microRNA information: hsa-miR-376a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-376a-5p | miRbase |
Accession: | MIMAT0003386 | miRbase |
Precursor name: | hsa-mir-376a-1 | miRbase |
Precursor accession: | MI0000784 | miRbase |
Symbol: | MIR376A1 | HGNC |
RefSeq ID: | NR_029868 | GenBank |
Sequence: | GUAGAUUCUCCUUCUAUGAGUA |
Reported expression in cancers: hsa-miR-376a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-376a-5p | colorectal cancer | downregulation | "Expression and clinical significance of microRNA 3 ......" | 25422250 | qPCR |
hsa-miR-376a-5p | esophageal cancer | deregulation | "Differentially-expressed miRNAs were analyzed usin ......" | 23534712 | Reverse transcription PCR |
hsa-miR-376a-5p | esophageal cancer | deregulation | "Specifically miR-141 and miR-200b were upregulated ......" | 25175076 | |
hsa-miR-376a-5p | liver cancer | downregulation | "miR 376a suppresses proliferation and induces apop ......" | 22684007 | |
hsa-miR-376a-5p | liver cancer | downregulation | "MiR 376a and histone deacetylation 9 form a regula ......" | 25613642 | |
hsa-miR-376a-5p | melanoma | upregulation | "Silencing of a large microRNA cluster on human chr ......" | 22747855 | |
hsa-miR-376a-5p | retinoblastoma | downregulation | "Most of these aberrantly expressed miRNAs were con ......" | 23373993 | qPCR |
Reported cancer pathway affected by hsa-miR-376a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-376a-5p | liver cancer | Apoptosis pathway | "miR 376a suppresses proliferation and induces apop ......" | 22684007 | |
hsa-miR-376a-5p | prostate cancer | Apoptosis pathway | "MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......" | 24166498 | |
hsa-miR-376a-5p | retinoblastoma | Apoptosis pathway | "Arsenic trioxide induced apoptosis in retinoblasto ......" | 23373993 | Luciferase |
Reported cancer prognosis affected by hsa-miR-376a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-376a-5p | colorectal cancer | staging; metastasis; poor survival | "Expression and clinical significance of microRNA 3 ......" | 25422250 | |
hsa-miR-376a-5p | liver cancer | recurrence | "Sequencing and bioinformatics based analyses of th ......" | 21283620 | |
hsa-miR-376a-5p | lung cancer | malignant trasformation | "Here we sought to comprehensively identify the miR ......" | 20237410 | |
hsa-miR-376a-5p | lung cancer | cell migration; poor survival | "An independent cohort of 60 lung ACs was used for ......" | 24833665 | |
hsa-miR-376a-5p | melanoma | metastasis; tumorigenesis | "Silencing of a large microRNA cluster on human chr ......" | 22747855 | Luciferase |
hsa-miR-376a-5p | ovarian cancer | staging | "Diagnostic and prognostic potential of serum miR 7 ......" | 26393886 |
Reported gene related to hsa-miR-376a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-376a-5p | liver cancer | AFP | "We discovered that miR-376a was frequently down-re ......" | 22684007 |
hsa-miR-376a-5p | retinoblastoma | CASP3 | "Using bioinformatic algorithms caspase-3 a key apo ......" | 23373993 |
hsa-miR-376a-5p | liver cancer | HDAC9 | "Interestingly HDAC9 a histone deacetylase responsi ......" | 25613642 |
hsa-miR-376a-5p | melanoma | IGF1R | "Our results suggest that down-regulation of mir-37 ......" | 22747855 |
hsa-miR-376a-5p | liver cancer | PIK3R1 | "Additionally p85α PIK3R1 was identified as a dire ......" | 22684007 |
hsa-miR-376a-5p | colorectal cancer | VEGFA | "VEGF IHC positivity was significantly more common ......" | 25422250 |
Expression profile in cancer corhorts: