microRNA information: hsa-miR-363-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-363-3p | miRbase |
| Accession: | MIMAT0000707 | miRbase |
| Precursor name: | hsa-mir-363 | miRbase |
| Precursor accession: | MI0000764 | miRbase |
| Symbol: | MIR363 | HGNC |
| RefSeq ID: | NR_029852 | GenBank |
| Sequence: | AAUUGCACGGUAUCCAUCUGUA |
Reported expression in cancers: hsa-miR-363-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-363-3p | acute myeloid leukemia | upregulation | "To identify miRNAs related to therapeutic response ......" | 23689423 | Microarray; qPCR |
| hsa-miR-363-3p | colorectal cancer | downregulation | "In the present study we showed that miR-363-3p was ......" | 27084453 | |
| hsa-miR-363-3p | gastric cancer | downregulation | "Thus the differential expression of a panel of miR ......" | 26171025 | Microarray; qPCR |
| hsa-miR-363-3p | gastric cancer | downregulation | "Using Limma package in R a total of 27 differentia ......" | 26692821 | |
| hsa-miR-363-3p | head and neck cancer | downregulation | "In this study we have first confirmed that miR-363 ......" | 23246488 | |
| hsa-miR-363-3p | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-363-3p | lymphoma | downregulation | "Intriguingly both hsa-miR-363 and hsa-miR-200a bel ......" | 26893685 |
Reported cancer pathway affected by hsa-miR-363-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-363-3p | breast cancer | Apoptosis pathway | "MiR 363 sensitizes cisplatin induced apoptosis tar ......" | 25416050 | |
| hsa-miR-363-3p | glioblastoma | Apoptosis pathway | "Using FACS sorting of low-passage cell samples fol ......" | 24805821 | Luciferase |
Reported cancer prognosis affected by hsa-miR-363-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-363-3p | acute myeloid leukemia | drug resistance | "To identify miRNAs related to therapeutic response ......" | 23689423 | |
| hsa-miR-363-3p | breast cancer | staging; drug resistance | "MiR 363 sensitizes cisplatin induced apoptosis tar ......" | 25416050 | |
| hsa-miR-363-3p | colorectal cancer | metastasis; cell migration | "MiR 363 3p inhibits the epithelial to mesenchymal ......" | 27084453 | |
| hsa-miR-363-3p | gastric cancer | staging; metastasis; differentiation | "Thus the differential expression of a panel of miR ......" | 26171025 | |
| hsa-miR-363-3p | gastric cancer | drug resistance; progression; poor survival; recurrence | "miR 363 promotes proliferation and chemo resistanc ......" | 27167197 | |
| hsa-miR-363-3p | glioblastoma | poor survival | "Using FACS sorting of low-passage cell samples fol ......" | 24805821 | Luciferase |
| hsa-miR-363-3p | head and neck cancer | metastasis | "Dysregulated miR 363 affects head and neck cancer ......" | 23246488 | |
| hsa-miR-363-3p | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-363-3p | head and neck cancer | cell migration | "MicroRNA 363 targets myosin 1B to reduce cellular ......" | 26545583 | Luciferase |
| hsa-miR-363-3p | lung squamous cell cancer | differentiation | "miR-363 -10a and -145 were associated with lymph n ......" | 26870288 | |
| hsa-miR-363-3p | ovarian cancer | drug resistance | "Analysis of microarray identified genes and microR ......" | 26261572 | |
| hsa-miR-363-3p | prostate cancer | progression | "MicroRNA 363 mediated positive regulation of c myc ......" | 25591584 | Western blot; Colony formation |
Reported gene related to hsa-miR-363-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-363-3p | bladder cancer | MCL1 | "The lncRNA MALAT1 functions as a competing endogen ......" | 27420766 |
| hsa-miR-363-3p | breast cancer | MCL1 | "MiR 363 sensitizes cisplatin induced apoptosis tar ......" | 25416050 |
| hsa-miR-363-3p | glioblastoma | ANXA5 | "We show that two candidate oncogenic microRNAs miR ......" | 24805821 |
| hsa-miR-363-3p | breast cancer | DCAF6 | "Our analysis demonstrated that miR-363 and its pos ......" | 24222117 |
| hsa-miR-363-3p | gastric cancer | FBXW7 | "miR 363 promotes proliferation and chemo resistanc ......" | 27167197 |
| hsa-miR-363-3p | colorectal cancer | GATA6 | "The miR 363 GATA6 Lgr5 pathway is critical for col ......" | 24452072 |
| hsa-miR-363-3p | acute myeloid leukemia | HIPK3 | "Genes targeted by miR-363 include RGS17 and HIPK3 ......" | 23689423 |
| hsa-miR-363-3p | colorectal cancer | LGR5 | "The miR 363 GATA6 Lgr5 pathway is critical for col ......" | 24452072 |
| hsa-miR-363-3p | bladder cancer | MALAT1 | "The lncRNA MALAT1 functions as a competing endogen ......" | 27420766 |
| hsa-miR-363-3p | prostate cancer | MYC | "MicroRNA 363 mediated positive regulation of c myc ......" | 25591584 |
| hsa-miR-363-3p | head and neck cancer | MYO1B | "Bioinformatic tools and a luciferase reporter assa ......" | 26545583 |
| hsa-miR-363-3p | gastric cancer | NOTCH1 | "The interaction between miR-363-3p and NOTCH1 was ......" | 26709677 |
| hsa-miR-363-3p | head and neck cancer | PDPN | "Dysregulated miR 363 affects head and neck cancer ......" | 23246488 |
| hsa-miR-363-3p | acute myeloid leukemia | RGS17 | "Genes targeted by miR-363 include RGS17 and HIPK3 ......" | 23689423 |
| hsa-miR-363-3p | liver cancer | S1PR1 | "MicroRNA 363 mediated downregulation of S1PR1 supp ......" | 24631531 |
| hsa-miR-363-3p | colorectal cancer | SOX4 | "MiR 363 3p inhibits the epithelial to mesenchymal ......" | 27084453 |
| hsa-miR-363-3p | liver cancer | STAT3 | "Transfection of miR-363 mimics suppressed S1PR1 ex ......" | 24631531 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-363-3p | COL1A2 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.354; TCGA CESC -0.208; TCGA ESCA -0.168; TCGA HNSC -0.359; TCGA KIRC -0.266; TCGA LUAD -0.098; TCGA LUSC -0.351; TCGA PRAD -0.167; TCGA SARC -0.185; TCGA THCA -0.234 |
hsa-miR-363-3p | ITGAV | 10 cancers: BLCA; CESC; HNSC; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.109; TCGA CESC -0.109; TCGA HNSC -0.092; TCGA LGG -0.086; TCGA LUAD -0.087; TCGA LUSC -0.182; TCGA PRAD -0.165; TCGA SARC -0.075; TCGA THCA -0.17; TCGA UCEC -0.121 |
hsa-miR-363-3p | ITM2B | 10 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC | MirTarget | TCGA BLCA -0.141; TCGA CESC -0.124; TCGA HNSC -0.065; TCGA KIRP -0.084; TCGA LIHC -0.06; TCGA LUAD -0.107; TCGA LUSC -0.065; TCGA PAAD -0.057; TCGA PRAD -0.153; TCGA UCEC -0.118 |
hsa-miR-363-3p | DAB2IP | 9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; OV; PRAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.11; TCGA CESC -0.119; TCGA ESCA -0.08; TCGA HNSC -0.05; TCGA LUSC -0.152; TCGA OV -0.074; TCGA PRAD -0.138; TCGA THCA -0.231; TCGA UCEC -0.055 |
hsa-miR-363-3p | GFPT2 | 9 cancers: BLCA; CESC; HNSC; LGG; LUSC; OV; PRAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.376; TCGA CESC -0.491; TCGA HNSC -0.128; TCGA LGG -0.25; TCGA LUSC -0.254; TCGA OV -0.121; TCGA PRAD -0.184; TCGA SARC -0.246; TCGA UCEC -0.175 |
hsa-miR-363-3p | GRIA3 | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUSC; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.265; TCGA BRCA -0.117; TCGA CESC -0.256; TCGA HNSC -0.276; TCGA LGG -0.098; TCGA LUSC -0.166; TCGA PRAD -0.218; TCGA THCA -0.335; TCGA UCEC -0.178 |
hsa-miR-363-3p | RPS6KA4 | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; THCA; STAD | MirTarget | TCGA BLCA -0.12; TCGA CESC -0.072; TCGA ESCA -0.149; TCGA HNSC -0.142; TCGA KIRC -0.102; TCGA LUSC -0.133; TCGA PAAD -0.102; TCGA THCA -0.113; TCGA STAD -0.085 |
hsa-miR-363-3p | NOX4 | 9 cancers: BLCA; CESC; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.178; TCGA CESC -0.196; TCGA HNSC -0.232; TCGA LUAD -0.109; TCGA LUSC -0.246; TCGA PAAD -0.255; TCGA THCA -0.556; TCGA STAD -0.203; TCGA UCEC -0.099 |
hsa-miR-363-3p | EFR3A | 11 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.101; TCGA CESC -0.052; TCGA ESCA -0.086; TCGA HNSC -0.064; TCGA LIHC -0.18; TCGA LUAD -0.067; TCGA LUSC -0.072; TCGA PRAD -0.14; TCGA SARC -0.06; TCGA THCA -0.136; TCGA UCEC -0.074 |
hsa-miR-363-3p | FBN1 | 9 cancers: BLCA; CESC; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.342; TCGA CESC -0.269; TCGA HNSC -0.204; TCGA KIRC -0.115; TCGA LUAD -0.143; TCGA LUSC -0.219; TCGA PRAD -0.282; TCGA SARC -0.127; TCGA UCEC -0.07 |
hsa-miR-363-3p | SPSB1 | 11 cancers: BLCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.151; TCGA CESC -0.124; TCGA HNSC -0.105; TCGA KIRC -0.206; TCGA LGG -0.176; TCGA LUAD -0.085; TCGA LUSC -0.138; TCGA OV -0.057; TCGA PRAD -0.185; TCGA SARC -0.091; TCGA UCEC -0.063 |
hsa-miR-363-3p | ITPRIPL2 | 9 cancers: BLCA; CESC; ESCA; LGG; LUSC; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.095; TCGA CESC -0.066; TCGA ESCA -0.072; TCGA LGG -0.107; TCGA LUSC -0.096; TCGA PAAD -0.107; TCGA PRAD -0.083; TCGA THCA -0.187; TCGA UCEC -0.07 |
hsa-miR-363-3p | C11orf24 | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; THCA | miRNATAP | TCGA BLCA -0.073; TCGA CESC -0.072; TCGA ESCA -0.092; TCGA HNSC -0.118; TCGA KIRC -0.127; TCGA LUAD -0.055; TCGA LUSC -0.067; TCGA SARC -0.082; TCGA THCA -0.108 |
hsa-miR-363-3p | FHL2 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC | miRNATAP | TCGA BLCA -0.123; TCGA BRCA -0.09; TCGA CESC -0.204; TCGA ESCA -0.192; TCGA HNSC -0.198; TCGA KIRP -0.242; TCGA LUAD -0.091; TCGA LUSC -0.302; TCGA PAAD -0.175; TCGA PRAD -0.227; TCGA SARC -0.128 |
hsa-miR-363-3p | TMEM87A | 10 cancers: CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD | MirTarget | TCGA CESC -0.066; TCGA COAD -0.081; TCGA ESCA -0.062; TCGA HNSC -0.083; TCGA KIRC -0.084; TCGA LUAD -0.095; TCGA LUSC -0.063; TCGA PAAD -0.097; TCGA SARC -0.056; TCGA STAD -0.093 |
hsa-miR-363-3p | EDEM1 | 9 cancers: CESC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; UCEC | MirTarget | TCGA CESC -0.099; TCGA KIRC -0.06; TCGA KIRP -0.067; TCGA LIHC -0.058; TCGA LUAD -0.095; TCGA LUSC -0.089; TCGA PRAD -0.053; TCGA THCA -0.207; TCGA UCEC -0.057 |
hsa-miR-363-3p | SERINC3 | 9 cancers: CESC; ESCA; HNSC; LIHC; LUSC; OV; PRAD; SARC; UCEC | mirMAP | TCGA CESC -0.053; TCGA ESCA -0.059; TCGA HNSC -0.105; TCGA LIHC -0.056; TCGA LUSC -0.066; TCGA OV -0.057; TCGA PRAD -0.114; TCGA SARC -0.061; TCGA UCEC -0.055 |
Enriched cancer pathways of putative targets