microRNA information: hsa-miR-34b-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-34b-5p | miRbase |
Accession: | MIMAT0000685 | miRbase |
Precursor name: | hsa-mir-34b | miRbase |
Precursor accession: | MI0000742 | miRbase |
Symbol: | MIR34B | HGNC |
RefSeq ID: | NR_029839 | GenBank |
Sequence: | UAGGCAGUGUCAUUAGCUGAUUG |
Reported expression in cancers: hsa-miR-34b-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-34b-5p | acute myeloid leukemia | upregulation | "We found that miR-34b was developmentally upregula ......" | 27296951 | |
hsa-miR-34b-5p | colorectal cancer | downregulation | "The miR-34 family members described as potential t ......" | 23183747 | RNA-Seq |
hsa-miR-34b-5p | gastric cancer | downregulation | "We found that miR-34b and miR-34c are epigenetical ......" | 20924086 | |
hsa-miR-34b-5p | gastric cancer | downregulation | "Epigenetic regulation of miR 34b and miR 129 expre ......" | 21960261 | |
hsa-miR-34b-5p | head and neck cancer | deregulation | "2012;488:686-91 including 7 consistently up-regula ......" | 24422025 | |
hsa-miR-34b-5p | liver cancer | downregulation | "Methylation associated silencing of microRNA 34b i ......" | 24704024 | Reverse transcription PCR |
hsa-miR-34b-5p | lung cancer | downregulation | "The miR-34 family consists of tumor-suppressive mi ......" | 23805317 | |
hsa-miR-34b-5p | lung squamous cell cancer | downregulation | "We have analyzed the impact of miR-34 expression o ......" | 19736307 | Reverse transcription PCR |
hsa-miR-34b-5p | lung squamous cell cancer | downregulation | "The miR-34 family is comprised of tumor-suppressiv ......" | 22047961 | |
hsa-miR-34b-5p | pancreatic cancer | downregulation | "In human specimens we found that miR-34b was down- ......" | 23305226 | |
hsa-miR-34b-5p | prostate cancer | downregulation | "Using novel high throughput technologies we identi ......" | 23573364 | |
hsa-miR-34b-5p | thyroid cancer | downregulation | "In this study we evaluated miRNA expression as a m ......" | 21537871 | Microarray |
hsa-miR-34b-5p | thyroid cancer | upregulation | "Additionally the relative expression levels of miR ......" | 26402809 | Reverse transcription PCR; qPCR |
Reported cancer pathway affected by hsa-miR-34b-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-34b-5p | acute myeloid leukemia | cell cycle pathway | "miR 34b targets cyclic AMP responsive element bind ......" | 19258499 | |
hsa-miR-34b-5p | acute myeloid leukemia | Apoptosis pathway | "miR 34b Targets HSF1 to Suppress Cell Survival in ......" | 27296951 | Luciferase |
hsa-miR-34b-5p | breast cancer | cell cycle pathway | "Effects on potential targets were analyzed with qP ......" | 25064703 | Western blot |
hsa-miR-34b-5p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "miR-34 family members can form a p53-miR-34 positi ......" | 26619844 | |
hsa-miR-34b-5p | colorectal cancer | Apoptosis pathway | "The miR-34 family members described as potential t ......" | 23183747 | |
hsa-miR-34b-5p | colorectal cancer | Wnt signaling pathway | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 | |
hsa-miR-34b-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "The microRNA miR-34 family is a direct transcripti ......" | 24337371 | |
hsa-miR-34b-5p | gastric cancer | cell cycle pathway; Apoptosis pathway | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 | Western blot |
hsa-miR-34b-5p | gastric cancer | Apoptosis pathway | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
hsa-miR-34b-5p | kidney renal cell cancer | cell cycle pathway; Apoptosis pathway | "Members of the miR-34 family have been shown to be ......" | 24503183 | Luciferase |
hsa-miR-34b-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "The miR-34 family members are direct transcription ......" | 20309940 | |
hsa-miR-34b-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "Effect of miR 34b overexpression on the radiosensi ......" | 22593438 | Flow cytometry |
hsa-miR-34b-5p | melanoma | cell cycle pathway | "Subsequently uveal melanoma cell proliferation was ......" | 22419847 | Flow cytometry; Cell migration assay; Luciferase; Western blot |
hsa-miR-34b-5p | ovarian cancer | Apoptosis pathway | "Frequent downregulation of miR 34 family in human ......" | 20145172 | |
hsa-miR-34b-5p | ovarian cancer | cell cycle pathway | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 | Western blot |
hsa-miR-34b-5p | ovarian cancer | Apoptosis pathway | "Estrogen combined with progesterone decreases cell ......" | 24643702 | MTT assay; Western blot |
hsa-miR-34b-5p | ovarian cancer | cell cycle pathway | "The effect of miR-449 and miR-34 on the growth cel ......" | 26770455 | Flow cytometry; Cell Proliferation Assay |
hsa-miR-34b-5p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "An increasing body of evidence shows that miR-34 f ......" | 26879132 | |
hsa-miR-34b-5p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA miR 34 inhibits human pancreatic cancer t ......" | 19714243 | |
hsa-miR-34b-5p | prostate cancer | Apoptosis pathway | "Importantly DOX did not induce miR-34 in LNCaP gro ......" | 18497571 | |
hsa-miR-34b-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "This study was undertaken to investigate the statu ......" | 23147995 | Colony formation |
Reported cancer prognosis affected by hsa-miR-34b-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-34b-5p | acute myeloid leukemia | poor survival | "miR 34b Targets HSF1 to Suppress Cell Survival in ......" | 27296951 | Luciferase |
hsa-miR-34b-5p | bladder cancer | worse prognosis | "miR 34 is associated with poor prognosis of patien ......" | 24078448 | |
hsa-miR-34b-5p | bladder cancer | drug resistance | "Focusing on the major obstacle regarding MIBC pati ......" | 27586262 | |
hsa-miR-34b-5p | breast cancer | drug resistance; poor survival | "The mir 34 microRNA is required for the DNA damage ......" | 19421141 | |
hsa-miR-34b-5p | breast cancer | progression | "In the present study we identified the estrogen-re ......" | 22113133 | Luciferase |
hsa-miR-34b-5p | breast cancer | poor survival | "MiR 34b is associated with clinical outcome in tri ......" | 22439831 | |
hsa-miR-34b-5p | breast cancer | metastasis | "Our results demonstrate that miR-34a/c functions a ......" | 23001043 | |
hsa-miR-34b-5p | breast cancer | drug resistance | "We used RNAi-mediated p53 knockdown KD and antagom ......" | 25123132 | RNAi |
hsa-miR-34b-5p | breast cancer | tumorigenesis; drug resistance | "Aberrant methylation of miR 34b is associated with ......" | 25398683 | |
hsa-miR-34b-5p | colon cancer | metastasis | "Expression of miR 34 is lost in colon cancer which ......" | 22992310 | |
hsa-miR-34b-5p | colon cancer | worse prognosis; staging; tumorigenesis; progression | "Increased microRNA 34b and 34c predominantly expre ......" | 25894979 | |
hsa-miR-34b-5p | colorectal cancer | metastasis | "Members of the miR-34 family are induced by the tu ......" | 24642471 | |
hsa-miR-34b-5p | gastric cancer | poor survival; differentiation | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 | Western blot |
hsa-miR-34b-5p | gastric cancer | drug resistance | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
hsa-miR-34b-5p | gastric cancer | tumorigenesis | "Previous studies have demonstrated that miR-34 fam ......" | 25658980 | |
hsa-miR-34b-5p | liver cancer | tumorigenesis | "Numerous studies have focused on the association b ......" | 23632240 | |
hsa-miR-34b-5p | liver cancer | tumorigenesis | "Previous studies have focused on the association o ......" | 23935875 | |
hsa-miR-34b-5p | liver cancer | tumorigenesis | "Methylation associated silencing of microRNA 34b i ......" | 24704024 | |
hsa-miR-34b-5p | lung cancer | tumorigenesis | "The microRNA-34 mir-34 gene family members are dow ......" | 22964582 | |
hsa-miR-34b-5p | lung squamous cell cancer | drug resistance; poor survival | "The miR-34 family is composed of three miRNAs miR- ......" | 19736307 | |
hsa-miR-34b-5p | lung squamous cell cancer | staging; recurrence | "Recently miR-34 family has been shown to be part o ......" | 21383543 | |
hsa-miR-34b-5p | lung squamous cell cancer | drug resistance; poor survival | "Effect of miR 34b overexpression on the radiosensi ......" | 22593438 | Flow cytometry |
hsa-miR-34b-5p | lung squamous cell cancer | poor survival | "Systemic nanodelivery of miR-34 and let-7 suppress ......" | 25174400 | |
hsa-miR-34b-5p | lung squamous cell cancer | metastasis | "The differentially expressed microRNAs associated ......" | 25628919 | |
hsa-miR-34b-5p | lung squamous cell cancer | progression | "We found that miR-34b and miR-520h might play impo ......" | 25702651 | |
hsa-miR-34b-5p | lung squamous cell cancer | metastasis; worse prognosis; tumorigenesis | "Combined Effect of Metastasis Related MicroRNA miR ......" | 27444357 | |
hsa-miR-34b-5p | melanoma | motility; staging | "Epigenetic regulation of microRNA genes and the ro ......" | 21949788 | |
hsa-miR-34b-5p | melanoma | cell migration | "Subsequently uveal melanoma cell proliferation was ......" | 22419847 | Flow cytometry; Cell migration assay; Luciferase; Western blot |
hsa-miR-34b-5p | ovarian cancer | motility; staging; progression | "Frequent downregulation of miR 34 family in human ......" | 20145172 | |
hsa-miR-34b-5p | ovarian cancer | staging | "The aim of this study was to investigate whether m ......" | 22340095 | Western blot |
hsa-miR-34b-5p | ovarian cancer | poor survival | "Estrogen combined with progesterone decreases cell ......" | 24643702 | MTT assay; Western blot |
hsa-miR-34b-5p | pancreatic cancer | poor survival | "MicroRNA miR 34 inhibits human pancreatic cancer t ......" | 19714243 | |
hsa-miR-34b-5p | pancreatic cancer | metastasis; staging; poor survival; progression | "MicroRNA 34b inhibits pancreatic cancer metastasis ......" | 23305226 | Luciferase |
hsa-miR-34b-5p | prostate cancer | poor survival; recurrence | "This study was undertaken to investigate the statu ......" | 23147995 | Colony formation |
hsa-miR-34b-5p | prostate cancer | motility | "miR 34 cooperates with p53 in suppression of prost ......" | 24630988 | |
hsa-miR-34b-5p | prostate cancer | staging; progression | "Here we used an integrated discovery platform comb ......" | 26107383 | |
hsa-miR-34b-5p | sarcoma | drug resistance | "The present study aimed to employ the miRNA respon ......" | 25335093 | Luciferase |
hsa-miR-34b-5p | thyroid cancer | metastasis; recurrence | "In this study we evaluated miRNA expression as a m ......" | 21537871 |
Reported gene related to hsa-miR-34b-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-34b-5p | breast cancer | TP53 | "As expected p53 loss caused downregulation of esta ......" | 25123132 |
hsa-miR-34b-5p | breast cancer | TP53 | "In particular mammalian miR-34 is upregulated by p ......" | 19421141 |
hsa-miR-34b-5p | breast cancer | TP53 | "Recent studies have shown that p53 upregulates miR ......" | 23292869 |
hsa-miR-34b-5p | breast cancer | TP53 | "Downregulation of nuclear FOXO3a decreased the exp ......" | 25647415 |
hsa-miR-34b-5p | breast cancer | TP53 | "Further validation indicated that estrogen's inhib ......" | 22113133 |
hsa-miR-34b-5p | colon cancer | TP53 | "To elucidate the roles of miR-34 family in colon c ......" | 25894979 |
hsa-miR-34b-5p | colorectal cancer | TP53 | "Members of the miR-34 family are induced by the tu ......" | 24642471 |
hsa-miR-34b-5p | colorectal cancer | TP53 | "We found that miRNA-34b miR-34b and miR-34c two co ......" | 18519671 |
hsa-miR-34b-5p | colorectal cancer | TP53 | "The microRNA miR-34 family is a direct transcripti ......" | 24337371 |
hsa-miR-34b-5p | colorectal cancer | TP53 | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 |
hsa-miR-34b-5p | gastric cancer | TP53 | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 |
hsa-miR-34b-5p | head and neck cancer | TP53 | "Among these we found well studied molecules such a ......" | 24209638 |
hsa-miR-34b-5p | kidney renal cell cancer | TP53 | "Members of the miR-34 family have been shown to be ......" | 24503183 |
hsa-miR-34b-5p | liver cancer | TP53 | "Numerous studies have focused on the association b ......" | 23632240 |
hsa-miR-34b-5p | liver cancer | TP53 | "The miR-34 family members are direct transcription ......" | 20309940 |
hsa-miR-34b-5p | lung squamous cell cancer | TP53 | "Recently miR-34 family has been shown to be part o ......" | 21383543 |
hsa-miR-34b-5p | lung squamous cell cancer | TP53 | "The miR-34 family under-expressed in-non small cel ......" | 22593438 |
hsa-miR-34b-5p | ovarian cancer | TP53 | "The miR-34 family is directly transactivated by tu ......" | 25895459 |
hsa-miR-34b-5p | ovarian cancer | TP53 | "The miR-34 family is directly transactivated by tu ......" | 20145172 |
hsa-miR-34b-5p | ovarian cancer | TP53 | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 |
hsa-miR-34b-5p | ovarian cancer | TP53 | "The expressions of miR-449a/b miR-34b and miR-34c ......" | 22340095 |
hsa-miR-34b-5p | pancreatic cancer | TP53 | "Transcription of the three miRNA miR-34 family mem ......" | 19714243 |
hsa-miR-34b-5p | prostate cancer | TP53 | "miR 34 cooperates with p53 in suppression of prost ......" | 24630988 |
hsa-miR-34b-5p | gastric cancer | BCL2 | "miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......" | 18803879 |
hsa-miR-34b-5p | lung cancer | BCL2 | "Tumors harvested from these lungs have elevated le ......" | 22964582 |
hsa-miR-34b-5p | ovarian cancer | BCL2 | "Estrogen combined with progesterone decreases cell ......" | 24643702 |
hsa-miR-34b-5p | pancreatic cancer | BCL2 | "Among the target proteins regulated by miR-34 are ......" | 19714243 |
hsa-miR-34b-5p | acute myeloid leukemia | APRT | "miR 34b targets cyclic AMP responsive element bind ......" | 19258499 |
hsa-miR-34b-5p | colorectal cancer | AXIN2 | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 |
hsa-miR-34b-5p | gastric cancer | CASP3 | "The effects of miR-34 restoration were assessed by ......" | 18803879 |
hsa-miR-34b-5p | breast cancer | CDC37 | "These findings show a role for mir-34 in both apop ......" | 19421141 |
hsa-miR-34b-5p | acute myeloid leukemia | CREB1 | "Real-time quantitative PCR revealed that miR-34b w ......" | 19258499 |
hsa-miR-34b-5p | lung squamous cell cancer | CRK | "The overexpression of mir-34b and mir-126 decrease ......" | 21702040 |
hsa-miR-34b-5p | lung squamous cell cancer | EGFL7 | "Mir-34b was silenced by the DNA methylation of its ......" | 21702040 |
hsa-miR-34b-5p | breast cancer | FOSL1 | "Our results demonstrate that miR-34a/c functions a ......" | 23001043 |
hsa-miR-34b-5p | breast cancer | FOXO3 | "Downregulation of nuclear FOXO3a decreased the exp ......" | 25647415 |
hsa-miR-34b-5p | gastric cancer | HMGA2 | "miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......" | 18803879 |
hsa-miR-34b-5p | acute myeloid leukemia | HSF1 | "miR 34b Targets HSF1 to Suppress Cell Survival in ......" | 27296951 |
hsa-miR-34b-5p | lung squamous cell cancer | KRAS | "In the p53 wild type KRAS mutated NSCLC cells the ......" | 22593438 |
hsa-miR-34b-5p | lung squamous cell cancer | MET | "The overexpression of mir-34b and mir-126 decrease ......" | 21702040 |
hsa-miR-34b-5p | lymphoma | MYC | "More interestingly hsa-mir-34b was found to be dow ......" | 18802929 |
hsa-miR-34b-5p | colon cancer | NOTCH1 | "The re-expression of miR-34 led to a marked reduct ......" | 22992310 |
hsa-miR-34b-5p | ovarian cancer | SLC10A4 | "E2 + P4 promoted the expression of let-7a and miR- ......" | 24643702 |
hsa-miR-34b-5p | liver cancer | SLC25A19 | "The aim of the current study was to investigate th ......" | 27165229 |
hsa-miR-34b-5p | pancreatic cancer | SMAD3 | "MicroRNA 34b inhibits pancreatic cancer metastasis ......" | 23305226 |
hsa-miR-34b-5p | colorectal cancer | SNAI1 | "EMT-TFs and microRNAs such as ZEB1/2 and miR-200 o ......" | 27573895 |
hsa-miR-34b-5p | prostate cancer | SOX2 | "In turn loss of miR-34b resulted in downstream der ......" | 26107383 |
Expression profile in cancer corhorts: