microRNA information: hsa-miR-375

SectionIDlink
Mature name: hsa-miR-375miRbase
Accession: MIMAT0000728miRbase
Precursor name: hsa-mir-375 miRbase
Precursor accession: MI0000783miRbase
Symbol: MIR375HGNC
RefSeq ID: NR_029867GenBank
Sequence: UUUGUUCGUUCGGCUCGCGUGA



Reported expression in cancers: hsa-miR-375

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-375

acute myeloid leukemiaupregulation"Upregulation of microRNA 375 is associated with po ......"23864342qPCR
hsa-miR-375

breast cancerupregulation"The current study validates nine miRNAs miR-18a/b ......"23144930qPCR
hsa-miR-375

breast cancerupregulation"Hsa miR 375 is a predictor of local control in ear ......"26962366Microarray; qPCR
hsa-miR-375

cervical and endocervical cancerupregulation"miR 375 is upregulated in acquired paclitaxel resi ......"23778521Microarray
hsa-miR-375

cervical and endocervical cancerupregulation"miR 375 mediated acquired chemo resistance in cerv ......"25330011
hsa-miR-375

cervical and endocervical cancerupregulation"Real-time Polymerase Chain Reaction was performed ......"27206217qPCR
hsa-miR-375

colon cancerupregulation"Among the upregulated miRNAs we focused on miR-199 ......"26107137
hsa-miR-375

colon cancerdownregulation"The aim of the current study was to identify wheth ......"26697569
hsa-miR-375

colorectal cancerdownregulation"Expression levels of microRNA 375 in colorectal ca ......"22377847qPCR
hsa-miR-375

colorectal cancerdownregulation"Herein we showed that miR-375 was frequently down- ......"24440701
hsa-miR-375

colorectal cancerdownregulation"The expression of microRNA 375 in plasma and tissu ......"25255814qPCR; Microarray
hsa-miR-375

colorectal cancerdownregulation"Our previous study found that microRNA-375 miR-375 ......"27222350
hsa-miR-375

colorectal cancerdownregulation"Of these microRNAs microRNA-375 miR-375 was previo ......"27276676
hsa-miR-375

esophageal cancerdownregulation"Some recent studies show that DNA methylation cont ......"21533613qPCR
hsa-miR-375

esophageal cancerdownregulation"MicroRNA 375 inhibits tumour growth and metastasis ......"21813472
hsa-miR-375

esophageal cancerdownregulation"Cell specific detection of miR 375 downregulation ......"23301089in situ hybridization; Microarray; qPCR
hsa-miR-375

esophageal cancerdownregulation"MicroRNA miR-21 and miR-375 are related to esophag ......"27508050qPCR; in situ hybridization
hsa-miR-375

gastric cancerdownregulation"Here we performed miRNA microarray to screen miRNA ......"20548334Microarray; qPCR
hsa-miR-375

gastric cancerdownregulation"MiR-375 and miR-148a were found downregulated in s ......"24902858
hsa-miR-375

gastric cancerdownregulation"MicroRNA 375 Functions as a Tumor Suppressor Gene ......"27689991
hsa-miR-375

head and neck cancerdownregulation"Conversely decreased expressions of miR-153 miR-20 ......"25677760
hsa-miR-375

liver cancerdownregulation"Among the 13 miRNAs we found that miR-375 was sign ......"22056881
hsa-miR-375

liver cancerdownregulation"We used a luciferase reporter assay to confirm ass ......"22504094
hsa-miR-375

lung cancerderegulation"We analyzed the expression of 14 selected miRNAs b ......"23268837qPCR
hsa-miR-375

lung cancerderegulation"The Expression of miR 375 Is Associated with Carci ......"26642205Microarray
hsa-miR-375

lung squamous cell cancerdownregulation"Decreased expression of microRNA 375 in nonsmall c ......"23206448Reverse transcription PCR; qPCR
hsa-miR-375

lung squamous cell cancerdownregulation"We attempted to investigate the expression and cli ......"24513341
hsa-miR-375

pancreatic cancerdownregulation"Aberrant expression of microRNA-375 miR-375 has be ......"23581226qPCR
hsa-miR-375

pancreatic cancerdownregulation"Expression levels of microRNA 375 in pancreatic ca ......"24648956qPCR
hsa-miR-375

prostate cancerupregulation"In primary CaP tissue we have previously found by ......"21593139RNA-Seq
hsa-miR-375

prostate cancerupregulation"Three of these hsa-miR-141 hsa-miR-298 and hsa-miR ......"22052531
hsa-miR-375

thyroid cancerupregulation"The aim of this study was to assess miRNA expressi ......"23427895Microarray
hsa-miR-375

thyroid cancerupregulation"Redifferentiation and induction of tumor suppresso ......"23598436



Reported cancer pathway affected by hsa-miR-375

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-375

breast cancerApoptosis pathway"Biochanin A promotes proliferation that involves a ......"25613180Flow cytometry; MTT assay
hsa-miR-375

cervical and endocervical cancercell cycle pathway"miR 375 is down regulated in squamous cervical can ......"21945323
hsa-miR-375

cervical and endocervical cancerEpithelial mesenchymal transition pathway"miR 375 mediated acquired chemo resistance in cerv ......"25330011
hsa-miR-375

cervical and endocervical cancerApoptosis pathway"miR 375 Modulates Radiosensitivity of HR HPV Posit ......"26224081
hsa-miR-375

cervical and endocervical cancerApoptosis pathway"miR 375 Affects the Proliferation Invasion and Apo ......"27206217Western blot
hsa-miR-375

cervical and endocervical cancerEpithelial mesenchymal transition pathway"MiR 375 Is Epigenetically Downregulated by HPV 16 ......"27658300Luciferase
hsa-miR-375

colon cancerApoptosis pathway"Exosome Carried microRNA 375 Inhibits Cell Progres ......"26697569Western blot; Flow cytometry
hsa-miR-375

colorectal cancercell cycle pathway; PI3K/Akt signaling pathway"MicroRNA 375 inhibits colorectal cancer growth by ......"24440701Colony formation
hsa-miR-375

colorectal cancerApoptosis pathway"Additionally TaqMan Human MicroRNA Array Set v2.0 ......"24892549
hsa-miR-375

colorectal cancercell cycle pathway"MiR 375 targets KLF4 and impacts the proliferation ......"26224477Luciferase; Colony formation
hsa-miR-375

gastric cancerApoptosis pathway"MicroRNA 375 is downregulated in gastric carcinoma ......"20215506Luciferase
hsa-miR-375

gastric cancercell cycle pathway; Apoptosis pathway"miR 375 targets the p53 gene to regulate cellular ......"23835407Colony formation; Luciferase; Flow cytometry
hsa-miR-375

gastric cancerApoptosis pathway"Upregulation of microRNA 375 increases the cisplat ......"26893657Western blot
hsa-miR-375

gastric cancercell cycle pathway"MicroRNA 375 Functions as a Tumor Suppressor Gene ......"27689991Luciferase; RNAi
hsa-miR-375

head and neck cancercell cycle pathway"A global miRNA profiling was done on 51 formalin-f ......"20145181Flow cytometry
hsa-miR-375

head and neck cancerApoptosis pathway"Tumor suppressive microRNA 375 regulates oncogene ......"21753766Luciferase
hsa-miR-375

head and neck cancerApoptosis pathway"MicroRNA 375 sensitizes tumour necrosis factor alp ......"23726271Western blot
hsa-miR-375

liver cancerHippo signaling pathway"MicroRNA 375 targets Hippo signaling effector YAP ......"20226166Luciferase
hsa-miR-375

liver cancerApoptosis pathway"MicroRNA 375 targets AEG 1 in hepatocellular carci ......"22056881Western blot; RNAi
hsa-miR-375

ovarian cancerApoptosis pathway"Mir 375 enhances ruthenium derived compound Rawq01 ......"23696927Flow cytometry; MTT assay; Western blot
hsa-miR-375

pancreatic cancercell cycle pathway; Apoptosis pathway"MicroRNA 375 is downregulated in pancreatic cancer ......"23581226Flow cytometry
hsa-miR-375

prostate cancerEpithelial mesenchymal transition pathway"A ZEB1 miR 375 YAP1 pathway regulates epithelial p ......"27270433
hsa-miR-375

sarcomaApoptosis pathway"Formononetin induces apoptosis of human osteosarco ......"26381132MTT assay; Flow cytometry; Western blot
hsa-miR-375

thyroid cancerApoptosis pathway"Over expression of microRNA 375 inhibits papillary ......"26806295



Reported cancer prognosis affected by hsa-miR-375

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-375

acute myeloid leukemiaworse prognosis; poor survival; progression"Upregulation of microRNA 375 is associated with po ......"23864342
hsa-miR-375

breast cancerstaging; drug resistance"De novo sequencing of circulating miRNAs identifie ......"22400902
hsa-miR-375

breast cancerdrug resistance; metastasis"Re expression of microRNA 375 reverses both tamoxi ......"22508479
hsa-miR-375

breast cancercell migration"Analysis of the miRNA expression identified 11 miR ......"23497265
hsa-miR-375

breast cancerdrug resistance"Epigenetic silencing of miR 375 induces trastuzuma ......"24571711Luciferase
hsa-miR-375

breast cancerpoor survival"SHOX2 is a direct miR 375 target and a novel epith ......"24746361
hsa-miR-375

breast cancerdrug resistance"Besides several miRNAs e.g miR-375 were enriched i ......"25680412
hsa-miR-375

breast cancerstaging"Hsa miR 375 is a predictor of local control in ear ......"26962366
hsa-miR-375

breast cancerrecurrence"We identified seven miRNAs that were differentiall ......"27409424
hsa-miR-375

breast cancerdrug resistance"MiR 375 is epigenetically downregulated due to pro ......"27466996MTT assay; Western blot; Luciferase
hsa-miR-375

cervical and endocervical cancercell migration; metastasis; progression; malignant trasformation"miR 375 is down regulated in squamous cervical can ......"21945323
hsa-miR-375

cervical and endocervical cancerdrug resistance"miR 375 is upregulated in acquired paclitaxel resi ......"23778521
hsa-miR-375

cervical and endocervical cancerdrug resistance"miR 375 mediated acquired chemo resistance in cerv ......"25330011
hsa-miR-375

cervical and endocervical cancerdrug resistance"miR 375 Modulates Radiosensitivity of HR HPV Posit ......"26224081
hsa-miR-375

cervical and endocervical cancertumorigenesis"miR 375 Affects the Proliferation Invasion and Apo ......"27206217Western blot
hsa-miR-375

cervical and endocervical cancermetastasis"MiR 375 Is Epigenetically Downregulated by HPV 16 ......"27658300Luciferase
hsa-miR-375

colon cancerdrug resistance"MiR 199a 5p and miR 375 affect colon cancer cell s ......"26107137
hsa-miR-375

colon cancerprogression"Exosome Carried microRNA 375 Inhibits Cell Progres ......"26697569Western blot; Flow cytometry
hsa-miR-375

colorectal cancerstaging; tumor size; tumorigenesis"Expression levels of microRNA 375 in colorectal ca ......"22377847
hsa-miR-375

colorectal cancerstaging"Additionally TaqMan Human MicroRNA Array Set v2.0 ......"24892549
hsa-miR-375

colorectal cancerprogression"The expression of microRNA 375 in plasma and tissu ......"25255814
hsa-miR-375

colorectal cancermetastasis"miR 375 inhibits the invasion and metastasis of co ......"27222350Colony formation; Transwell assay; Western blot; Luciferase
hsa-miR-375

colorectal cancermetastasis; cell migration"MicroRNA 375 suppresses human colorectal cancer me ......"27276676
hsa-miR-375

esophageal cancertumorigenesis"Epigenetic silencing of microRNA 375 regulates PDK ......"21533613
hsa-miR-375

esophageal cancermetastasis; staging; poor survival; motility; progression"MicroRNA 375 inhibits tumour growth and metastasis ......"21813472
hsa-miR-375

esophageal cancerpoor survival; worse prognosis"Prognostic impact of circulating miR 21 and miR 37 ......"22519435
hsa-miR-375

esophageal cancerstaging; metastasis; poor survival; recurrence; drug resistance; worse prognosis"There are several microRNAs that have been consist ......"23092342
hsa-miR-375

esophageal cancerworse prognosis; staging; metastasis"Cell specific detection of miR 375 downregulation ......"23301089
hsa-miR-375

esophageal cancerpoor survival"Clinical significance of serum miR 223 miR 25 and ......"24390317
hsa-miR-375

esophageal cancerworse prognosis"The expression of miR 21 and miR 375 predict progn ......"24680681
hsa-miR-375

esophageal cancerrecurrence"Pooled hazard ratios of miR-21 and miR-375 for OS ......"25097879
hsa-miR-375

esophageal cancerpoor survival; worse prognosis"Evaluation of miR 21 and miR 375 as prognostic bio ......"26481465
hsa-miR-375

esophageal cancerworse prognosis"MicroRNA miR-21 and miR-375 are related to esophag ......"27508050
hsa-miR-375

gastric cancerpoor survival"MicroRNA 375 is downregulated in gastric carcinoma ......"20215506Luciferase
hsa-miR-375

gastric cancerrecurrence; poor survival; progression"Combination of hsa miR 375 and hsa miR 142 5p as a ......"21343377
hsa-miR-375

gastric cancertumorigenesis"Targeting miR 375 in gastric cancer; This review s ......"21557705
hsa-miR-375

gastric cancerdrug resistance"miR 375 targets the p53 gene to regulate cellular ......"23835407Colony formation; Luciferase; Flow cytometry
hsa-miR-375

gastric cancertumorigenesis"miR 375 inhibits the proliferation of gastric canc ......"24926380Western blot; Luciferase
hsa-miR-375

gastric cancermetastasis; cell migration"Snail regulated MiR 375 inhibits migration and inv ......"25055044
hsa-miR-375

gastric cancerstaging"In the second stage differentially expressed miRNA ......"26172537
hsa-miR-375

gastric cancermetastasis"MicroRNA 375 Functions as a Tumor Suppressor Gene ......"27689991Luciferase; RNAi
hsa-miR-375

head and neck cancerpoor survival; cell migration; metastasis; progression"Significance of dysregulated metadherin and microR ......"22031094Western blot; Luciferase
hsa-miR-375

head and neck cancermetastasis; malignant trasformation; poor survival; staging"Low level expression of miR 375 correlates with po ......"22234174
hsa-miR-375

head and neck cancerworse prognosis"Conversely decreased expressions of miR-153 miR-20 ......"25677760
hsa-miR-375

head and neck cancermetastasis; poor survival; recurrence"MicroRNA 375 Suppresses Extracellular Matrix Degra ......"26172508Western blot
hsa-miR-375

liver cancerstaging"Circulating miR 375 and miR 199a 3p as potential b ......"25618599
hsa-miR-375

liver cancertumorigenesis"Among the downregulated miRNAs eight miR-101 miR-1 ......"25762642
hsa-miR-375

lung cancerdifferentiation"miR 375 is activated by ASH1 and inhibits YAP1 in ......"21856745
hsa-miR-375

lung cancermetastasis"MicroRNA microarrays were performed on 26 primary ......"24778034
hsa-miR-375

lung cancerstaging"MiR 205 and MiR 375 microRNA assays to distinguish ......"25695220
hsa-miR-375

lung cancertumorigenesis"The Expression of miR 375 Is Associated with Carci ......"26642205Western blot; Luciferase
hsa-miR-375

lung squamous cell cancerprogression; staging; metastasis; poor survival"Decreased expression of microRNA 375 in nonsmall c ......"23206448
hsa-miR-375

lung squamous cell cancerprogression; poor survival; drug resistance"A two miRNA signature miR-149 and miR-375 was foun ......"24007627
hsa-miR-375

lung squamous cell cancerpoor survival; progression"Alterations of miRNAs expression in cancer tissue ......"24404590
hsa-miR-375

lung squamous cell cancerpoor survival; progression"We attempted to investigate the expression and cli ......"24513341
hsa-miR-375

lung squamous cell cancermetastasis; cell migration; poor survival"Claudin 1 is a novel target of miR 375 in non smal ......"25001509Luciferase; Wound Healing Assay
hsa-miR-375

melanomaprogression; motility"Epigenetic regulation of microRNA 375 and its role ......"21723283
hsa-miR-375

ovarian cancerdrug resistance"Of these 10 miRNAs miR-193a-5p miR-375 miR-339-3p ......"26485143
hsa-miR-375

pancreatic cancermalignant trasformation"miR-148a/b and miR-375 expression were found decre ......"21738581
hsa-miR-375

pancreatic cancerprogression; staging; metastasis; tumor size"MicroRNA 375 is downregulated in pancreatic cancer ......"23581226Flow cytometry
hsa-miR-375

pancreatic cancertumor size; staging; metastasis; tumorigenesis"Expression levels of microRNA 375 in pancreatic ca ......"24648956
hsa-miR-375

pancreatic cancerworse prognosis; poor survival"The aim of this study was to investigate microRNAs ......"25906450
hsa-miR-375

prostate cancerprogression"Three of these hsa-miR-141 hsa-miR-298 and hsa-miR ......"22052531
hsa-miR-375

prostate cancerprogression"Androgen receptor is negatively correlated with th ......"24173286
hsa-miR-375

prostate cancerstaging; malignant trasformation; metastasis"Comparative microRNA profiling of prostate carcino ......"24337069
hsa-miR-375

prostate cancerpoor survival; worse prognosis"Exosomal miR 1290 and miR 375 as prognostic marker ......"25129854
hsa-miR-375

prostate cancerstaging; worse prognosis"The combined serum levels of miR 375 and urokinase ......"25754273
hsa-miR-375

prostate cancerprogression"CIC overexpression suppressed prostate cancer cell ......"26124181RNAi
hsa-miR-375

prostate cancerworse prognosis"Promising preliminary results were published conce ......"26751899
hsa-miR-375

prostate cancerstaging"To investigate the diagnostic potential of plasma ......"27268927
hsa-miR-375

prostate cancerprogression; staging"A ZEB1 miR 375 YAP1 pathway regulates epithelial p ......"27270433
hsa-miR-375

prostate cancerprogression; poor survival"Ago RIP Seq identifies Polycomb repressive complex ......"27449098
hsa-miR-375

sarcomatumorigenesis"MicroRNA 375 functions as a tumor suppressor in os ......"26036761
hsa-miR-375

thyroid cancerpoor survival"The aim of this study was to assess miRNA expressi ......"23427895
hsa-miR-375

thyroid cancerdifferentiation"Redifferentiation and induction of tumor suppresso ......"23598436



Reported gene related to hsa-miR-375

miRNAcancergenereportingPUBMED
hsa-miR-375

breast cancerERBB2"Epigenetic silencing of miR 375 induces trastuzuma ......"24571711
hsa-miR-375

gastric cancerERBB2"miR 375 inhibits the proliferation of gastric canc ......"24926380
hsa-miR-375

gastric cancerERBB2"Upregulation of microRNA 375 increases the cisplat ......"26893657
hsa-miR-375

thyroid cancerERBB2"Over expression of microRNA 375 inhibits papillary ......"26806295
hsa-miR-375

liver cancerYAP1"MicroRNA 375 targets Hippo signaling effector YAP ......"20226166
hsa-miR-375

lung cancerYAP1"miR 375 is activated by ASH1 and inhibits YAP1 in ......"21856745
hsa-miR-375

prostate cancerYAP1"A ZEB1 miR 375 YAP1 pathway regulates epithelial p ......"27270433
hsa-miR-375

thyroid cancerYAP1"Overexpression of miR 10a and miR 375 and downregu ......"23685355
hsa-miR-375

breast cancerBCL2"mRNA levels of ERα Bcl-2 and miR-375 were quantif ......"25613180
hsa-miR-375

colon cancerBCL2"Exosome Carried microRNA 375 Inhibits Cell Progres ......"26697569
hsa-miR-375

sarcomaBCL2"The levels of miR-375 Bax and Bcl-2 protein expres ......"26381132
hsa-miR-375

breast cancerESR1"Epigenetically deregulated microRNA 375 is involve ......"20978187
hsa-miR-375

breast cancerESR1"Biochanin A promotes proliferation that involves a ......"25613180
hsa-miR-375

breast cancerESR1"Hsa-miR-375 predicts local control in patient with ......"26962366
hsa-miR-375

breast cancerIGF1R"Epigenetic silencing of miR 375 induces trastuzuma ......"24571711
hsa-miR-375

esophageal cancerIGF1R"Real-time quantitative PCR was applied to detectth ......"21813472
hsa-miR-375

ovarian cancerIGF1R"Together these results show that AE modulates canc ......"27129171
hsa-miR-375

gastric cancerJAK2"MiR 375 frequently downregulated in gastric cancer ......"20548334
hsa-miR-375

gastric cancerJAK2"Snail regulated MiR 375 inhibits migration and inv ......"25055044
hsa-miR-375

gastric cancerJAK2"The genes targeted by miR-375 including JAK2 and 3 ......"21557705
hsa-miR-375

breast cancerMTDH"A combination of mRNA profiling bioinformatics ana ......"22508479
hsa-miR-375

head and neck cancerMTDH"Significance of dysregulated metadherin and microR ......"22031094
hsa-miR-375

liver cancerMTDH"MicroRNA 375 targets AEG 1 in hepatocellular carci ......"22056881
hsa-miR-375

esophageal cancerPDK1"Epigenetic silencing of microRNA 375 regulates PDK ......"21533613
hsa-miR-375

gastric cancerPDK1"The genes targeted by miR-375 including JAK2 and 3 ......"21557705
hsa-miR-375

gastric cancerPDK1"MicroRNA 375 is downregulated in gastric carcinoma ......"20215506
hsa-miR-375

cervical and endocervical cancerTP53"miR 375 Modulates Radiosensitivity of HR HPV Posit ......"26224081
hsa-miR-375

gastric cancerTP53"miR 375 targets the p53 gene to regulate cellular ......"23835407
hsa-miR-375

gastric cancerTP53"In addition we evaluated that hsa-miR-375 and hsa- ......"21343377
hsa-miR-375

cervical and endocervical cancerDNMT1"MiR 375 Is Epigenetically Downregulated by HPV 16 ......"27658300
hsa-miR-375

prostate cancerDNMT1"Taken together these findings indicate that the ne ......"24173286
hsa-miR-375

colorectal cancerF2"However there were no significant correlations bet ......"22377847
hsa-miR-375

pancreatic cancerF2"The low expression of miR-375 was correlated with ......"24648956
hsa-miR-375

colorectal cancerPIK3CA"MicroRNA 375 inhibits colorectal cancer growth by ......"24440701
hsa-miR-375

sarcomaPIK3CA"MicroRNA 375 functions as a tumor suppressor in os ......"26036761
hsa-miR-375

lung cancerSCLC1"Thus our study demonstrates the differential expre ......"26642205
hsa-miR-375

lung squamous cell cancerSCLC1"These results imply a role of ASCL1 in SCLC via th ......"22172490
hsa-miR-375

gastric cancerSNAI1"Snail regulated MiR 375 inhibits migration and inv ......"25055044
hsa-miR-375

ovarian cancerSNAI1"Together these results show that AE modulates canc ......"27129171
hsa-miR-375

cervical and endocervical cancerSP1"miR 375 is down regulated in squamous cervical can ......"21945323
hsa-miR-375

colorectal cancerSP1"miR 375 inhibits the invasion and metastasis of co ......"27222350
hsa-miR-375

breast cancerABCB1"Both miR-375 overexpression and YBX1 knockdown sig ......"27466996
hsa-miR-375

prostate cancerAR"Androgen receptor is negatively correlated with th ......"24173286
hsa-miR-375

lung squamous cell cancerASCL1"Moreover miR-375 was upregulated and correlated wi ......"22172490
hsa-miR-375

liver cancerATG7"The ability of miR-375 to inhibit autophagy was in ......"22504094
hsa-miR-375

sarcomaBAX"The levels of miR-375 Bax and Bcl-2 protein expres ......"26381132
hsa-miR-375

head and neck cancerBIRC3"Taken together these data suggest that miR-375 sen ......"23726271
hsa-miR-375

prostate cancerCBX7"Integration of tissue and gene ontology data prior ......"27449098
hsa-miR-375

lung squamous cell cancerCDC37"miR 375 is highly expressed and possibly transacti ......"22172490
hsa-miR-375

lung squamous cell cancerCLDN1"Claudin 1 is a novel target of miR 375 in non smal ......"25001509
hsa-miR-375

liver cancerCTNNB1"Down-regulations of miR-107 and miR-375 were speci ......"18433021
hsa-miR-375

head and neck cancerCTTN"Higher miR-375 expression does not reduce cellular ......"26172508
hsa-miR-375

esophageal cancerCYLD"The aim of this study was to evaluate the prognost ......"26481465
hsa-miR-375

colon cancerCYP27A1"Indeed restoration of PHLPP1 increases sensitivity ......"26107137
hsa-miR-375

gastric cancerEGF"In the present study miR-375 was shown to be downr ......"24926380
hsa-miR-375

colorectal cancerFZD1"MicroRNA 375 suppresses human colorectal cancer me ......"27276676
hsa-miR-375

colorectal cancerFZD8"MicroRNA 375 suppresses human colorectal cancer me ......"27276676
hsa-miR-375

pancreatic cancerHOXB3"Deregulation of MicroRNA 375 inhibits cancer proli ......"27186281
hsa-miR-375

pancreatic cancerIGFBP5"Further analysis by gene expression microarray rev ......"21779484
hsa-miR-375

lung cancerITPKB"Further investigation revealed that miR-375 direct ......"26642205
hsa-miR-375

colorectal cancerKLF4"MiR 375 targets KLF4 and impacts the proliferation ......"26224477
hsa-miR-375

esophageal cancerLDHB"The restoration of miR-375 suppressed the expressi ......"22752059
hsa-miR-375

cervical and endocervical cancerMALAT1"MiR 375 Is Epigenetically Downregulated by HPV 16 ......"27658300
hsa-miR-375

colorectal cancerMMP2"In conclusion miR-375 inhibited the proliferation ......"27222350
hsa-miR-375

gastric cancerMST1R"However the function of miR-375 and RON expression ......"27689991
hsa-miR-375

liver cancerMYC"Noticeably miR-375 showed limited antineoplastic a ......"25762642
hsa-miR-375

head and neck cancerNPC1"The prognostic significance of miR-375 or MTDH in ......"22031094
hsa-miR-375

esophageal cancerPDPK1"Epigenetic silencing of miR-375 induced an up-regu ......"21533613
hsa-miR-375

colon cancerPHLPP1"Indeed restoration of PHLPP1 increases sensitivity ......"26107137
hsa-miR-375

colorectal cancerPIK3CD"Furthermore miR-375 overexpression resulted in inh ......"24440701
hsa-miR-375

prostate cancerPLG"The combined serum levels of miR 375 and urokinase ......"25754273
hsa-miR-375

breast cancerRASD1"A combination of expression profiling from tumor s ......"20978187
hsa-miR-375

prostate cancerSEC23A"A computational analysis predicted the 3'-UTR of t ......"21593139
hsa-miR-375

esophageal cancerSGSM3"Screening of alternative drugs to the tumor suppre ......"25195536
hsa-miR-375

breast cancerSHOX2"SHOX2 is a direct miR 375 target and a novel epith ......"24746361
hsa-miR-375

thyroid cancerSLC16A2"Expression of the potential downstream targets of ......"23685355
hsa-miR-375

lung squamous cell cancerSMR3B"Plasma miR-375 levels in NSCLC patients were signi ......"24404590
hsa-miR-375

gastric cancerTIMM8A"In addition upregulation of miR-375 significantly ......"26893657
hsa-miR-375

head and neck cancerTNF"MicroRNA 375 sensitizes tumour necrosis factor alp ......"23726271
hsa-miR-375

cervical and endocervical cancerUBE3A"miR 375 Modulates Radiosensitivity of HR HPV Posit ......"26224081
hsa-miR-375

breast cancerYBX1"MiR 375 is epigenetically downregulated due to pro ......"27466996
hsa-miR-375

prostate cancerZEB1"A ZEB1 miR 375 YAP1 pathway regulates epithelial p ......"27270433
hsa-miR-375

prostate cancerZNF135"Hereby miR-375 increased from normal to organ-conf ......"24337069



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-375
AXL
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.162; TCGA BRCA -0.068; TCGA CESC -0.157; TCGA COAD -0.294; TCGA ESCA -0.09; TCGA HNSC -0.155; TCGA KIRC -0.081; TCGA LUAD -0.203; TCGA OV -0.105; TCGA PAAD -0.168; TCGA PRAD -0.308; TCGA STAD -0.177; TCGA UCEC -0.076
hsa-miR-375
CFL2
11 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.08; TCGA BRCA -0.134; TCGA COAD -0.244; TCGA ESCA -0.103; TCGA LIHC -0.062; TCGA LUAD -0.11; TCGA PRAD -0.337; TCGA SARC -0.078; TCGA THCA -0.094; TCGA STAD -0.216; TCGA UCEC -0.116
hsa-miR-375
COL12A1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.137; TCGA CESC -0.068; TCGA COAD -0.249; TCGA ESCA -0.16; TCGA HNSC -0.236; TCGA LUAD -0.266; TCGA LUSC -0.17; TCGA OV -0.184; TCGA PAAD -0.31; TCGA STAD -0.15
hsa-miR-375
CTGF
9 cancers: BLCA; BRCA; COAD; LGG; LUAD; OV; PRAD; THCA; STAD
miRNAWalker2 validate; miRanda
TCGA BLCA -0.191; TCGA BRCA -0.105; TCGA COAD -0.267; TCGA LGG -0.086; TCGA LUAD -0.075; TCGA OV -0.095; TCGA PRAD -0.244; TCGA THCA -0.106; TCGA STAD -0.074
hsa-miR-375
DPYSL3
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; OV; PAAD; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.115; TCGA BRCA -0.143; TCGA COAD -0.277; TCGA ESCA -0.202; TCGA KIRC -0.088; TCGA LGG -0.108; TCGA OV -0.173; TCGA PAAD -0.096; TCGA PRAD -0.351; TCGA SARC -0.107; TCGA STAD -0.202
hsa-miR-375
EXT1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.057; TCGA BRCA -0.069; TCGA CESC -0.133; TCGA ESCA -0.092; TCGA HNSC -0.103; TCGA LUAD -0.073; TCGA LUSC -0.141; TCGA PAAD -0.057; TCGA PRAD -0.141; TCGA THCA -0.072; TCGA UCEC -0.079
hsa-miR-375
FSTL3
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.094; TCGA CESC -0.122; TCGA COAD -0.29; TCGA ESCA -0.166; TCGA HNSC -0.194; TCGA KIRC -0.122; TCGA KIRP -0.141; TCGA LUAD -0.156; TCGA OV -0.134; TCGA PRAD -0.072; TCGA STAD -0.15; TCGA UCEC -0.131
hsa-miR-375
JAG1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD
miRNAWalker2 validate
TCGA BLCA -0.081; TCGA BRCA -0.057; TCGA CESC -0.19; TCGA ESCA -0.162; TCGA HNSC -0.095; TCGA KIRC -0.101; TCGA LGG -0.101; TCGA LUAD -0.164; TCGA LUSC -0.243; TCGA PAAD -0.061
hsa-miR-375
LHFPL2
9 cancers: BLCA; BRCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.088; TCGA BRCA -0.08; TCGA HNSC -0.106; TCGA KIRC -0.109; TCGA LUAD -0.144; TCGA OV -0.059; TCGA PAAD -0.092; TCGA PRAD -0.307; TCGA STAD -0.055
hsa-miR-375
MAP3K8
10 cancers: BLCA; BRCA; CESC; COAD; LIHC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.076; TCGA BRCA -0.164; TCGA CESC -0.084; TCGA COAD -0.111; TCGA LIHC -0.199; TCGA PAAD -0.176; TCGA PRAD -0.347; TCGA THCA -0.133; TCGA STAD -0.122; TCGA UCEC -0.083
hsa-miR-375
PDGFC
10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRanda
TCGA BLCA -0.085; TCGA COAD -0.246; TCGA ESCA -0.112; TCGA HNSC -0.074; TCGA LGG -0.138; TCGA LUAD -0.113; TCGA PAAD -0.145; TCGA PRAD -0.374; TCGA STAD -0.085; TCGA UCEC -0.051
hsa-miR-375
PROCR
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA BLCA -0.126; TCGA BRCA -0.052; TCGA CESC -0.132; TCGA COAD -0.162; TCGA HNSC -0.133; TCGA KIRC -0.102; TCGA KIRP -0.069; TCGA LUAD -0.111; TCGA LUSC -0.066; TCGA OV -0.078; TCGA PRAD -0.19; TCGA SARC -0.081; TCGA UCEC -0.059
hsa-miR-375
SAMD4A
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRanda
TCGA BLCA -0.162; TCGA BRCA -0.171; TCGA CESC -0.064; TCGA COAD -0.248; TCGA HNSC -0.058; TCGA LUAD -0.15; TCGA PAAD -0.071; TCGA PRAD -0.264; TCGA STAD -0.146; TCGA UCEC -0.166
hsa-miR-375
SEC23A
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRanda
TCGA BLCA -0.063; TCGA BRCA -0.073; TCGA COAD -0.093; TCGA ESCA -0.063; TCGA HNSC -0.065; TCGA LUAD -0.137; TCGA LUSC -0.051; TCGA OV -0.07; TCGA PAAD -0.107; TCGA PRAD -0.313; TCGA SARC -0.056; TCGA STAD -0.07; TCGA UCEC -0.059
hsa-miR-375
TGM2
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.146; TCGA BRCA -0.092; TCGA COAD -0.261; TCGA HNSC -0.075; TCGA KIRC -0.084; TCGA LUAD -0.076; TCGA PAAD -0.172; TCGA SARC -0.153; TCGA STAD -0.234; TCGA UCEC -0.099
hsa-miR-375
TNS3
9 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; OV; PRAD; THCA
miRNAWalker2 validate
TCGA BLCA -0.076; TCGA BRCA -0.064; TCGA COAD -0.122; TCGA HNSC -0.096; TCGA LIHC -0.067; TCGA LUAD -0.093; TCGA OV -0.062; TCGA PRAD -0.164; TCGA THCA -0.152
hsa-miR-375
XAF1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.092; TCGA BRCA -0.06; TCGA CESC -0.079; TCGA COAD -0.11; TCGA ESCA -0.055; TCGA HNSC -0.141; TCGA KIRC -0.072; TCGA LUAD -0.131; TCGA PAAD -0.201; TCGA PRAD -0.223; TCGA SARC -0.084; TCGA STAD -0.076; TCGA UCEC -0.08
hsa-miR-375
DGKH
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
PITA; miRanda
TCGA BLCA -0.058; TCGA BRCA -0.057; TCGA COAD -0.095; TCGA KIRC -0.065; TCGA KIRP -0.082; TCGA LUAD -0.103; TCGA LUSC -0.127; TCGA PAAD -0.077; TCGA PRAD -0.249; TCGA STAD -0.063
hsa-miR-375
CXCL12
10 cancers: BLCA; BRCA; CESC; COAD; LUAD; OV; PRAD; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.169; TCGA BRCA -0.131; TCGA CESC -0.072; TCGA COAD -0.22; TCGA LUAD -0.122; TCGA OV -0.238; TCGA PRAD -0.243; TCGA THCA -0.055; TCGA STAD -0.104; TCGA UCEC -0.1
hsa-miR-375
DMD
9 cancers: BLCA; BRCA; CESC; COAD; LIHC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.117; TCGA BRCA -0.343; TCGA CESC -0.08; TCGA COAD -0.414; TCGA LIHC -0.067; TCGA PRAD -0.52; TCGA SARC -0.122; TCGA STAD -0.152; TCGA UCEC -0.117
hsa-miR-375
DFNA5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.165; TCGA BRCA -0.114; TCGA CESC -0.241; TCGA COAD -0.33; TCGA ESCA -0.33; TCGA HNSC -0.164; TCGA KIRP -0.078; TCGA LUAD -0.212; TCGA LUSC -0.094; TCGA PAAD -0.138; TCGA PRAD -0.334; TCGA SARC -0.122; TCGA UCEC -0.174
hsa-miR-375
FPR2
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; OV; PAAD; UCEC
miRanda
TCGA BLCA -0.108; TCGA BRCA -0.255; TCGA CESC -0.102; TCGA HNSC -0.123; TCGA KIRC -0.09; TCGA LUAD -0.147; TCGA OV -0.102; TCGA PAAD -0.269; TCGA UCEC -0.068
hsa-miR-375
SMAD7
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; OV; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.08; TCGA CESC -0.057; TCGA COAD -0.079; TCGA HNSC -0.069; TCGA KIRC -0.074; TCGA OV -0.055; TCGA PRAD -0.154; TCGA THCA -0.085; TCGA UCEC -0.089
hsa-miR-375
CCDC80
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; OV; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.186; TCGA BRCA -0.162; TCGA CESC -0.146; TCGA COAD -0.473; TCGA ESCA -0.208; TCGA LGG -0.126; TCGA LUAD -0.131; TCGA OV -0.242; TCGA PRAD -0.399; TCGA SARC -0.182; TCGA STAD -0.219; TCGA UCEC -0.105
hsa-miR-375
IL2RA
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; OV; PAAD; SARC
miRanda
TCGA BLCA -0.107; TCGA BRCA -0.227; TCGA CESC -0.179; TCGA ESCA -0.111; TCGA HNSC -0.179; TCGA LUAD -0.088; TCGA OV -0.146; TCGA PAAD -0.272; TCGA SARC -0.159
hsa-miR-375
BCL6
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; OV; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.075; TCGA BRCA -0.077; TCGA CESC -0.064; TCGA COAD -0.128; TCGA ESCA -0.199; TCGA KIRC -0.052; TCGA LGG -0.105; TCGA LIHC -0.088; TCGA OV -0.081; TCGA PAAD -0.142; TCGA PRAD -0.115; TCGA STAD -0.145
hsa-miR-375
FRMD6
12 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.163; TCGA CESC -0.299; TCGA COAD -0.343; TCGA ESCA -0.354; TCGA LUAD -0.27; TCGA LUSC -0.264; TCGA OV -0.056; TCGA PAAD -0.182; TCGA PRAD -0.469; TCGA SARC -0.081; TCGA STAD -0.155; TCGA UCEC -0.076
hsa-miR-375
CYBB
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.13; TCGA BRCA -0.099; TCGA CESC -0.165; TCGA COAD -0.165; TCGA HNSC -0.115; TCGA KIRC -0.099; TCGA LUAD -0.135; TCGA OV -0.112; TCGA PAAD -0.106; TCGA PRAD -0.177; TCGA SARC -0.141; TCGA STAD -0.077
hsa-miR-375
KANK2
9 cancers: BLCA; COAD; HNSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.104; TCGA COAD -0.226; TCGA HNSC -0.064; TCGA OV -0.064; TCGA PAAD -0.07; TCGA PRAD -0.369; TCGA SARC -0.099; TCGA STAD -0.145; TCGA UCEC -0.093
hsa-miR-375
SAMSN1
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; OV; PAAD; PRAD; SARC
miRanda
TCGA BLCA -0.114; TCGA CESC -0.146; TCGA ESCA -0.061; TCGA HNSC -0.078; TCGA LUAD -0.096; TCGA OV -0.101; TCGA PAAD -0.154; TCGA PRAD -0.095; TCGA SARC -0.102
hsa-miR-375
SULF1
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.146; TCGA COAD -0.437; TCGA ESCA -0.187; TCGA HNSC -0.183; TCGA KIRC -0.098; TCGA LUAD -0.146; TCGA LUSC -0.192; TCGA OV -0.336; TCGA PAAD -0.219; TCGA PRAD -0.258; TCGA STAD -0.201
hsa-miR-375
CPNE8
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.073; TCGA BRCA -0.193; TCGA CESC -0.185; TCGA ESCA -0.163; TCGA KIRC -0.105; TCGA LUAD -0.057; TCGA PRAD -0.246; TCGA THCA -0.077; TCGA STAD -0.068; TCGA UCEC -0.212
hsa-miR-375
STON1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.134; TCGA BRCA -0.191; TCGA CESC -0.134; TCGA COAD -0.366; TCGA ESCA -0.205; TCGA HNSC -0.07; TCGA LGG -0.101; TCGA LUAD -0.07; TCGA OV -0.084; TCGA PAAD -0.11; TCGA PRAD -0.069; TCGA SARC -0.088; TCGA THCA -0.076; TCGA UCEC -0.251
hsa-miR-375
ZEB2
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.131; TCGA BRCA -0.142; TCGA CESC -0.098; TCGA COAD -0.259; TCGA HNSC -0.093; TCGA KIRC -0.072; TCGA LUAD -0.079; TCGA OV -0.143; TCGA PRAD -0.345; TCGA SARC -0.107; TCGA THCA -0.051; TCGA STAD -0.077; TCGA UCEC -0.075
hsa-miR-375
ZFPM2
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.191; TCGA BRCA -0.077; TCGA COAD -0.37; TCGA ESCA -0.157; TCGA KIRC -0.072; TCGA LUAD -0.128; TCGA OV -0.194; TCGA PAAD -0.164; TCGA PRAD -0.498; TCGA THCA -0.133; TCGA STAD -0.169; TCGA UCEC -0.2
hsa-miR-375
HOXA3
10 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.216; TCGA HNSC -0.068; TCGA LIHC -0.193; TCGA LUAD -0.165; TCGA LUSC -0.105; TCGA PAAD -0.234; TCGA SARC -0.084; TCGA STAD -0.144; TCGA UCEC -0.17
hsa-miR-375
NOX4
12 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD
miRanda; miRNATAP
TCGA BLCA -0.139; TCGA COAD -0.454; TCGA ESCA -0.215; TCGA HNSC -0.196; TCGA LGG -0.113; TCGA LIHC -0.055; TCGA LUAD -0.123; TCGA LUSC -0.16; TCGA OV -0.184; TCGA PAAD -0.217; TCGA SARC -0.156; TCGA STAD -0.177
hsa-miR-375
FAP
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.163; TCGA CESC -0.122; TCGA COAD -0.413; TCGA ESCA -0.296; TCGA HNSC -0.299; TCGA KIRC -0.112; TCGA LUAD -0.182; TCGA LUSC -0.116; TCGA OV -0.415; TCGA SARC -0.192; TCGA STAD -0.189; TCGA UCEC -0.081
hsa-miR-375
HLA-F
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC
miRanda
TCGA BLCA -0.078; TCGA BRCA -0.127; TCGA HNSC -0.11; TCGA KIRC -0.098; TCGA KIRP -0.061; TCGA LIHC -0.071; TCGA LUAD -0.123; TCGA PAAD -0.137; TCGA PRAD -0.092; TCGA SARC -0.092
hsa-miR-375
CLEC5A
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; STAD
miRanda
TCGA BLCA -0.112; TCGA CESC -0.13; TCGA COAD -0.313; TCGA ESCA -0.175; TCGA HNSC -0.084; TCGA KIRC -0.117; TCGA LUAD -0.19; TCGA OV -0.096; TCGA STAD -0.079
hsa-miR-375
TSHZ3
11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.171; TCGA COAD -0.258; TCGA ESCA -0.203; TCGA HNSC -0.113; TCGA LUAD -0.125; TCGA OV -0.072; TCGA PAAD -0.07; TCGA PRAD -0.297; TCGA SARC -0.078; TCGA THCA -0.098; TCGA STAD -0.134
hsa-miR-375
THBS1
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.151; TCGA CESC -0.104; TCGA COAD -0.239; TCGA ESCA -0.121; TCGA KIRC -0.07; TCGA LUAD -0.093; TCGA OV -0.188; TCGA PAAD -0.12; TCGA PRAD -0.166; TCGA SARC -0.13; TCGA STAD -0.132; TCGA UCEC -0.073
hsa-miR-375
ZEB1
12 cancers: BLCA; COAD; HNSC; KIRC; LGG; LIHC; LUAD; OV; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.132; TCGA COAD -0.32; TCGA HNSC -0.057; TCGA KIRC -0.112; TCGA LGG -0.158; TCGA LIHC -0.055; TCGA LUAD -0.082; TCGA OV -0.138; TCGA PRAD -0.336; TCGA THCA -0.089; TCGA STAD -0.182; TCGA UCEC -0.093
hsa-miR-375
RRN3P2
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.122; TCGA BRCA -0.118; TCGA CESC -0.065; TCGA HNSC -0.053; TCGA KIRC -0.112; TCGA PAAD -0.117; TCGA PRAD -0.212; TCGA SARC -0.103; TCGA STAD -0.063
hsa-miR-375
CPEB1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.13; TCGA BRCA -0.102; TCGA CESC -0.256; TCGA COAD -0.531; TCGA ESCA -0.143; TCGA LUAD -0.104; TCGA PRAD -0.612; TCGA STAD -0.167; TCGA UCEC -0.164
hsa-miR-375
ST3GAL2
12 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.06; TCGA BRCA -0.094; TCGA HNSC -0.123; TCGA KIRC -0.055; TCGA LIHC -0.056; TCGA LUAD -0.055; TCGA OV -0.073; TCGA PAAD -0.053; TCGA PRAD -0.197; TCGA THCA -0.076; TCGA STAD -0.11; TCGA UCEC -0.101
hsa-miR-375
MCTP1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; OV; SARC; UCEC
miRanda
TCGA BLCA -0.088; TCGA BRCA -0.088; TCGA COAD -0.258; TCGA ESCA -0.064; TCGA HNSC -0.08; TCGA LUAD -0.089; TCGA OV -0.151; TCGA SARC -0.076; TCGA UCEC -0.129
hsa-miR-375
COL8A1
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.136; TCGA COAD -0.418; TCGA ESCA -0.161; TCGA HNSC -0.154; TCGA KIRC -0.15; TCGA LUAD -0.093; TCGA OV -0.308; TCGA PAAD -0.21; TCGA PRAD -0.197; TCGA STAD -0.224; TCGA UCEC -0.089
hsa-miR-375
CYP7B1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.074; TCGA BRCA -0.187; TCGA CESC -0.231; TCGA COAD -0.426; TCGA ESCA -0.077; TCGA LIHC -0.139; TCGA PRAD -0.15; TCGA THCA -0.19; TCGA STAD -0.087; TCGA UCEC -0.078
hsa-miR-375
CNRIP1
10 cancers: BLCA; BRCA; COAD; KIRC; LUAD; OV; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.138; TCGA BRCA -0.112; TCGA COAD -0.265; TCGA KIRC -0.101; TCGA LUAD -0.052; TCGA OV -0.114; TCGA PRAD -0.306; TCGA THCA -0.052; TCGA STAD -0.083; TCGA UCEC -0.062
hsa-miR-375
SNAI2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.16; TCGA BRCA -0.148; TCGA CESC -0.406; TCGA COAD -0.243; TCGA ESCA -0.415; TCGA HNSC -0.177; TCGA LGG -0.096; TCGA LIHC -0.209; TCGA LUAD -0.276; TCGA LUSC -0.27; TCGA OV -0.194; TCGA PAAD -0.136; TCGA PRAD -0.444; TCGA STAD -0.069; TCGA UCEC -0.056
hsa-miR-375
HTR7
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD
miRanda
TCGA BLCA -0.342; TCGA BRCA -0.076; TCGA CESC -0.431; TCGA COAD -0.174; TCGA ESCA -0.36; TCGA HNSC -0.242; TCGA KIRC -0.107; TCGA LUAD -0.22; TCGA LUSC -0.236; TCGA OV -0.159; TCGA PRAD -0.225
hsa-miR-375
SDC2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.067; TCGA BRCA -0.136; TCGA COAD -0.265; TCGA ESCA -0.065; TCGA HNSC -0.095; TCGA LIHC -0.052; TCGA PRAD -0.201; TCGA THCA -0.056; TCGA STAD -0.083; TCGA UCEC -0.099
hsa-miR-375
ADARB1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; STAD; UCEC
miRanda
TCGA BLCA -0.105; TCGA BRCA -0.082; TCGA CESC -0.062; TCGA COAD -0.136; TCGA ESCA -0.071; TCGA HNSC -0.061; TCGA KIRC -0.075; TCGA LUAD -0.075; TCGA STAD -0.139; TCGA UCEC -0.085
hsa-miR-375
PPP1R12B
10 cancers: BLCA; BRCA; CESC; COAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.112; TCGA BRCA -0.095; TCGA CESC -0.082; TCGA COAD -0.199; TCGA OV -0.076; TCGA PRAD -0.436; TCGA SARC -0.221; TCGA THCA -0.101; TCGA STAD -0.198; TCGA UCEC -0.092
hsa-miR-375
PRKD1
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.142; TCGA BRCA -0.106; TCGA COAD -0.396; TCGA ESCA -0.147; TCGA LGG -0.109; TCGA LIHC -0.067; TCGA SARC -0.098; TCGA THCA -0.087; TCGA STAD -0.105; TCGA UCEC -0.112
hsa-miR-375
IGFBP4
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; OV; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.196; TCGA CESC -0.077; TCGA COAD -0.161; TCGA ESCA -0.071; TCGA KIRC -0.071; TCGA LGG -0.109; TCGA LUAD -0.073; TCGA OV -0.103; TCGA PRAD -0.311; TCGA SARC -0.117; TCGA STAD -0.115
hsa-miR-375
FOXC1
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.074; TCGA BRCA -0.392; TCGA COAD -0.249; TCGA ESCA -0.055; TCGA LUAD -0.197; TCGA PAAD -0.123; TCGA PRAD -0.262; TCGA THCA -0.122; TCGA STAD -0.095
hsa-miR-375
CLEC2B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.105; TCGA CESC -0.345; TCGA COAD -0.157; TCGA ESCA -0.258; TCGA HNSC -0.131; TCGA KIRC -0.098; TCGA LUAD -0.192; TCGA OV -0.116; TCGA PAAD -0.131; TCGA PRAD -0.201; TCGA SARC -0.154; TCGA STAD -0.065
hsa-miR-375
STX11
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.193; TCGA CESC -0.238; TCGA COAD -0.149; TCGA ESCA -0.151; TCGA LUAD -0.114; TCGA OV -0.092; TCGA PAAD -0.079; TCGA PRAD -0.19; TCGA THCA -0.102; TCGA STAD -0.051; TCGA UCEC -0.063
hsa-miR-375
NPL
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA
miRanda
TCGA BLCA -0.051; TCGA BRCA -0.058; TCGA CESC -0.195; TCGA COAD -0.146; TCGA ESCA -0.152; TCGA LIHC -0.117; TCGA LUAD -0.056; TCGA LUSC -0.104; TCGA OV -0.054; TCGA PAAD -0.083; TCGA PRAD -0.228; TCGA THCA -0.059
hsa-miR-375
FAM180A
9 cancers: BLCA; BRCA; COAD; LGG; LUAD; OV; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.189; TCGA BRCA -0.134; TCGA COAD -0.476; TCGA LGG -0.115; TCGA LUAD -0.09; TCGA OV -0.283; TCGA SARC -0.227; TCGA STAD -0.116; TCGA UCEC -0.116
hsa-miR-375
PXDN
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.095; TCGA BRCA -0.08; TCGA COAD -0.216; TCGA ESCA -0.121; TCGA HNSC -0.189; TCGA KIRC -0.114; TCGA KIRP -0.099; TCGA LGG -0.181; TCGA LUAD -0.172; TCGA PAAD -0.153; TCGA STAD -0.072; TCGA UCEC -0.161
hsa-miR-375
FBN1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.149; TCGA BRCA -0.081; TCGA COAD -0.364; TCGA ESCA -0.116; TCGA HNSC -0.119; TCGA KIRC -0.058; TCGA LUAD -0.131; TCGA OV -0.215; TCGA PAAD -0.117; TCGA PRAD -0.313; TCGA THCA -0.12; TCGA STAD -0.129; TCGA UCEC -0.078
hsa-miR-375
MBNL1
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.056; TCGA BRCA -0.086; TCGA CESC -0.055; TCGA ESCA -0.081; TCGA KIRC -0.053; TCGA LUAD -0.051; TCGA PAAD -0.059; TCGA PRAD -0.172; TCGA SARC -0.091; TCGA STAD -0.089
hsa-miR-375
LST1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC
miRNATAP
TCGA BLCA -0.154; TCGA BRCA -0.058; TCGA CESC -0.137; TCGA COAD -0.151; TCGA ESCA -0.088; TCGA HNSC -0.08; TCGA KIRC -0.097; TCGA LUAD -0.097; TCGA OV -0.092; TCGA PAAD -0.087; TCGA PRAD -0.111; TCGA SARC -0.113
hsa-miR-375
UST
11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LIHC; LUSC; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.125; TCGA CESC -0.087; TCGA ESCA -0.158; TCGA LGG -0.156; TCGA LIHC -0.176; TCGA LUSC -0.085; TCGA PAAD -0.114; TCGA PRAD -0.247; TCGA THCA -0.073; TCGA UCEC -0.256
hsa-miR-375
SPOCK1
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD
miRNATAP
TCGA BLCA -0.178; TCGA COAD -0.64; TCGA ESCA -0.301; TCGA HNSC -0.136; TCGA LUAD -0.295; TCGA LUSC -0.258; TCGA OV -0.13; TCGA PAAD -0.254; TCGA STAD -0.267
hsa-miR-375
SVIL
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.069; TCGA BRCA -0.129; TCGA CESC -0.093; TCGA COAD -0.161; TCGA ESCA -0.147; TCGA LUAD -0.082; TCGA PAAD -0.091; TCGA PRAD -0.392; TCGA SARC -0.095; TCGA STAD -0.234; TCGA UCEC -0.128
hsa-miR-375
SCN2B
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.157; TCGA CESC -0.184; TCGA COAD -0.623; TCGA ESCA -0.154; TCGA OV -0.148; TCGA PRAD -0.598; TCGA STAD -0.173; TCGA UCEC -0.293
hsa-miR-375
RGS16
10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; OV; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.076; TCGA COAD -0.115; TCGA ESCA -0.088; TCGA HNSC -0.056; TCGA LIHC -0.112; TCGA LUAD -0.063; TCGA OV -0.09; TCGA PRAD -0.355; TCGA THCA -0.228; TCGA STAD -0.067
hsa-miR-375
BNC2
11 cancers: BLCA; BRCA; COAD; ESCA; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.215; TCGA BRCA -0.086; TCGA COAD -0.455; TCGA ESCA -0.173; TCGA LUAD -0.168; TCGA OV -0.206; TCGA PAAD -0.172; TCGA PRAD -0.447; TCGA SARC -0.067; TCGA STAD -0.19; TCGA UCEC -0.234
hsa-miR-375
CALU
10 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.055; TCGA COAD -0.099; TCGA ESCA -0.066; TCGA HNSC -0.093; TCGA LUAD -0.111; TCGA LUSC -0.082; TCGA PAAD -0.131; TCGA SARC -0.069; TCGA STAD -0.07; TCGA UCEC -0.058
hsa-miR-375
CCDC88A
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; OV; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.145; TCGA CESC -0.086; TCGA COAD -0.204; TCGA ESCA -0.076; TCGA HNSC -0.092; TCGA KIRC -0.109; TCGA LGG -0.063; TCGA LIHC -0.052; TCGA LUAD -0.081; TCGA OV -0.064; TCGA PRAD -0.319; TCGA THCA -0.071; TCGA STAD -0.108; TCGA UCEC -0.107
hsa-miR-375
CLDN1
11 cancers: BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.157; TCGA CESC -0.405; TCGA COAD -0.202; TCGA ESCA -0.214; TCGA LUAD -0.235; TCGA LUSC -0.225; TCGA OV -0.175; TCGA PAAD -0.101; TCGA PRAD -0.403; TCGA STAD -0.11; TCGA UCEC -0.308
hsa-miR-375
CORO1C
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.123; TCGA CESC -0.066; TCGA COAD -0.069; TCGA ESCA -0.13; TCGA HNSC -0.056; TCGA KIRC -0.066; TCGA LGG -0.138; TCGA LUAD -0.123; TCGA LUSC -0.061; TCGA PAAD -0.115; TCGA PRAD -0.285; TCGA SARC -0.066; TCGA STAD -0.106; TCGA UCEC -0.06
hsa-miR-375
IGFBP3
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.125; TCGA COAD -0.167; TCGA ESCA -0.089; TCGA HNSC -0.094; TCGA KIRC -0.229; TCGA LUAD -0.106; TCGA LUSC -0.226; TCGA PAAD -0.212; TCGA PRAD -0.19; TCGA UCEC -0.059
hsa-miR-375
IL1RAP
10 cancers: BRCA; CESC; ESCA; KIRC; LUAD; LUSC; OV; PAAD; PRAD; UCEC
miRNAWalker2 validate; miRanda
TCGA BRCA -0.112; TCGA CESC -0.202; TCGA ESCA -0.23; TCGA KIRC -0.077; TCGA LUAD -0.143; TCGA LUSC -0.12; TCGA OV -0.089; TCGA PAAD -0.204; TCGA PRAD -0.062; TCGA UCEC -0.106
hsa-miR-375
ITGB1
9 cancers: BRCA; COAD; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BRCA -0.063; TCGA COAD -0.094; TCGA HNSC -0.081; TCGA KIRC -0.055; TCGA LUAD -0.105; TCGA PAAD -0.084; TCGA PRAD -0.167; TCGA SARC -0.084; TCGA STAD -0.143
hsa-miR-375
MYBL1
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.057; TCGA COAD -0.138; TCGA ESCA -0.061; TCGA HNSC -0.098; TCGA KIRC -0.071; TCGA PAAD -0.089; TCGA PRAD -0.188; TCGA STAD -0.105; TCGA UCEC -0.061
hsa-miR-375
RRAGC
9 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUAD; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA BRCA -0.081; TCGA CESC -0.119; TCGA COAD -0.058; TCGA ESCA -0.059; TCGA LIHC -0.062; TCGA LUAD -0.094; TCGA PRAD -0.089; TCGA SARC -0.064; TCGA UCEC -0.104
hsa-miR-375
TGFB2
10 cancers: BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.118; TCGA CESC -0.113; TCGA COAD -0.202; TCGA ESCA -0.135; TCGA LUAD -0.2; TCGA OV -0.186; TCGA PAAD -0.155; TCGA PRAD -0.261; TCGA STAD -0.096; TCGA UCEC -0.075
hsa-miR-375
TTC7B
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate; miRanda
TCGA BRCA -0.094; TCGA CESC -0.103; TCGA COAD -0.258; TCGA ESCA -0.19; TCGA HNSC -0.083; TCGA LUAD -0.061; TCGA LUSC -0.077; TCGA THCA -0.107; TCGA STAD -0.114; TCGA UCEC -0.1
hsa-miR-375
USP31
9 cancers: BRCA; CESC; COAD; ESCA; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.07; TCGA CESC -0.124; TCGA COAD -0.054; TCGA ESCA -0.137; TCGA LUSC -0.127; TCGA PRAD -0.087; TCGA SARC -0.054; TCGA STAD -0.067; TCGA UCEC -0.074
hsa-miR-375
ARL4C
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.178; TCGA CESC -0.067; TCGA COAD -0.234; TCGA ESCA -0.231; TCGA HNSC -0.11; TCGA LUSC -0.067; TCGA PAAD -0.239; TCGA PRAD -0.24; TCGA STAD -0.091; TCGA UCEC -0.062
hsa-miR-375
YEATS2
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.079; TCGA CESC -0.071; TCGA ESCA -0.137; TCGA HNSC -0.079; TCGA KIRC -0.089; TCGA LGG -0.07; TCGA LUAD -0.078; TCGA LUSC -0.167; TCGA PAAD -0.066; TCGA STAD -0.067; TCGA UCEC -0.069
hsa-miR-375
MICAL3
10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; OV; PRAD; STAD
miRanda
TCGA BRCA -0.118; TCGA CESC -0.057; TCGA ESCA -0.1; TCGA KIRC -0.075; TCGA KIRP -0.093; TCGA LUAD -0.131; TCGA LUSC -0.13; TCGA OV -0.06; TCGA PRAD -0.062; TCGA STAD -0.09
hsa-miR-375
ZFHX4
13 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.086; TCGA COAD -0.524; TCGA ESCA -0.243; TCGA HNSC -0.093; TCGA LGG -0.065; TCGA LUAD -0.124; TCGA LUSC -0.156; TCGA OV -0.23; TCGA PAAD -0.131; TCGA PRAD -0.296; TCGA THCA -0.189; TCGA STAD -0.175; TCGA UCEC -0.22
hsa-miR-375
EBF3
9 cancers: BRCA; COAD; KIRC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.16; TCGA COAD -0.359; TCGA KIRC -0.195; TCGA LUAD -0.118; TCGA LUSC -0.188; TCGA PRAD -0.139; TCGA THCA -0.125; TCGA STAD -0.063; TCGA UCEC -0.096
hsa-miR-375
CHODL
10 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.478; TCGA CESC -0.178; TCGA COAD -0.261; TCGA ESCA -0.505; TCGA LIHC -0.078; TCGA LUAD -0.197; TCGA LUSC -0.303; TCGA PRAD -0.248; TCGA STAD -0.162; TCGA UCEC -0.09
hsa-miR-375
QKI
12 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.164; TCGA CESC -0.109; TCGA COAD -0.252; TCGA ESCA -0.164; TCGA KIRC -0.065; TCGA LGG -0.074; TCGA LUAD -0.092; TCGA OV -0.062; TCGA PAAD -0.072; TCGA PRAD -0.167; TCGA STAD -0.104; TCGA UCEC -0.106
hsa-miR-375
BCL11B
9 cancers: BRCA; CESC; ESCA; KIRC; LUSC; OV; PAAD; PRAD; THCA
miRanda
TCGA BRCA -0.165; TCGA CESC -0.233; TCGA ESCA -0.175; TCGA KIRC -0.081; TCGA LUSC -0.181; TCGA OV -0.093; TCGA PAAD -0.108; TCGA PRAD -0.303; TCGA THCA -0.187
hsa-miR-375
P2RX7
10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; OV; PRAD; STAD
miRanda
TCGA BRCA -0.069; TCGA CESC -0.249; TCGA COAD -0.287; TCGA ESCA -0.182; TCGA KIRC -0.223; TCGA LGG -0.109; TCGA LUAD -0.163; TCGA OV -0.069; TCGA PRAD -0.364; TCGA STAD -0.137
hsa-miR-375
MMD
10 cancers: BRCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.159; TCGA COAD -0.099; TCGA ESCA -0.099; TCGA HNSC -0.091; TCGA LUAD -0.18; TCGA PAAD -0.123; TCGA PRAD -0.183; TCGA THCA -0.133; TCGA STAD -0.134; TCGA UCEC -0.103
hsa-miR-375
TMEFF1
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BRCA -0.109; TCGA COAD -0.183; TCGA ESCA -0.166; TCGA HNSC -0.121; TCGA KIRC -0.056; TCGA LUAD -0.109; TCGA LUSC -0.068; TCGA PAAD -0.069; TCGA PRAD -0.104; TCGA UCEC -0.168
hsa-miR-375
ADCY3
10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.121; TCGA CESC -0.082; TCGA COAD -0.101; TCGA ESCA -0.124; TCGA KIRC -0.056; TCGA LUAD -0.089; TCGA LUSC -0.123; TCGA PRAD -0.231; TCGA STAD -0.068; TCGA UCEC -0.136
hsa-miR-375
EGFR
9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BRCA -0.425; TCGA CESC -0.222; TCGA ESCA -0.19; TCGA KIRC -0.117; TCGA LGG -0.169; TCGA LUAD -0.182; TCGA LUSC -0.199; TCGA PAAD -0.108; TCGA PRAD -0.234
hsa-miR-375
BEND6
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.127; TCGA CESC -0.162; TCGA COAD -0.437; TCGA ESCA -0.376; TCGA HNSC -0.175; TCGA LUAD -0.333; TCGA LUSC -0.131; TCGA OV -0.099; TCGA PRAD -0.248; TCGA SARC -0.124; TCGA STAD -0.123; TCGA UCEC -0.211
hsa-miR-375
APLF
11 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.155; TCGA CESC -0.087; TCGA COAD -0.165; TCGA ESCA -0.125; TCGA KIRC -0.052; TCGA LUAD -0.058; TCGA LUSC -0.079; TCGA PAAD -0.064; TCGA PRAD -0.286; TCGA STAD -0.076; TCGA UCEC -0.085
hsa-miR-375
GAP43
10 cancers: BRCA; COAD; ESCA; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.128; TCGA COAD -0.591; TCGA ESCA -0.29; TCGA LUAD -0.197; TCGA LUSC -0.193; TCGA OV -0.167; TCGA PRAD -0.138; TCGA SARC -0.209; TCGA STAD -0.23; TCGA UCEC -0.12
hsa-miR-375
KLF7
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; UCEC
miRNATAP
TCGA BRCA -0.078; TCGA CESC -0.086; TCGA COAD -0.233; TCGA ESCA -0.206; TCGA HNSC -0.091; TCGA KIRC -0.074; TCGA PAAD -0.127; TCGA PRAD -0.253; TCGA SARC -0.07; TCGA UCEC -0.071
hsa-miR-375
HAS2
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; OV; PRAD
miRNATAP
TCGA BRCA -0.23; TCGA CESC -0.248; TCGA COAD -0.215; TCGA ESCA -0.161; TCGA HNSC -0.139; TCGA LGG -0.173; TCGA LUAD -0.198; TCGA OV -0.235; TCGA PRAD -0.324
hsa-miR-375
KLF12
9 cancers: BRCA; ESCA; LGG; LIHC; LUAD; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.07; TCGA ESCA -0.084; TCGA LGG -0.106; TCGA LIHC -0.061; TCGA LUAD -0.09; TCGA OV -0.07; TCGA PRAD -0.256; TCGA STAD -0.068; TCGA UCEC -0.131
hsa-miR-375
BVES
10 cancers: BRCA; COAD; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.132; TCGA COAD -0.37; TCGA ESCA -0.18; TCGA HNSC -0.076; TCGA LUAD -0.137; TCGA PRAD -0.329; TCGA SARC -0.11; TCGA THCA -0.229; TCGA STAD -0.188; TCGA UCEC -0.138
hsa-miR-375
SEMA5B
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; PRAD; STAD
miRNATAP
TCGA BRCA -0.069; TCGA CESC -0.078; TCGA COAD -0.168; TCGA ESCA -0.131; TCGA HNSC -0.126; TCGA KIRC -0.275; TCGA LGG -0.106; TCGA PRAD -0.077; TCGA STAD -0.06
hsa-miR-375
BACH2
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; PRAD; UCEC
miRNATAP
TCGA BRCA -0.204; TCGA CESC -0.094; TCGA COAD -0.182; TCGA ESCA -0.193; TCGA HNSC -0.055; TCGA LGG -0.068; TCGA LUAD -0.124; TCGA PRAD -0.292; TCGA UCEC -0.162
hsa-miR-375
ENAH
10 cancers: CESC; COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate; miRNATAP
TCGA CESC -0.054; TCGA COAD -0.092; TCGA ESCA -0.125; TCGA HNSC -0.065; TCGA KIRP -0.055; TCGA LGG -0.102; TCGA LUSC -0.072; TCGA PAAD -0.082; TCGA PRAD -0.181; TCGA STAD -0.091
hsa-miR-375
SLC38A2
10 cancers: CESC; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC
miRanda
TCGA CESC -0.118; TCGA ESCA -0.139; TCGA LGG -0.05; TCGA LIHC -0.059; TCGA LUAD -0.06; TCGA LUSC -0.071; TCGA OV -0.052; TCGA PAAD -0.054; TCGA PRAD -0.054; TCGA UCEC -0.091
hsa-miR-375
IFIT2
10 cancers: CESC; COAD; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA CESC -0.117; TCGA COAD -0.189; TCGA ESCA -0.085; TCGA HNSC -0.155; TCGA LGG -0.053; TCGA LUAD -0.19; TCGA PAAD -0.102; TCGA PRAD -0.25; TCGA STAD -0.109; TCGA UCEC -0.123
hsa-miR-375
TRIM9
10 cancers: CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PRAD; THCA; UCEC
miRanda
TCGA CESC -0.159; TCGA COAD -0.332; TCGA ESCA -0.244; TCGA HNSC -0.097; TCGA KIRC -0.138; TCGA LGG -0.158; TCGA LUSC -0.207; TCGA PRAD -0.614; TCGA THCA -0.128; TCGA UCEC -0.148
hsa-miR-375
KCNQ5
10 cancers: CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRanda
TCGA CESC -0.33; TCGA COAD -0.266; TCGA ESCA -0.536; TCGA KIRC -0.083; TCGA LUAD -0.158; TCGA LUSC -0.192; TCGA OV -0.297; TCGA PRAD -0.468; TCGA STAD -0.183; TCGA UCEC -0.107
hsa-miR-375
TMEM26
9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; THCA
miRNATAP
TCGA CESC -0.066; TCGA COAD -0.154; TCGA ESCA -0.075; TCGA HNSC -0.201; TCGA KIRC -0.064; TCGA LUAD -0.092; TCGA OV -0.145; TCGA PAAD -0.177; TCGA THCA -0.113
hsa-miR-375
KIAA1524
9 cancers: ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; THCA; UCEC
miRNAWalker2 validate
TCGA ESCA -0.083; TCGA HNSC -0.092; TCGA KIRC -0.072; TCGA LGG -0.058; TCGA LUAD -0.169; TCGA LUSC -0.192; TCGA PAAD -0.116; TCGA THCA -0.057; TCGA UCEC -0.103





Enriched cancer pathways of putative targets