microRNA information: hsa-miR-374a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-374a-5p | miRbase |
| Accession: | MIMAT0000727 | miRbase |
| Precursor name: | hsa-mir-374a | miRbase |
| Precursor accession: | MI0000782 | miRbase |
| Symbol: | MIR374A | HGNC |
| RefSeq ID: | NR_030785 | GenBank |
| Sequence: | UUAUAAUACAACCUGAUAAGUG |
Reported expression in cancers: hsa-miR-374a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-374a-5p | bladder cancer | deregulation | "By using high-throughput sequencing technologies w ......" | 23939156 | RNA-Seq |
| hsa-miR-374a-5p | breast cancer | upregulation | "MicroRNA 374a activates Wnt/β catenin signaling t ......" | 23321667 | |
| hsa-miR-374a-5p | gastric cancer | upregulation | "In this study we found that miR-374a expression wa ......" | 25554419 | |
| hsa-miR-374a-5p | lung cancer | downregulation | "Aberrant expression of miR-374a has been reported ......" | 27207663 | |
| hsa-miR-374a-5p | lung squamous cell cancer | downregulation | "Identification of miR 374a as a prognostic marker ......" | 21748820 | Microarray |
| hsa-miR-374a-5p | sarcoma | upregulation | "Furthermore the upregulated miRNAs included miR-9/ ......" | 23133552 | |
| hsa-miR-374a-5p | sarcoma | upregulation | "In the present study we reported that the expressi ......" | 26064239 | |
| hsa-miR-374a-5p | sarcoma | upregulation | "MicroRNA-374a miR-374a has been implicated in seve ......" | 26617789 | qPCR |
Reported cancer pathway affected by hsa-miR-374a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-374a-5p | colon cancer | PI3K/Akt signaling pathway; cell cycle pathway; Epithelial mesenchymal transition pathway | "microRNA 374a suppresses colon cancer progression ......" | 27191497 | Luciferase |
| hsa-miR-374a-5p | lung cancer | cell cycle pathway; Apoptosis pathway | "In this study we validate and report that miR-374a ......" | 24832599 |
Reported cancer prognosis affected by hsa-miR-374a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-374a-5p | breast cancer | metastasis; poor survival | "MicroRNA 374a activates Wnt/β catenin signaling t ......" | 23321667 | |
| hsa-miR-374a-5p | breast cancer | worse prognosis; progression | "Effects of differential distribution of microvesse ......" | 23679262 | Western blot |
| hsa-miR-374a-5p | colon cancer | progression; metastasis | "microRNA 374a suppresses colon cancer progression ......" | 27191497 | Luciferase |
| hsa-miR-374a-5p | colorectal cancer | progression | "Furthermore we found that miR-34a miR-34c miR-369- ......" | 26062441 | |
| hsa-miR-374a-5p | esophageal cancer | progression; worse prognosis | "MicroRNA 374a promotes esophageal cancer cell prol ......" | 26252180 | |
| hsa-miR-374a-5p | gastric cancer | malignant trasformation | "miR 374a promotes cell proliferation migration and ......" | 25554419 | |
| hsa-miR-374a-5p | lung cancer | tumorigenesis; poor survival | "In this study we validate and report that miR-374a ......" | 24832599 | |
| hsa-miR-374a-5p | lung squamous cell cancer | staging; poor survival; progression | "Identification of miR 374a as a prognostic marker ......" | 21748820 | |
| hsa-miR-374a-5p | ovarian cancer | drug resistance | "MiR 130a and MiR 374a Function as Novel Regulators ......" | 26043084 | Western blot |
Reported gene related to hsa-miR-374a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-374a-5p | esophageal cancer | AXIN2 | "MicroRNA 374a promotes esophageal cancer cell prol ......" | 26252180 |
| hsa-miR-374a-5p | sarcoma | AXIN2 | "MiR 374a promotes the proliferation of osteosarcom ......" | 26617789 |
| hsa-miR-374a-5p | lung cancer | AXL | "Of clinical significance high expression of Axl an ......" | 24832599 |
| hsa-miR-374a-5p | colon cancer | CCND1 | "microRNA 374a suppresses colon cancer progression ......" | 27191497 |
| hsa-miR-374a-5p | sarcoma | FOXO1 | "MiR 374a promotes the proliferation of human osteo ......" | 26064239 |
| hsa-miR-374a-5p | colorectal cancer | LDHA | "More importantly we identified a genetic loci newl ......" | 26062441 |
| hsa-miR-374a-5p | gastric cancer | SRCIN1 | "miR 374a promotes cell proliferation migration and ......" | 25554419 |
| hsa-miR-374a-5p | lung cancer | TGFA | "MiR 374a suppresses lung adenocarcinoma cell proli ......" | 27207663 |
| hsa-miR-374a-5p | breast cancer | VCAM1 | "Our data demonstrated miR-374a to be differentiall ......" | 23679262 |
| hsa-miR-374a-5p | breast cancer | VEGFA | "Our data demonstrated miR-374a to be differentiall ......" | 23679262 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-374a-5p | CDC42BPB | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.096; TCGA BRCA -0.148; TCGA CESC -0.155; TCGA ESCA -0.184; TCGA HNSC -0.184; TCGA KIRC -0.235; TCGA KIRP -0.246; TCGA LGG -0.051; TCGA LUAD -0.118; TCGA LUSC -0.25; TCGA SARC -0.086; TCGA THCA -0.106; TCGA STAD -0.18; TCGA UCEC -0.078 |
hsa-miR-374a-5p | MEF2D | 9 cancers: BLCA; BRCA; CESC; COAD; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.159; TCGA BRCA -0.185; TCGA CESC -0.134; TCGA COAD -0.232; TCGA LUAD -0.114; TCGA LUSC -0.106; TCGA SARC -0.2; TCGA STAD -0.167; TCGA UCEC -0.115 |
hsa-miR-374a-5p | ITGA2 | 9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; UCEC | MirTarget | TCGA BLCA -0.216; TCGA BRCA -0.316; TCGA HNSC -0.202; TCGA KIRC -0.421; TCGA KIRP -0.514; TCGA LUSC -0.712; TCGA PAAD -0.483; TCGA THCA -1.128; TCGA UCEC -0.452 |
hsa-miR-374a-5p | PTPN14 | 12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.153; TCGA COAD -0.491; TCGA HNSC -0.175; TCGA KIRC -0.327; TCGA KIRP -0.429; TCGA LIHC -0.225; TCGA LUAD -0.129; TCGA LUSC -0.27; TCGA PAAD -0.519; TCGA SARC -0.407; TCGA STAD -0.273; TCGA UCEC -0.169 |
hsa-miR-374a-5p | MMP14 | 9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA | MirTarget | TCGA BLCA -0.179; TCGA COAD -0.399; TCGA ESCA -0.324; TCGA HNSC -0.311; TCGA LIHC -0.241; TCGA LUAD -0.185; TCGA LUSC -0.743; TCGA PAAD -0.31; TCGA THCA -0.339 |
hsa-miR-374a-5p | RGS4 | 9 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; THCA; STAD | MirTarget | TCGA BLCA -0.301; TCGA BRCA -0.171; TCGA COAD -0.653; TCGA HNSC -0.302; TCGA LIHC -0.828; TCGA LUAD -0.282; TCGA LUSC -0.62; TCGA THCA -0.485; TCGA STAD -0.68 |
hsa-miR-374a-5p | ACTN1 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.474; TCGA CESC -0.165; TCGA COAD -0.293; TCGA ESCA -0.325; TCGA HNSC -0.39; TCGA LUAD -0.102; TCGA LUSC -0.687; TCGA PAAD -0.133; TCGA SARC -0.454; TCGA THCA -0.463; TCGA STAD -0.622 |
hsa-miR-374a-5p | LDHA | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA | MirTarget | TCGA BLCA -0.287; TCGA BRCA -0.159; TCGA CESC -0.259; TCGA ESCA -0.223; TCGA HNSC -0.387; TCGA KIRP -0.133; TCGA LUAD -0.1; TCGA LUSC -0.386; TCGA PAAD -0.378; TCGA PRAD -0.145; TCGA THCA -0.285 |
hsa-miR-374a-5p | TRPS1 | 9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUSC; PAAD; STAD; UCEC | MirTarget; mirMAP | TCGA BLCA -0.261; TCGA BRCA -0.427; TCGA COAD -0.741; TCGA KIRC -0.144; TCGA KIRP -0.237; TCGA LUSC -0.35; TCGA PAAD -0.239; TCGA STAD -0.383; TCGA UCEC -0.24 |
hsa-miR-374a-5p | SEMA3C | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; STAD | MirTarget; mirMAP | TCGA BLCA -0.303; TCGA BRCA -0.276; TCGA CESC -0.487; TCGA HNSC -0.602; TCGA KIRC -0.563; TCGA KIRP -0.603; TCGA LIHC -0.761; TCGA LUSC -0.441; TCGA PAAD -0.525; TCGA STAD -0.558 |
hsa-miR-374a-5p | BHLHE40 | 9 cancers: BLCA; BRCA; CESC; COAD; LUSC; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.403; TCGA BRCA -0.376; TCGA CESC -0.276; TCGA COAD -0.191; TCGA LUSC -0.26; TCGA PAAD -0.346; TCGA PRAD -0.218; TCGA THCA -0.797; TCGA STAD -0.227 |
hsa-miR-374a-5p | ASPN | 11 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.732; TCGA BRCA -0.53; TCGA COAD -0.696; TCGA HNSC -0.361; TCGA LIHC -0.546; TCGA LUAD -0.235; TCGA LUSC -0.914; TCGA PAAD -0.396; TCGA SARC -0.427; TCGA THCA -0.28; TCGA STAD -0.447 |
hsa-miR-374a-5p | TJP1 | 9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; PAAD; SARC; THCA; STAD | MirTarget; mirMAP | TCGA BLCA -0.096; TCGA BRCA -0.082; TCGA COAD -0.171; TCGA KIRC -0.126; TCGA KIRP -0.21; TCGA PAAD -0.179; TCGA SARC -0.205; TCGA THCA -0.102; TCGA STAD -0.379 |
hsa-miR-374a-5p | MAP4 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.163; TCGA BRCA -0.067; TCGA CESC -0.155; TCGA COAD -0.135; TCGA ESCA -0.257; TCGA HNSC -0.148; TCGA KIRC -0.098; TCGA LUAD -0.065; TCGA LUSC -0.187; TCGA PAAD -0.136; TCGA SARC -0.133; TCGA THCA -0.25; TCGA STAD -0.25 |
hsa-miR-374a-5p | NCKAP1 | 10 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.117; TCGA BRCA -0.11; TCGA CESC -0.115; TCGA KIRC -0.133; TCGA LUAD -0.089; TCGA LUSC -0.224; TCGA PAAD -0.198; TCGA SARC -0.266; TCGA THCA -0.202; TCGA STAD -0.288 |
hsa-miR-374a-5p | CYFIP1 | 10 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.128; TCGA BRCA -0.067; TCGA ESCA -0.174; TCGA LIHC -0.083; TCGA LUAD -0.063; TCGA LUSC -0.117; TCGA PAAD -0.143; TCGA PRAD -0.055; TCGA THCA -0.148; TCGA STAD -0.104 |
hsa-miR-374a-5p | FBXW11 | 10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; LUSC; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.135; TCGA BRCA -0.176; TCGA COAD -0.12; TCGA KIRC -0.14; TCGA LIHC -0.092; TCGA LUAD -0.072; TCGA LUSC -0.125; TCGA SARC -0.083; TCGA THCA -0.108; TCGA STAD -0.167 |
hsa-miR-374a-5p | RASAL2 | 9 cancers: BLCA; CESC; ESCA; KIRP; LUSC; PAAD; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.153; TCGA CESC -0.181; TCGA ESCA -0.189; TCGA KIRP -0.195; TCGA LUSC -0.194; TCGA PAAD -0.193; TCGA SARC -0.178; TCGA THCA -0.357; TCGA UCEC -0.171 |
hsa-miR-374a-5p | SEC23A | 9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.276; TCGA ESCA -0.157; TCGA HNSC -0.194; TCGA LUAD -0.12; TCGA LUSC -0.315; TCGA PAAD -0.157; TCGA SARC -0.175; TCGA THCA -0.265; TCGA STAD -0.291 |
hsa-miR-374a-5p | RAB2A | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD | mirMAP | TCGA BLCA -0.087; TCGA BRCA -0.113; TCGA CESC -0.107; TCGA ESCA -0.107; TCGA HNSC -0.136; TCGA LGG -0.103; TCGA LUAD -0.099; TCGA LUSC -0.187; TCGA PAAD -0.12 |
hsa-miR-374a-5p | INPP4B | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD | mirMAP | TCGA BLCA -0.403; TCGA BRCA -0.457; TCGA CESC -0.51; TCGA ESCA -0.571; TCGA HNSC -0.572; TCGA LUAD -0.226; TCGA LUSC -0.779; TCGA PAAD -0.448; TCGA STAD -0.39 |
hsa-miR-374a-5p | PPFIBP1 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; STAD | mirMAP | TCGA BLCA -0.174; TCGA BRCA -0.106; TCGA CESC -0.168; TCGA COAD -0.384; TCGA ESCA -0.2; TCGA HNSC -0.22; TCGA KIRP -0.146; TCGA LIHC -0.21; TCGA LUSC -0.268; TCGA PAAD -0.223; TCGA STAD -0.215 |
hsa-miR-374a-5p | ASCC3 | 10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; SARC; THCA | mirMAP | TCGA BLCA -0.144; TCGA BRCA -0.09; TCGA ESCA -0.146; TCGA HNSC -0.199; TCGA LGG -0.104; TCGA LIHC -0.197; TCGA LUAD -0.106; TCGA LUSC -0.247; TCGA SARC -0.153; TCGA THCA -0.395 |
hsa-miR-374a-5p | LNPEP | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.144; TCGA BRCA -0.339; TCGA COAD -0.224; TCGA ESCA -0.226; TCGA KIRC -0.366; TCGA KIRP -0.276; TCGA LUAD -0.165; TCGA LUSC -0.223; TCGA SARC -0.318; TCGA STAD -0.281 |
hsa-miR-374a-5p | FHL2 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.257; TCGA BRCA -0.258; TCGA CESC -0.43; TCGA ESCA -0.364; TCGA HNSC -0.296; TCGA KIRP -0.226; TCGA LIHC -0.297; TCGA LUAD -0.295; TCGA LUSC -1.061; TCGA PAAD -0.289; TCGA SARC -0.292; TCGA STAD -0.36 |
hsa-miR-374a-5p | VAMP4 | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.095; TCGA BRCA -0.153; TCGA HNSC -0.095; TCGA KIRC -0.098; TCGA KIRP -0.104; TCGA LGG -0.18; TCGA SARC -0.131; TCGA THCA -0.161; TCGA STAD -0.266; TCGA UCEC -0.095 |
hsa-miR-374a-5p | INHBA | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.427; TCGA BRCA -0.501; TCGA CESC -0.531; TCGA COAD -0.699; TCGA HNSC -1.108; TCGA LUAD -0.348; TCGA LUSC -0.997; TCGA PAAD -0.711; TCGA SARC -0.489; TCGA THCA -0.375; TCGA UCEC -0.275 |
hsa-miR-374a-5p | PTPN12 | 9 cancers: BLCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.097; TCGA HNSC -0.24; TCGA KIRP -0.134; TCGA LUAD -0.06; TCGA LUSC -0.137; TCGA PAAD -0.172; TCGA PRAD -0.083; TCGA THCA -0.172; TCGA STAD -0.242 |
hsa-miR-374a-5p | CALU | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.15; TCGA BRCA -0.11; TCGA COAD -0.285; TCGA HNSC -0.229; TCGA LUAD -0.242; TCGA LUSC -0.286; TCGA PAAD -0.371; TCGA THCA -0.23; TCGA STAD -0.238 |
hsa-miR-374a-5p | PRKAB2 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.178; TCGA BRCA -0.086; TCGA CESC -0.128; TCGA COAD -0.157; TCGA HNSC -0.186; TCGA KIRC -0.328; TCGA KIRP -0.09; TCGA LGG -0.062; TCGA LUAD -0.122; TCGA LUSC -0.331; TCGA PAAD -0.2; TCGA SARC -0.335; TCGA STAD -0.35 |
hsa-miR-374a-5p | CDC73 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.146; TCGA BRCA -0.151; TCGA COAD -0.11; TCGA HNSC -0.096; TCGA KIRP -0.101; TCGA LUAD -0.077; TCGA LUSC -0.119; TCGA PAAD -0.171; TCGA SARC -0.194; TCGA STAD -0.141 |
hsa-miR-374a-5p | NT5E | 11 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; THCA; UCEC | mirMAP | TCGA BLCA -0.555; TCGA CESC -0.463; TCGA COAD -0.326; TCGA HNSC -0.467; TCGA KIRP -0.308; TCGA LGG -0.186; TCGA LUAD -0.244; TCGA LUSC -0.869; TCGA PAAD -0.397; TCGA THCA -0.471; TCGA UCEC -0.288 |
hsa-miR-374a-5p | LAMC1 | 11 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.128; TCGA COAD -0.324; TCGA HNSC -0.185; TCGA KIRP -0.236; TCGA LUAD -0.108; TCGA LUSC -0.245; TCGA PAAD -0.272; TCGA PRAD -0.16; TCGA THCA -0.263; TCGA STAD -0.253; TCGA UCEC -0.185 |
hsa-miR-374a-5p | ITGAV | 10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.235; TCGA BRCA -0.197; TCGA COAD -0.308; TCGA HNSC -0.26; TCGA LIHC -0.174; TCGA LUSC -0.454; TCGA PAAD -0.235; TCGA SARC -0.187; TCGA THCA -0.265; TCGA STAD -0.273 |
hsa-miR-374a-5p | FRMD6 | 9 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.364; TCGA BRCA -0.142; TCGA COAD -0.612; TCGA HNSC -0.227; TCGA LIHC -0.217; TCGA LUSC -0.613; TCGA PAAD -0.398; TCGA SARC -0.358; TCGA STAD -0.49 |
hsa-miR-374a-5p | IGF1R | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.234; TCGA BRCA -0.463; TCGA HNSC -0.17; TCGA KIRC -0.172; TCGA KIRP -0.162; TCGA LGG -0.105; TCGA LIHC -0.39; TCGA LUSC -0.225; TCGA SARC -0.293; TCGA STAD -0.25 |
hsa-miR-374a-5p | IQGAP1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA | mirMAP | TCGA BLCA -0.211; TCGA BRCA -0.112; TCGA CESC -0.115; TCGA COAD -0.115; TCGA ESCA -0.22; TCGA KIRP -0.139; TCGA LIHC -0.257; TCGA LUAD -0.088; TCGA LUSC -0.162; TCGA PAAD -0.24; TCGA SARC -0.198; TCGA THCA -0.308 |
hsa-miR-374a-5p | SETD7 | 9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.201; TCGA BRCA -0.157; TCGA COAD -0.177; TCGA ESCA -0.184; TCGA LUAD -0.154; TCGA LUSC -0.189; TCGA PAAD -0.137; TCGA THCA -0.339; TCGA STAD -0.424 |
hsa-miR-374a-5p | OSMR | 11 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.488; TCGA CESC -0.265; TCGA COAD -0.651; TCGA HNSC -0.298; TCGA KIRP -0.303; TCGA LUAD -0.248; TCGA LUSC -0.515; TCGA PAAD -0.361; TCGA SARC -0.246; TCGA THCA -0.403; TCGA UCEC -0.288 |
hsa-miR-374a-5p | TPBG | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.357; TCGA BRCA -0.265; TCGA CESC -0.2; TCGA COAD -0.555; TCGA ESCA -0.456; TCGA HNSC -0.415; TCGA KIRP -0.373; TCGA LIHC -0.513; TCGA LUAD -0.174; TCGA LUSC -0.667; TCGA PAAD -0.332; TCGA THCA -0.149; TCGA STAD -0.312 |
hsa-miR-374a-5p | FER | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.288; TCGA BRCA -0.15; TCGA COAD -0.192; TCGA ESCA -0.293; TCGA HNSC -0.286; TCGA KIRC -0.227; TCGA KIRP -0.242; TCGA LUSC -0.191; TCGA PAAD -0.32; TCGA SARC -0.125; TCGA STAD -0.413 |
hsa-miR-374a-5p | EDNRA | 10 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.477; TCGA BRCA -0.211; TCGA HNSC -0.309; TCGA LIHC -0.391; TCGA LUAD -0.137; TCGA LUSC -0.482; TCGA PAAD -0.27; TCGA SARC -0.497; TCGA THCA -0.397; TCGA STAD -0.381 |
hsa-miR-374a-5p | ENAH | 11 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.163; TCGA BRCA -0.105; TCGA COAD -0.208; TCGA HNSC -0.367; TCGA LIHC -0.191; TCGA LUAD -0.136; TCGA LUSC -0.438; TCGA PAAD -0.208; TCGA SARC -0.281; TCGA THCA -0.322; TCGA STAD -0.282 |
hsa-miR-374a-5p | FBXO32 | 9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.413; TCGA COAD -0.437; TCGA ESCA -0.289; TCGA LUAD -0.183; TCGA LUSC -0.74; TCGA SARC -0.618; TCGA THCA -0.729; TCGA STAD -0.96; TCGA UCEC -0.201 |
hsa-miR-374a-5p | SLMAP | 11 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.366; TCGA BRCA -0.2; TCGA CESC -0.18; TCGA COAD -0.196; TCGA KIRC -0.265; TCGA KIRP -0.117; TCGA LUAD -0.07; TCGA LUSC -0.139; TCGA PAAD -0.2; TCGA SARC -0.702; TCGA STAD -0.653 |
hsa-miR-374a-5p | SGMS2 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.389; TCGA CESC -0.37; TCGA COAD -0.497; TCGA ESCA -0.26; TCGA HNSC -0.165; TCGA KIRP -0.336; TCGA PAAD -0.453; TCGA SARC -0.314; TCGA THCA -0.279; TCGA STAD -0.423; TCGA UCEC -0.17 |
hsa-miR-374a-5p | GPX8 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.239; TCGA BRCA -0.128; TCGA CESC -0.224; TCGA COAD -0.655; TCGA HNSC -0.292; TCGA LIHC -0.394; TCGA LUAD -0.136; TCGA LUSC -0.495; TCGA PAAD -0.315; TCGA THCA -0.112; TCGA STAD -0.27 |
hsa-miR-374a-5p | SLFN5 | 9 cancers: BLCA; COAD; HNSC; KIRP; LIHC; LUSC; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.242; TCGA COAD -0.596; TCGA HNSC -0.179; TCGA KIRP -0.222; TCGA LIHC -0.241; TCGA LUSC -0.349; TCGA SARC -0.148; TCGA THCA -0.319; TCGA UCEC -0.222 |
hsa-miR-374a-5p | PCDH7 | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUSC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.492; TCGA BRCA -0.192; TCGA COAD -0.78; TCGA HNSC -0.517; TCGA LGG -0.148; TCGA LIHC -0.804; TCGA LUSC -0.859; TCGA SARC -0.723; TCGA STAD -0.635; TCGA UCEC -0.353 |
hsa-miR-374a-5p | TMED10 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD | mirMAP | TCGA BLCA -0.081; TCGA BRCA -0.172; TCGA COAD -0.122; TCGA ESCA -0.175; TCGA HNSC -0.123; TCGA KIRC -0.098; TCGA KIRP -0.112; TCGA LUSC -0.273; TCGA PAAD -0.148; TCGA STAD -0.099 |
hsa-miR-374a-5p | GNG12 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.213; TCGA BRCA -0.224; TCGA ESCA -0.163; TCGA HNSC -0.143; TCGA LUSC -0.352; TCGA PAAD -0.2; TCGA SARC -0.198; TCGA THCA -0.071; TCGA STAD -0.213 |
hsa-miR-374a-5p | ZMAT3 | 10 cancers: BLCA; BRCA; COAD; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.187; TCGA BRCA -0.106; TCGA COAD -0.446; TCGA LGG -0.211; TCGA LUAD -0.132; TCGA LUSC -0.291; TCGA SARC -0.212; TCGA THCA -0.7; TCGA STAD -0.204; TCGA UCEC -0.187 |
hsa-miR-374a-5p | PAWR | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.154; TCGA BRCA -0.173; TCGA HNSC -0.206; TCGA KIRC -0.296; TCGA KIRP -0.275; TCGA LUSC -0.158; TCGA PAAD -0.235; TCGA PRAD -0.087; TCGA SARC -0.573; TCGA THCA -0.128 |
hsa-miR-374a-5p | ARSJ | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.425; TCGA COAD -0.69; TCGA ESCA -0.341; TCGA HNSC -0.466; TCGA KIRC -0.196; TCGA KIRP -0.421; TCGA LIHC -0.395; TCGA LUSC -0.263; TCGA PAAD -0.404; TCGA THCA -0.489; TCGA STAD -0.414 |
hsa-miR-374a-5p | IPO7 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.169; TCGA BRCA -0.156; TCGA CESC -0.164; TCGA HNSC -0.102; TCGA KIRC -0.143; TCGA KIRP -0.128; TCGA LGG -0.117; TCGA LUAD -0.107; TCGA LUSC -0.141; TCGA PAAD -0.202; TCGA SARC -0.102; TCGA THCA -0.184; TCGA STAD -0.17 |
hsa-miR-374a-5p | FMN1 | 9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUSC; PAAD; SARC; UCEC | mirMAP | TCGA BLCA -0.388; TCGA BRCA -0.619; TCGA CESC -0.429; TCGA KIRC -0.85; TCGA KIRP -0.631; TCGA LUSC -0.386; TCGA PAAD -0.538; TCGA SARC -0.514; TCGA UCEC -0.258 |
hsa-miR-374a-5p | MAP4K3 | 9 cancers: BRCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD | MirTarget; mirMAP | TCGA BRCA -0.148; TCGA KIRC -0.373; TCGA KIRP -0.136; TCGA LGG -0.053; TCGA LUAD -0.095; TCGA PAAD -0.126; TCGA PRAD -0.091; TCGA SARC -0.101; TCGA STAD -0.239 |
hsa-miR-374a-5p | UBE2H | 10 cancers: BRCA; COAD; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.211; TCGA COAD -0.096; TCGA KIRC -0.159; TCGA KIRP -0.156; TCGA LUAD -0.149; TCGA PAAD -0.178; TCGA PRAD -0.069; TCGA SARC -0.126; TCGA THCA -0.123; TCGA STAD -0.252 |
hsa-miR-374a-5p | DENND1B | 9 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD | MirTarget; mirMAP | TCGA BRCA -0.352; TCGA COAD -0.189; TCGA HNSC -0.166; TCGA KIRC -0.425; TCGA KIRP -0.261; TCGA LGG -0.123; TCGA LUAD -0.165; TCGA LUSC -0.286; TCGA PAAD -0.298 |
hsa-miR-374a-5p | LONRF2 | 10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.538; TCGA COAD -1.463; TCGA KIRC -1.425; TCGA KIRP -0.395; TCGA LGG -0.112; TCGA LIHC -0.486; TCGA PRAD -0.092; TCGA SARC -1.104; TCGA THCA -0.514; TCGA STAD -1.036 |
hsa-miR-374a-5p | NDUFS1 | 9 cancers: BRCA; KIRC; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.133; TCGA KIRC -0.438; TCGA LGG -0.054; TCGA LUAD -0.078; TCGA LUSC -0.151; TCGA PAAD -0.169; TCGA SARC -0.134; TCGA THCA -0.125; TCGA STAD -0.141 |
hsa-miR-374a-5p | KPNA6 | 9 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LUSC; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.08; TCGA COAD -0.101; TCGA HNSC -0.07; TCGA KIRC -0.076; TCGA KIRP -0.072; TCGA LUSC -0.095; TCGA SARC -0.073; TCGA THCA -0.116; TCGA STAD -0.119 |
hsa-miR-374a-5p | COL11A1 | 9 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA | mirMAP | TCGA BRCA -1.07; TCGA COAD -0.913; TCGA HNSC -1.348; TCGA LIHC -0.844; TCGA LUAD -0.886; TCGA LUSC -2.393; TCGA PAAD -0.964; TCGA PRAD -0.36; TCGA THCA -1.855 |
hsa-miR-374a-5p | SNX13 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BRCA -0.133; TCGA ESCA -0.144; TCGA KIRC -0.224; TCGA KIRP -0.149; TCGA LGG -0.074; TCGA LUAD -0.082; TCGA LUSC -0.154; TCGA SARC -0.134; TCGA STAD -0.166 |
hsa-miR-374a-5p | GSK3B | 10 cancers: BRCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.162; TCGA HNSC -0.148; TCGA KIRP -0.088; TCGA LGG -0.089; TCGA LUSC -0.187; TCGA PAAD -0.108; TCGA PRAD -0.092; TCGA SARC -0.111; TCGA THCA -0.193; TCGA STAD -0.104 |
hsa-miR-374a-5p | TMEM106B | 10 cancers: BRCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.179; TCGA KIRC -0.231; TCGA KIRP -0.15; TCGA LGG -0.071; TCGA LUAD -0.104; TCGA LUSC -0.155; TCGA PAAD -0.139; TCGA SARC -0.162; TCGA THCA -0.194; TCGA STAD -0.234 |
hsa-miR-374a-5p | VDR | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; UCEC | mirMAP | TCGA BRCA -0.085; TCGA CESC -0.246; TCGA ESCA -0.393; TCGA HNSC -0.375; TCGA KIRC -0.397; TCGA LIHC -0.25; TCGA LUAD -0.166; TCGA LUSC -0.678; TCGA THCA -0.367; TCGA UCEC -0.205 |
hsa-miR-374a-5p | PLS1 | 9 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA | mirMAP | TCGA BRCA -0.399; TCGA KIRC -0.287; TCGA KIRP -0.199; TCGA LGG -0.165; TCGA LIHC -0.182; TCGA LUAD -0.11; TCGA PAAD -0.452; TCGA PRAD -0.146; TCGA THCA -0.193 |
hsa-miR-374a-5p | RNF2 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; THCA | mirMAP | TCGA BRCA -0.168; TCGA CESC -0.115; TCGA COAD -0.135; TCGA HNSC -0.186; TCGA KIRP -0.093; TCGA LUAD -0.079; TCGA LUSC -0.225; TCGA PAAD -0.092; TCGA THCA -0.095 |
hsa-miR-374a-5p | RUNX2 | 9 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; THCA | mirMAP | TCGA BRCA -0.144; TCGA CESC -0.262; TCGA COAD -0.402; TCGA HNSC -0.181; TCGA LIHC -0.405; TCGA LUAD -0.139; TCGA LUSC -0.685; TCGA PAAD -0.244; TCGA THCA -0.696 |
hsa-miR-374a-5p | PRRG4 | 9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA | mirMAP | TCGA BRCA -0.228; TCGA HNSC -0.192; TCGA KIRC -0.379; TCGA KIRP -0.249; TCGA LUAD -0.184; TCGA LUSC -0.245; TCGA PAAD -0.214; TCGA SARC -0.363; TCGA THCA -0.165 |
hsa-miR-374a-5p | RPRD1A | 9 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.174; TCGA COAD -0.227; TCGA KIRC -0.2; TCGA KIRP -0.087; TCGA LGG -0.063; TCGA LIHC -0.122; TCGA SARC -0.207; TCGA THCA -0.284; TCGA STAD -0.212 |
hsa-miR-374a-5p | POGK | 11 cancers: BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC | mirMAP | TCGA BRCA -0.145; TCGA CESC -0.13; TCGA KIRC -0.099; TCGA KIRP -0.124; TCGA LUAD -0.092; TCGA LUSC -0.116; TCGA PAAD -0.086; TCGA PRAD -0.071; TCGA SARC -0.151; TCGA THCA -0.149; TCGA UCEC -0.082 |
hsa-miR-374a-5p | PPP2R5E | 10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BRCA -0.175; TCGA ESCA -0.174; TCGA HNSC -0.163; TCGA KIRC -0.134; TCGA KIRP -0.12; TCGA LUAD -0.166; TCGA LUSC -0.328; TCGA PAAD -0.12; TCGA SARC -0.112; TCGA STAD -0.138 |
hsa-miR-374a-5p | MMP16 | 9 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.219; TCGA COAD -0.521; TCGA HNSC -0.43; TCGA LIHC -0.46; TCGA LUAD -0.267; TCGA LUSC -0.857; TCGA SARC -0.361; TCGA THCA -0.904; TCGA STAD -0.622 |
hsa-miR-374a-5p | CLDN12 | 12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.207; TCGA CESC -0.183; TCGA HNSC -0.122; TCGA KIRC -0.139; TCGA KIRP -0.167; TCGA LGG -0.101; TCGA LUAD -0.131; TCGA LUSC -0.169; TCGA PAAD -0.255; TCGA SARC -0.156; TCGA THCA -0.197; TCGA STAD -0.215 |
hsa-miR-374a-5p | OXR1 | 9 cancers: BRCA; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.081; TCGA KIRC -0.244; TCGA KIRP -0.469; TCGA LUAD -0.114; TCGA LUSC -0.182; TCGA PAAD -0.19; TCGA SARC -0.216; TCGA THCA -0.112; TCGA STAD -0.262 |
hsa-miR-374a-5p | CRK | 9 cancers: BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.126; TCGA COAD -0.266; TCGA HNSC -0.128; TCGA KIRP -0.185; TCGA LUAD -0.135; TCGA LUSC -0.142; TCGA PAAD -0.144; TCGA STAD -0.124; TCGA UCEC -0.133 |
hsa-miR-374a-5p | TOR1AIP2 | 10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC | mirMAP | TCGA BRCA -0.265; TCGA COAD -0.297; TCGA HNSC -0.221; TCGA KIRC -0.19; TCGA KIRP -0.216; TCGA LUAD -0.126; TCGA LUSC -0.361; TCGA PAAD -0.176; TCGA SARC -0.227; TCGA UCEC -0.153 |
hsa-miR-374a-5p | SLC30A1 | 10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC | mirMAP | TCGA BRCA -0.279; TCGA CESC -0.205; TCGA HNSC -0.18; TCGA KIRC -0.301; TCGA KIRP -0.217; TCGA LUAD -0.132; TCGA LUSC -0.243; TCGA PAAD -0.266; TCGA SARC -0.126; TCGA UCEC -0.142 |
hsa-miR-374a-5p | SPTY2D1 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD | mirMAP | TCGA BRCA -0.19; TCGA CESC -0.089; TCGA COAD -0.092; TCGA HNSC -0.099; TCGA KIRC -0.218; TCGA KIRP -0.137; TCGA LUAD -0.119; TCGA LUSC -0.151; TCGA PAAD -0.216 |
hsa-miR-374a-5p | ZFP91 | 9 cancers: BRCA; COAD; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.155; TCGA COAD -0.078; TCGA KIRP -0.128; TCGA LUAD -0.12; TCGA LUSC -0.156; TCGA PAAD -0.172; TCGA SARC -0.118; TCGA THCA -0.1; TCGA STAD -0.099 |
hsa-miR-374a-5p | CD2AP | 9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; THCA | mirMAP | TCGA BRCA -0.206; TCGA CESC -0.163; TCGA ESCA -0.211; TCGA HNSC -0.144; TCGA KIRC -0.233; TCGA KIRP -0.114; TCGA LUAD -0.147; TCGA PAAD -0.232; TCGA THCA -0.143 |
hsa-miR-374a-5p | IPO9 | 9 cancers: BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA | mirMAP | TCGA BRCA -0.131; TCGA COAD -0.085; TCGA HNSC -0.113; TCGA LUAD -0.077; TCGA LUSC -0.166; TCGA PAAD -0.065; TCGA PRAD -0.051; TCGA SARC -0.182; TCGA THCA -0.057 |
hsa-miR-374a-5p | DSG2 | 11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; UCEC | MirTarget | TCGA CESC -0.218; TCGA ESCA -0.323; TCGA HNSC -0.315; TCGA KIRC -0.378; TCGA KIRP -0.221; TCGA LIHC -0.547; TCGA LUAD -0.209; TCGA LUSC -0.406; TCGA PAAD -0.575; TCGA THCA -0.37; TCGA UCEC -0.154 |
hsa-miR-374a-5p | MYO10 | 11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD | mirMAP | TCGA CESC -0.166; TCGA ESCA -0.302; TCGA HNSC -0.314; TCGA KIRC -0.621; TCGA KIRP -0.215; TCGA LGG -0.211; TCGA LIHC -0.423; TCGA LUAD -0.142; TCGA LUSC -0.545; TCGA PAAD -0.143; TCGA PRAD -0.096 |
hsa-miR-374a-5p | C1orf116 | 10 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; THCA; UCEC | mirMAP | TCGA CESC -0.62; TCGA COAD -0.19; TCGA ESCA -0.459; TCGA HNSC -0.289; TCGA KIRC -2.055; TCGA KIRP -0.434; TCGA LIHC -0.452; TCGA PAAD -0.366; TCGA THCA -0.413; TCGA UCEC -0.547 |
hsa-miR-374a-5p | PCDHB10 | 9 cancers: COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA COAD -0.422; TCGA HNSC -0.185; TCGA LGG -0.173; TCGA LIHC -0.289; TCGA LUAD -0.199; TCGA LUSC -0.275; TCGA PRAD -0.245; TCGA STAD -0.521; TCGA UCEC -0.366 |
Enriched cancer pathways of putative targets