microRNA information: hsa-miR-376b-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-376b-3p | miRbase |
Accession: | MIMAT0002172 | miRbase |
Precursor name: | hsa-mir-376b | miRbase |
Precursor accession: | MI0002466 | miRbase |
Symbol: | MIR376B | HGNC |
RefSeq ID: | NR_030157 | GenBank |
Sequence: | AUCAUAGAGGAAAAUCCAUGUU |
Reported expression in cancers: hsa-miR-376b-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-376b-3p | NA | NA | "NA ......" | NA | NA |
hsa-miR-376b-3p | " ......" |
Reported cancer pathway affected by hsa-miR-376b-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-376b-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-376b-3p | liver cancer | recurrence | "Sequencing and bioinformatics based analyses of th ......" | 21283620 |
Reported gene related to hsa-miR-376b-3p
miRNA | cancer | gene | reporting | PUBMED |
---|
Expression profile in cancer corhorts: