microRNA information: hsa-miR-377-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-377-3p | miRbase |
Accession: | MIMAT0000730 | miRbase |
Precursor name: | hsa-mir-377 | miRbase |
Precursor accession: | MI0000785 | miRbase |
Symbol: | MIR377 | HGNC |
RefSeq ID: | NR_029869 | GenBank |
Sequence: | AUCACACAAAGGCAACUUUUGU |
Reported expression in cancers: hsa-miR-377-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-377-3p | gastric cancer | upregulation | "MicroRNA 377 predicts poor clinical outcome of gas ......" | 25998046 | qPCR |
hsa-miR-377-3p | glioblastoma | downregulation | "Here we identified a novel tumor suppressive miRN ......" | 24951112 | Reverse transcription PCR; qPCR |
hsa-miR-377-3p | liver cancer | downregulation | "Here we identified a novel tumor suppressive miRNA ......" | 25739101 | Reverse transcription PCR; qPCR |
hsa-miR-377-3p | lung cancer | deregulation | "Microarray studies revealed alterations in the exp ......" | 19748927 | Microarray; Reverse transcription PCR |
hsa-miR-377-3p | melanoma | upregulation | "miR-377 one of the miRNAs located within this clus ......" | 25889255 | |
hsa-miR-377-3p | pancreatic cancer | downregulation | "MiR-377 has been implicated in many types of cance ......" | 27638830 |
Reported cancer pathway affected by hsa-miR-377-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-377-3p | glioblastoma | cell cycle pathway | "MicroRNA 377 inhibited proliferation and invasion ......" | 24951112 | Western blot; Luciferase |
hsa-miR-377-3p | kidney renal cell cancer | cell cycle pathway | "miR 377 functions as a tumor suppressor in human c ......" | 25776481 | Luciferase |
hsa-miR-377-3p | melanoma | cell cycle pathway; MAPK signaling pathway | "MiR 377 targets E2F3 and alters the NF kB signalin ......" | 25889255 | Western blot; Luciferase; Colony formation |
hsa-miR-377-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "MiR 377 inhibits the proliferation of pancreatic c ......" | 27638830 | Luciferase |
hsa-miR-377-3p | prostate cancer | Apoptosis pathway | "MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......" | 24166498 | |
hsa-miR-377-3p | sarcoma | Apoptosis pathway | "microRNA 377 suppresses the proliferation of human ......" | 25577249 |
Reported cancer prognosis affected by hsa-miR-377-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-377-3p | acute myeloid leukemia | staging | "At least 15 miRNAs to be differentially expressed ......" | 25502508 | |
hsa-miR-377-3p | gastric cancer | tumorigenesis; staging; metastasis; recurrence; poor survival; worse prognosis | "MicroRNA 377 predicts poor clinical outcome of gas ......" | 25998046 | MTT assay |
hsa-miR-377-3p | glioblastoma | progression | "MicroRNA 377 inhibited proliferation and invasion ......" | 24951112 | Western blot; Luciferase |
hsa-miR-377-3p | liver cancer | metastasis | "MicroRNA 377 suppresses cell proliferation and inv ......" | 25739101 | Western blot; Luciferase |
hsa-miR-377-3p | lung squamous cell cancer | progression | "Long non coding RNA NEAT1 promotes non small cell ......" | 27351135 | RNA pull-down; Luciferase |
hsa-miR-377-3p | melanoma | malignant trasformation; progression | "MiR 377 targets E2F3 and alters the NF kB signalin ......" | 25889255 | Western blot; Luciferase; Colony formation |
hsa-miR-377-3p | pancreatic cancer | metastasis | "MiR 377 inhibits the proliferation of pancreatic c ......" | 27638830 | Luciferase |
Reported gene related to hsa-miR-377-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-377-3p | lung squamous cell cancer | E2F3 | "Long non coding RNA NEAT1 promotes non small cell ......" | 27351135 |
hsa-miR-377-3p | melanoma | E2F3 | "E2F3 a potent transcriptional inducer of cell-cycl ......" | 25889255 |
hsa-miR-377-3p | sarcoma | CDK6 | "microRNA 377 suppresses the proliferation of human ......" | 25577249 |
hsa-miR-377-3p | kidney renal cell cancer | ETS1 | "miR 377 functions as a tumor suppressor in human c ......" | 25776481 |
hsa-miR-377-3p | acute myeloid leukemia | FUT1 | "At least 15 miRNAs to be differentially expressed ......" | 25502508 |
hsa-miR-377-3p | prostate cancer | FZD4 | "Finally we identified FZD4 a gene important for ep ......" | 24166498 |
hsa-miR-377-3p | melanoma | MAP3K7 | "MAP3K7 known as TAK1 a serine/threonine kinase alo ......" | 25889255 |
hsa-miR-377-3p | melanoma | MARK2 | "MAP3K7 known as TAK1 a serine/threonine kinase alo ......" | 25889255 |
hsa-miR-377-3p | lung squamous cell cancer | MTDH | "MicroRNA 377 inhibits non small cell lung cancer t ......" | 26823698 |
hsa-miR-377-3p | lung squamous cell cancer | NEAT1 | "Long non coding RNA NEAT1 promotes non small cell ......" | 27351135 |
hsa-miR-377-3p | pancreatic cancer | PIM1 | "MiR 377 inhibits the proliferation of pancreatic c ......" | 27638830 |
hsa-miR-377-3p | pancreatic cancer | PIM3 | "MiR 377 inhibits the proliferation of pancreatic c ......" | 27638830 |
hsa-miR-377-3p | glioblastoma | SP1 | "MicroRNA 377 inhibited proliferation and invasion ......" | 24951112 |
hsa-miR-377-3p | liver cancer | TIAM1 | "MicroRNA 377 suppresses cell proliferation and inv ......" | 25739101 |
Expression profile in cancer corhorts: