microRNA information: hsa-miR-370-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-370-3p | miRbase |
| Accession: | MIMAT0000722 | miRbase |
| Precursor name: | hsa-mir-370 | miRbase |
| Precursor accession: | MI0000778 | miRbase |
| Symbol: | MIR370 | HGNC |
| RefSeq ID: | NR_029863 | GenBank |
| Sequence: | GCCUGCUGGGGUGGAACCUGGU |
Reported expression in cancers: hsa-miR-370-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-370-3p | acute myeloid leukemia | downregulation | "We found that the down-regulation of miR-370 expre ......" | 22900969 | |
| hsa-miR-370-3p | bladder cancer | downregulation | "We investigated the miRNA expression signature of ......" | 21304530 | |
| hsa-miR-370-3p | breast cancer | upregulation | "Expression of microRNA 370 in human breast cancer ......" | 27563639 | qPCR |
| hsa-miR-370-3p | gastric cancer | downregulation | "Compared with the expression levels in the normal ......" | 25013480 | |
| hsa-miR-370-3p | gastric cancer | downregulation | "Real-time quantitative PCR RTQ-PCR was employed to ......" | 25270964 | qPCR |
| hsa-miR-370-3p | lung squamous cell cancer | downregulation | "The present study aimed to investigate the role an ......" | 25976502 |
Reported cancer pathway affected by hsa-miR-370-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-370-3p | acute myeloid leukemia | cell cycle pathway | "The expression levels of miR-370 and FoxM1 were as ......" | 22900969 | Western blot; Colony formation; RNAi |
| hsa-miR-370-3p | chronic myeloid leukemia | Apoptosis pathway | "MiR 370 sensitizes chronic myeloid leukemia K562 c ......" | 24148180 | Flow cytometry; Western blot |
| hsa-miR-370-3p | gastric cancer | Apoptosis pathway | "Upregulation of microRNA 370 promotes cell apoptos ......" | 27499479 | |
| hsa-miR-370-3p | liver cancer | PI3K/Akt signaling pathway | "MiR 370 promotes cell death of liver cancer cells ......" | 27249599 | MTT assay; Colony formation; Western blot |
| hsa-miR-370-3p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 370 inhibits the progression of non small ......" | 25976502 | Luciferase |
| hsa-miR-370-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "MicroRNA 370 directly targets FOXM1 to inhibit cel ......" | 26617733 | Luciferase |
Reported cancer prognosis affected by hsa-miR-370-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-370-3p | acute myeloid leukemia | progression | "The expression levels of miR-370 and FoxM1 were as ......" | 22900969 | Western blot; Colony formation; RNAi |
| hsa-miR-370-3p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
| hsa-miR-370-3p | breast cancer | progression; worse prognosis; staging; metastasis; poor survival | "High MicroRNA 370 Expression Correlates with Tumor ......" | 26770238 | |
| hsa-miR-370-3p | breast cancer | malignant trasformation; staging; tumor size | "Expression of microRNA 370 in human breast cancer ......" | 27563639 | |
| hsa-miR-370-3p | colorectal cancer | drug resistance | "We identified a miRNA profile that was analysed by ......" | 25197016 | |
| hsa-miR-370-3p | gastric cancer | progression; staging; metastasis; cell migration | "Overexpression of miR 370 and downregulation of it ......" | 21666718 | |
| hsa-miR-370-3p | gastric cancer | progression | "Upregulation of miR 370 contributes to the progres ......" | 23721824 | |
| hsa-miR-370-3p | gastric cancer | metastasis | "Real-time quantitative PCR RTQ-PCR was employed to ......" | 25270964 | |
| hsa-miR-370-3p | liver cancer | malignant trasformation; metastasis; poor survival; progression | "MicroRNA 370 miR-370 is located within the DLK1/DI ......" | 23728999 | |
| hsa-miR-370-3p | liver cancer | progression | "MiR 370 promotes cell death of liver cancer cells ......" | 27249599 | MTT assay; Colony formation; Western blot |
| hsa-miR-370-3p | lung cancer | cell migration; poor survival | "An independent cohort of 60 lung ACs was used for ......" | 24833665 | |
| hsa-miR-370-3p | lung squamous cell cancer | progression | "MicroRNA 370 inhibits the progression of non small ......" | 25976502 | Luciferase |
| hsa-miR-370-3p | ovarian cancer | staging | "We measured the expression of nine miRNAs miR-181d ......" | 22925189 | |
| hsa-miR-370-3p | sarcoma | metastasis | "MicroRNA 370 directly targets FOXM1 to inhibit cel ......" | 26617733 | Luciferase |
Reported gene related to hsa-miR-370-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-370-3p | acute myeloid leukemia | FOXM1 | "The expression levels of miR-370 and FoxM1 were as ......" | 22900969 |
| hsa-miR-370-3p | chronic myeloid leukemia | FOXM1 | "MiR 370 sensitizes chronic myeloid leukemia K562 c ......" | 24148180 |
| hsa-miR-370-3p | sarcoma | FOXM1 | "MicroRNA 370 directly targets FOXM1 to inhibit cel ......" | 26617733 |
| hsa-miR-370-3p | chronic myeloid leukemia | ACVRL1 | "We examined the synergistic action between miR-370 ......" | 24148180 |
| hsa-miR-370-3p | ovarian cancer | ENG | "MicroRNA 370 suppresses proliferation and promotes ......" | 25063739 |
| hsa-miR-370-3p | gastric cancer | FOXO1 | "Upregulation of miR 370 contributes to the progres ......" | 23721824 |
| hsa-miR-370-3p | liver cancer | FOXO3 | "Furthermore Western blotting analysis results demo ......" | 27249599 |
| hsa-miR-370-3p | liver cancer | IL6 | "These data demonstrate the involvement of a novel ......" | 23728999 |
| hsa-miR-370-3p | liver cancer | LIN28A | "Moreover the RNA-binding protein LIN28A was identi ......" | 23728999 |
| hsa-miR-370-3p | acute myeloid leukemia | MTOR | "Since NF1 deficiency leads to RAS activation patie ......" | 23077663 |
| hsa-miR-370-3p | acute myeloid leukemia | NF1 | "Integration of SNP and mRNA arrays with microRNA p ......" | 23077663 |
| hsa-miR-370-3p | gastric cancer | PTEN | "Upregulation of microRNA 370 promotes cell apoptos ......" | 27499479 |
| hsa-miR-370-3p | gastric cancer | SMAD3 | "The exogenous miR-370 expression decreased TGFβ-R ......" | 21666718 |
| hsa-miR-370-3p | lung squamous cell cancer | TNF | "Through bioinformatic analysis we found that tumor ......" | 25976502 |
| hsa-miR-370-3p | lung squamous cell cancer | TRAF4 | "MicroRNA 370 inhibits the progression of non small ......" | 25976502 |
| hsa-miR-370-3p | prostate cancer | VAMP8 | "Further using miRNA mimics and reporter gene assay ......" | 25691096 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-370-3p | SLC48A1 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; STAD | MirTarget | TCGA BLCA -0.12; TCGA BRCA -0.053; TCGA CESC -0.055; TCGA COAD -0.076; TCGA HNSC -0.057; TCGA LIHC -0.093; TCGA LUAD -0.057; TCGA LUSC -0.057; TCGA OV -0.062; TCGA STAD -0.099 |
Enriched cancer pathways of putative targets