microRNA information: hsa-miR-3613-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-3613-3p | miRbase |
| Accession: | MIMAT0017991 | miRbase |
| Precursor name: | hsa-mir-3613 | miRbase |
| Precursor accession: | MI0016003 | miRbase |
| Symbol: | MIR3613 | HGNC |
| RefSeq ID: | NR_037407 | GenBank |
| Sequence: | ACAAAAAAAAAAGCCCAACCCUUC |
Reported expression in cancers: hsa-miR-3613-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-3613-3p | thyroid cancer | deregulation | "Quantitative real-time PCR qRT-PCR was used to val ......" | 26380656 | qPCR |
Reported cancer pathway affected by hsa-miR-3613-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-3613-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-3613-3p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
| hsa-miR-3613-3p | lung squamous cell cancer | staging | "We found that tissue-specific and plasma miR-211-3 ......" | 27148421 |
Reported gene related to hsa-miR-3613-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|