration were assessed by ......"18803879
hsa-miR-34b-5p

breast cancerCDC37"These findings show a role for mir-34 in both apop ......"19421141
hsa-miR-34b-5p

acute myeloid leukemiaCREB1"Real-time quantitative PCR revealed that miR-34b w ......"19258499
hsa-miR-34b-5p

lung squamous cell cancerCRK"The overexpression of mir-34b and mir-126 decrease ......"21702040
hsa-miR-34b-5p

lung squamous cell cancerEGFL7"Mir-34b was silenced by the DNA methylation of its ......"21702040
hsa-miR-34b-5p

breast cancerFOSL1"Our results demonstrate that miR-34a/c functions a ......"23001043
hsa-miR-34b-5p

breast cancerFOXO3"Downregulation of nuclear FOXO3a decreased the exp ......"25647415
hsa-miR-34b-5p

gastric cancerHMGA2"miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......"18803879
hsa-miR-34b-5p

acute myeloid leukemiaHSF1"miR 34b Targets HSF1 to Suppress Cell Survival in ......"27296951
hsa-miR-34b-5p

lung squamous cell cancerKRAS"In the p53 wild type KRAS mutated NSCLC cells the ......"22593438
hsa-miR-34b-5p

lung squamous cell cancerMET"The overexpression of mir-34b and mir-126 decrease ......"21702040
hsa-miR-34b-5p

lymphomaMYC"More interestingly hsa-mir-34b was found to be dow ......"18802929
hsa-miR-34b-5p

colon cancerNOTCH1"The re-expression of miR-34 led to a marked reduct ......"22992310
hsa-miR-34b-5p

ovarian cancerSLC10A4"E2 + P4 promoted the expression of let-7a and miR- ......"24643702
hsa-miR-34b-5p

liver cancerSLC25A19"The aim of the current study was to investigate th ......"27165229
hsa-miR-34b-5p

pancreatic cancerSMAD3"MicroRNA 34b inhibits pancreatic cancer metastasis ......"23305226
hsa-miR-34b-5p

colorectal cancerSNAI1"EMT-TFs and microRNAs such as ZEB1/2 and miR-200 o ......"27573895
hsa-miR-34b-5p

prostate cancerSOX2"In turn loss of miR-34b resulted in downstream der ......"26107383



Expression profile in cancer corhorts: