microRNA information: hsa-miR-3614-5p

SectionIDlink
Mature name: hsa-miR-3614-5pmiRbase
Accession: MIMAT0017992miRbase
Precursor name: hsa-mir-3614 miRbase
Precursor accession: MI0016004miRbase
Symbol: MIR3614HGNC
RefSeq ID: NR_037408GenBank
Sequence: CCACUUGGAUCUGAAGGCUGCCC



Reported expression in cancers: hsa-miR-3614-5p

miRNAcancerregulationreportingPUBMEDmethod



Reported cancer pathway affected by hsa-miR-3614-5p

miRNAcancerpathwayreportingPUBMEDfunctional study



Reported cancer prognosis affected by hsa-miR-3614-5p

miRNAcancerprognosisreportingPUBMEDfunctional study



Reported gene related to hsa-miR-3614-5p

miRNAcancergenereportingPUBMED



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-3614-5p
DTX3
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.14; TCGA CESC -0.093; TCGA ESCA -0.383; TCGA HNSC -0.15; TCGA LUAD -0.066; TCGA LUSC -0.131; TCGA PAAD -0.127; TCGA STAD -0.269; TCGA UCEC -0.074
hsa-miR-3614-5p
RASL10B
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.176; TCGA CESC -0.183; TCGA ESCA -0.213; TCGA HNSC -0.265; TCGA LUAD -0.258; TCGA LUSC -0.218; TCGA PAAD -0.231; TCGA STAD -0.343; TCGA UCEC -0.245
hsa-miR-3614-5p
RAB6B
10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.112; TCGA CESC -0.211; TCGA ESCA -0.341; TCGA HNSC -0.383; TCGA LIHC -0.252; TCGA LUAD -0.166; TCGA LUSC -0.355; TCGA PAAD -0.127; TCGA STAD -0.268; TCGA UCEC -0.178
hsa-miR-3614-5p
PSKH1
9 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.107; TCGA CESC -0.078; TCGA ESCA -0.103; TCGA HNSC -0.051; TCGA LIHC -0.121; TCGA LUSC -0.06; TCGA PAAD -0.091; TCGA STAD -0.099; TCGA UCEC -0.11
hsa-miR-3614-5p
JAKMIP3
10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.272; TCGA CESC -0.378; TCGA ESCA -0.573; TCGA HNSC -0.466; TCGA LIHC -0.141; TCGA LUAD -0.155; TCGA LUSC -0.517; TCGA PAAD -0.162; TCGA STAD -0.181; TCGA UCEC -0.192
hsa-miR-3614-5p
MAFG
9 cancers: BLCA; CESC; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.059; TCGA CESC -0.079; TCGA HNSC -0.083; TCGA LIHC -0.143; TCGA LUAD -0.071; TCGA LUSC -0.164; TCGA PAAD -0.087; TCGA STAD -0.105; TCGA UCEC -0.153
hsa-miR-3614-5p
NPTXR
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.3; TCGA CESC -0.245; TCGA ESCA -0.722; TCGA HNSC -0.351; TCGA LUAD -0.126; TCGA LUSC -0.252; TCGA PAAD -0.16; TCGA STAD -0.459; TCGA UCEC -0.306
hsa-miR-3614-5p
SYNGR1
9 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.281; TCGA CESC -0.228; TCGA ESCA -0.561; TCGA HNSC -0.347; TCGA LIHC -0.144; TCGA LUAD -0.087; TCGA LUSC -0.137; TCGA PAAD -0.176; TCGA UCEC -0.086
hsa-miR-3614-5p
ZNF862
9 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.123; TCGA CESC -0.102; TCGA ESCA -0.206; TCGA HNSC -0.182; TCGA LIHC -0.123; TCGA LUAD -0.138; TCGA LUSC -0.1; TCGA STAD -0.142; TCGA UCEC -0.067





Enriched cancer pathways of putative targets