microRNA information: hsa-miR-34c-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-34c-3p | miRbase |
Accession: | MIMAT0004677 | miRbase |
Precursor name: | hsa-mir-34c | miRbase |
Precursor accession: | MI0000743 | miRbase |
Symbol: | MIR34C | HGNC |
RefSeq ID: | NR_029840 | GenBank |
Sequence: | AAUCACUAACCACACGGCCAGG |
Reported expression in cancers: hsa-miR-34c-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-34c-3p | breast cancer | downregulation | "Effects on potential targets were analyzed with qP ......" | 25064703 | qPCR |
hsa-miR-34c-3p | breast cancer | downregulation | "Here we found that microRNA-34c miR-34c was signif ......" | 27698902 | |
hsa-miR-34c-3p | colorectal cancer | downregulation | "Silence of the tumor suppressor miR-34c is implica ......" | 26674205 | qPCR |
hsa-miR-34c-3p | gastric cancer | downregulation | "We found that miR-34b and miR-34c are epigenetical ......" | 20924086 | |
hsa-miR-34c-3p | liver cancer | downregulation | "Recent studies have shown that microRNA-34c-3p miR ......" | 26722462 | qPCR |
hsa-miR-34c-3p | lung cancer | downregulation | "MiR-34a and miR-34c were downregulated in lung tum ......" | 23805317 | |
hsa-miR-34c-3p | lung squamous cell cancer | downregulation | "MiR 34c 3p suppresses the proliferation and invasi ......" | 26261507 | |
hsa-miR-34c-3p | ovarian cancer | downregulation | "The variations in cell growth rate and cell cycle ......" | 26770455 | |
hsa-miR-34c-3p | prostate cancer | downregulation | "miR 34c is downregulated in prostate cancer and ex ......" | 21351256 | qPCR |
hsa-miR-34c-3p | prostate cancer | downregulation | "The microRNA miR-34c is a well-established regulat ......" | 23922103 |
Reported cancer pathway affected by hsa-miR-34c-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-34c-3p | breast cancer | Epithelial mesenchymal transition pathway | "MicroRNA 34c gene down regulation via DNA methylat ......" | 22074923 | |
hsa-miR-34c-3p | breast cancer | cell cycle pathway | "Expression of miR 34c induces G2/M cell cycle arre ......" | 25064703 | Western blot |
hsa-miR-34c-3p | liver cancer | cell cycle pathway | "MicroRNA 34c 3p promotes cell proliferation and in ......" | 27704267 | Luciferase; Colony formation |
hsa-miR-34c-3p | lung cancer | Apoptosis pathway | "miR 34c may protect lung cancer cells from paclita ......" | 22370637 | |
hsa-miR-34c-3p | lung squamous cell cancer | cell cycle pathway | "miR 34c 3p functions as a tumour suppressor by inh ......" | 26250586 | Western blot; Luciferase |
hsa-miR-34c-3p | melanoma | cell cycle pathway | "Subsequently uveal melanoma cell proliferation was ......" | 22419847 | Flow cytometry; Cell migration assay; Luciferase; Western blot |
hsa-miR-34c-3p | ovarian cancer | cell cycle pathway | "miR 449b and miR 34c on inducing down regulation o ......" | 21321636 | Western blot |
hsa-miR-34c-3p | ovarian cancer | cell cycle pathway | "The reactivation of p53 was detected by Western bl ......" | 22340095 | Western blot |
hsa-miR-34c-3p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "Functional analysis of miR 34c as a putative tumor ......" | 25273528 | |
hsa-miR-34c-3p | ovarian cancer | cell cycle pathway | "The variations in cell growth rate and cell cycle ......" | 26770455 | Flow cytometry; Cell Proliferation Assay; Western blot |
hsa-miR-34c-3p | prostate cancer | Apoptosis pathway | "MiR-34c expression increased 27 fold after DOX and ......" | 18497571 | |
hsa-miR-34c-3p | prostate cancer | Apoptosis pathway | "miR 34c is downregulated in prostate cancer and ex ......" | 21351256 | |
hsa-miR-34c-3p | prostate cancer | cell cycle pathway | "The tumour suppressor miR 34c targets MET in prost ......" | 23922103 | Luciferase |
Reported cancer prognosis affected by hsa-miR-34c-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-34c-3p | breast cancer | poor survival | "Global miRNA expression profiling was performed on ......" | 19798417 | |
hsa-miR-34c-3p | breast cancer | metastasis | "Here we describe the regulation and function of mi ......" | 23001043 | |
hsa-miR-34c-3p | breast cancer | worse prognosis; progression | "Expression of miR 34c induces G2/M cell cycle arre ......" | 25064703 | Western blot |
hsa-miR-34c-3p | breast cancer | cell migration | "MicroRNA 34c Suppresses Breast Cancer Migration an ......" | 27698902 | |
hsa-miR-34c-3p | colorectal cancer | metastasis; tumorigenesis | "KITLG is a novel target of miR 34c that is associa ......" | 25213795 | Luciferase |
hsa-miR-34c-3p | colorectal cancer | progression | "Resveratrol elicits anti colorectal cancer effect ......" | 26674205 | Flow cytometry; Colony formation; Western blot |
hsa-miR-34c-3p | gastric cancer | drug resistance | "Regulation of microtubule associated protein tau M ......" | 23423488 | Western blot; Luciferase; MTT assay |
hsa-miR-34c-3p | gastric cancer | tumorigenesis; poor survival | "PABPC1 exerts carcinogenesis in gastric carcinoma ......" | 26097561 | |
hsa-miR-34c-3p | liver cancer | metastasis; staging | "miR 34c 3p inhibits cell proliferation migration a ......" | 26722462 | Luciferase |
hsa-miR-34c-3p | liver cancer | poor survival; worse prognosis | "MicroRNA 34c 3p promotes cell proliferation and in ......" | 27704267 | Luciferase; Colony formation |
hsa-miR-34c-3p | lung cancer | drug resistance | "We analyzed the expression of 14 selected miRNAs b ......" | 23268837 | |
hsa-miR-34c-3p | lung cancer | poor survival | "Some representative cases from each group were pro ......" | 26170125 | |
hsa-miR-34c-3p | lung squamous cell cancer | drug resistance | "The miR-34 family is composed of three miRNAs miR- ......" | 19736307 | |
hsa-miR-34c-3p | lung squamous cell cancer | progression | "miR 34c 3p functions as a tumour suppressor by inh ......" | 26250586 | Western blot; Luciferase |
hsa-miR-34c-3p | melanoma | cell migration | "Subsequently uveal melanoma cell proliferation was ......" | 22419847 | Flow cytometry; Cell migration assay; Luciferase; Western blot |
hsa-miR-34c-3p | ovarian cancer | malignant trasformation | "miR 449b and miR 34c on inducing down regulation o ......" | 21321636 | Western blot |
hsa-miR-34c-3p | ovarian cancer | staging | "The reactivation of p53 was detected by Western bl ......" | 22340095 | Western blot |
hsa-miR-34c-3p | ovarian cancer | tumorigenesis | "Functional analysis of miR 34c as a putative tumor ......" | 25273528 | |
hsa-miR-34c-3p | pancreatic cancer | staging | "In addition from 10 to 50 weeks of age stage-speci ......" | 26516699 | |
hsa-miR-34c-3p | prostate cancer | drug resistance | "Using multiplexed quantitative real-time PCR we pe ......" | 18668526 | |
hsa-miR-34c-3p | prostate cancer | metastasis; poor survival | "miR 34c is downregulated in prostate cancer and ex ......" | 21351256 | |
hsa-miR-34c-3p | prostate cancer | progression | "The tumour suppressor miR 34c targets MET in prost ......" | 23922103 | Luciferase |
hsa-miR-34c-3p | sarcoma | metastasis; drug resistance | "MiR 34c inhibits osteosarcoma metastasis and chemo ......" | 24802328 |
Reported gene related to hsa-miR-34c-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-34c-3p | breast cancer | TP53 | "Downregulation of nuclear FOXO3a decreased the exp ......" | 25647415 |
hsa-miR-34c-3p | colorectal cancer | TP53 | "The anti-CRC effect of Res was partially but speci ......" | 26674205 |
hsa-miR-34c-3p | colorectal cancer | TP53 | "We found that miRNA-34b miR-34b and miR-34c two co ......" | 18519671 |
hsa-miR-34c-3p | ovarian cancer | TP53 | "The expressions of miR-449a/b miR-34b and miR-34c ......" | 22340095 |
hsa-miR-34c-3p | sarcoma | TP53 | "Importantly Nutlin-3-mediated stabilization of p53 ......" | 23720736 |
hsa-miR-34c-3p | colorectal cancer | KITLG | "KITLG is a novel target of miR 34c that is associa ......" | 25213795 |
hsa-miR-34c-3p | colorectal cancer | KITLG | "Resveratrol elicits anti colorectal cancer effect ......" | 26674205 |
hsa-miR-34c-3p | colorectal cancer | KITLG | "Interrupted E2F1 miR 34c SCF negative feedback loo ......" | 26704889 |
hsa-miR-34c-3p | prostate cancer | AR | "In particular analysis of clinical prostate cancer ......" | 21343391 |
hsa-miR-34c-3p | prostate cancer | BCL2 | "In concordance to this miR-34c was found to negati ......" | 21351256 |
hsa-miR-34c-3p | breast cancer | CDC23 | "In addition the levels of CDC23 an important media ......" | 25064703 |
hsa-miR-34c-3p | ovarian cancer | CDC25A | "Ectopic expression of miR-449b and miR-34c resulte ......" | 21321636 |
hsa-miR-34c-3p | ovarian cancer | CDK6 | "Ectopic expression of miR-449b and miR-34c resulte ......" | 21321636 |
hsa-miR-34c-3p | colorectal cancer | E2F1 | "Interrupted E2F1 miR 34c SCF negative feedback loo ......" | 26704889 |
hsa-miR-34c-3p | prostate cancer | E2F3 | "In concordance to this miR-34c was found to negati ......" | 21351256 |
hsa-miR-34c-3p | lung cancer | EGFR | "In EGFR exon 19 mutation group miR-34c high expres ......" | 26170125 |
hsa-miR-34c-3p | lung squamous cell cancer | EIF4E | "miR 34c 3p functions as a tumour suppressor by inh ......" | 26250586 |
hsa-miR-34c-3p | breast cancer | FOXO3 | "Downregulation of nuclear FOXO3a decreased the exp ......" | 25647415 |
hsa-miR-34c-3p | breast cancer | GIT1 | "MicroRNA 34c Suppresses Breast Cancer Migration an ......" | 27698902 |
hsa-miR-34c-3p | sarcoma | LEF1 | "Taken together our data indicate that miR-34c supp ......" | 24802328 |
hsa-miR-34c-3p | liver cancer | MARCKS | "miR 34c 3p inhibits cell proliferation migration a ......" | 26722462 |
hsa-miR-34c-3p | liver cancer | NCKAP1 | "MicroRNA 34c 3p promotes cell proliferation and in ......" | 27704267 |
hsa-miR-34c-3p | sarcoma | NOTCH1 | "Taken together our data indicate that miR-34c supp ......" | 24802328 |
hsa-miR-34c-3p | breast cancer | NOTCH4 | "Ectopic expression of miR-34c reduced the self-ren ......" | 22074923 |
hsa-miR-34c-3p | gastric cancer | PABPC1 | "PABPC1 exerts carcinogenesis in gastric carcinoma ......" | 26097561 |
hsa-miR-34c-3p | lung cancer | PCNA | "The miR-34c target cyclin E was repressed by miR-3 ......" | 19228723 |
hsa-miR-34c-3p | ovarian cancer | PHLDA2 | "miR 449b and miR 34c on inducing down regulation o ......" | 21321636 |
hsa-miR-34c-3p | breast cancer | PRKCA | "However protein levels of PRKCA a predicted miR-34 ......" | 25064703 |
hsa-miR-34c-3p | sarcoma | RUNX2 | "The p53-dependent miR-34c is the most significantl ......" | 23720736 |
hsa-miR-34c-3p | breast cancer | SP1 | "Furthermore we identified a single hypermethylated ......" | 22074923 |
hsa-miR-34c-3p | lung cancer | TXK | "In this study we found that miR-34a and miR-34c ta ......" | 23805317 |
Expression profile in cancer corhorts: