microRNA information: hsa-miR-376a-5p

SectionIDlink
Mature name: hsa-miR-376a-5pmiRbase
Accession: MIMAT0003386miRbase
Precursor name: hsa-mir-376a-1 miRbase
Precursor accession: MI0000784miRbase
Symbol: MIR376A1HGNC
RefSeq ID: NR_029868GenBank
Sequence: GUAGAUUCUCCUUCUAUGAGUA



Reported expression in cancers: hsa-miR-376a-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-376a-5p

colorectal cancerdownregulation"Expression and clinical significance of microRNA 3 ......"25422250qPCR
hsa-miR-376a-5p

esophageal cancerderegulation"Differentially-expressed miRNAs were analyzed usin ......"23534712Reverse transcription PCR
hsa-miR-376a-5p

esophageal cancerderegulation"Specifically miR-141 and miR-200b were upregulated ......"25175076
hsa-miR-376a-5p

liver cancerdownregulation"miR 376a suppresses proliferation and induces apop ......"22684007
hsa-miR-376a-5p

liver cancerdownregulation"MiR 376a and histone deacetylation 9 form a regula ......"25613642
hsa-miR-376a-5p

melanomaupregulation"Silencing of a large microRNA cluster on human chr ......"22747855
hsa-miR-376a-5p

retinoblastomadownregulation"Most of these aberrantly expressed miRNAs were con ......"23373993qPCR



Reported cancer pathway affected by hsa-miR-376a-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-376a-5p

liver cancerApoptosis pathway"miR 376a suppresses proliferation and induces apop ......"22684007
hsa-miR-376a-5p

prostate cancerApoptosis pathway"MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......"24166498
hsa-miR-376a-5p

retinoblastomaApoptosis pathway"Arsenic trioxide induced apoptosis in retinoblasto ......"23373993Luciferase



Reported cancer prognosis affected by hsa-miR-376a-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-376a-5p

colorectal cancerstaging; metastasis; poor survival"Expression and clinical significance of microRNA 3 ......"25422250
hsa-miR-376a-5p

liver cancerrecurrence"Sequencing and bioinformatics based analyses of th ......"21283620
hsa-miR-376a-5p

lung cancermalignant trasformation"Here we sought to comprehensively identify the miR ......"20237410
hsa-miR-376a-5p

lung cancercell migration; poor survival"An independent cohort of 60 lung ACs was used for ......"24833665
hsa-miR-376a-5p

melanomametastasis; tumorigenesis"Silencing of a large microRNA cluster on human chr ......"22747855Luciferase
hsa-miR-376a-5p

ovarian cancerstaging"Diagnostic and prognostic potential of serum miR 7 ......"26393886



Reported gene related to hsa-miR-376a-5p

miRNAcancergenereportingPUBMED
hsa-miR-376a-5p

liver cancerAFP"We discovered that miR-376a was frequently down-re ......"22684007
hsa-miR-376a-5p

retinoblastomaCASP3"Using bioinformatic algorithms caspase-3 a key apo ......"23373993
hsa-miR-376a-5p

liver cancerHDAC9"Interestingly HDAC9 a histone deacetylase responsi ......"25613642
hsa-miR-376a-5p

melanomaIGF1R"Our results suggest that down-regulation of mir-37 ......"22747855
hsa-miR-376a-5p

liver cancerPIK3R1"Additionally p85α PIK3R1 was identified as a dire ......"22684007
hsa-miR-376a-5p

colorectal cancerVEGFA"VEGF IHC positivity was significantly more common ......"25422250



Expression profile in cancer corhorts: