microRNA information: hsa-miR-367-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-367-3p | miRbase |
| Accession: | MIMAT0000719 | miRbase |
| Precursor name: | hsa-mir-367 | miRbase |
| Precursor accession: | MI0000775 | miRbase |
| Symbol: | MIR367 | HGNC |
| RefSeq ID: | NR_029860 | GenBank |
| Sequence: | AAUUGCACUUUAGCAAUGGUGA |
Reported expression in cancers: hsa-miR-367-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-367-3p | esophageal cancer | deregulation | "MicroRNA 367 is a potential diagnostic biomarker f ......" | 26777997 | qPCR |
| hsa-miR-367-3p | lung squamous cell cancer | deregulation | "Low miR 145 and high miR 367 are associated with u ......" | 22835608 | |
| hsa-miR-367-3p | lung squamous cell cancer | deregulation | "In this study we evaluated the expression profiles ......" | 27533249 |
Reported cancer pathway affected by hsa-miR-367-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-367-3p | esophageal cancer | cell cycle pathway | "MicroRNA 367 is a potential diagnostic biomarker f ......" | 26777997 |
Reported cancer prognosis affected by hsa-miR-367-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-367-3p | esophageal cancer | poor survival; staging; metastasis; differentiation | "MicroRNA 367 is a potential diagnostic biomarker f ......" | 26777997 | |
| hsa-miR-367-3p | gastric cancer | metastasis; staging; differentiation | "The microRNA 367 inhibits the invasion and metasta ......" | 25489984 | Luciferase |
| hsa-miR-367-3p | liver cancer | cell migration | "miR 367 promotes proliferation and invasion of hep ......" | 26772880 | Transwell assay; Western blot; Luciferase |
| hsa-miR-367-3p | liver cancer | metastasis; staging | "The miR 367 3p Increases Sorafenib Chemotherapy Ef ......" | 27688096 | |
| hsa-miR-367-3p | lung squamous cell cancer | worse prognosis | "Low miR 145 and high miR 367 are associated with u ......" | 22835608 |
Reported gene related to hsa-miR-367-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-367-3p | liver cancer | AR | "The miR 367 3p Increases Sorafenib Chemotherapy Ef ......" | 27688096 |
| hsa-miR-367-3p | breast cancer | BPIFA4P | "A thermodynamic model based on base pairing and th ......" | 21810988 |
| hsa-miR-367-3p | liver cancer | EIF2AK3 | "Together these results suggest that miR-367-3p may ......" | 27688096 |
| hsa-miR-367-3p | liver cancer | PTEN | "miR 367 promotes proliferation and invasion of hep ......" | 26772880 |
| hsa-miR-367-3p | gastric cancer | RAB23 | "The microRNA 367 inhibits the invasion and metasta ......" | 25489984 |
| hsa-miR-367-3p | breast cancer | RYR3 | "Functional SNP in the microRNA 367 binding site in ......" | 21810988 |
| hsa-miR-367-3p | lung squamous cell cancer | TTR | "Mean TTR was 29.1 months for patients with low miR ......" | 22835608 |