microRNA information: hsa-miR-378a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-378a-3p | miRbase |
| Accession: | MIMAT0000732 | miRbase |
| Precursor name: | hsa-mir-378a | miRbase |
| Precursor accession: | MI0000786 | miRbase |
| Symbol: | NA | HGNC |
| RefSeq ID: | NA | GenBank |
| Sequence: | ACUGGACUUGGAGUCAGAAGGC |
Reported expression in cancers: hsa-miR-378a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-378a-3p | acute myeloid leukemia | upregulation | "Overexpression of miR 378 is frequent and may affe ......" | 23582927 | qPCR |
| hsa-miR-378a-3p | breast cancer | upregulation | "Association between mir 24 and mir 378 in formalin ......" | 25120807 | qPCR |
| hsa-miR-378a-3p | breast cancer | downregulation | "We found that miR-378a-3p expression was downregul ......" | 26255816 | |
| hsa-miR-378a-3p | colorectal cancer | downregulation | "MiR 378 is an independent prognostic factor and in ......" | 24555885 | |
| hsa-miR-378a-3p | gastric cancer | upregulation | "The most highly expressed miRNAs in non-tumorous t ......" | 19175831 | |
| hsa-miR-378a-3p | gastric cancer | deregulation | "The results from the miRNA microarray analysis wer ......" | 21475928 | qPCR; Microarray |
| hsa-miR-378a-3p | gastric cancer | downregulation | "The low expression of miR-195 and miR-378 was clos ......" | 23333942 | |
| hsa-miR-378a-3p | gastric cancer | upregulation | "We identified five miRNAs that were most consisten ......" | 24040025 | qPCR |
| hsa-miR-378a-3p | gastric cancer | downregulation | "Currently a large number of miRNAs have been repor ......" | 24139413 | |
| hsa-miR-378a-3p | liver cancer | upregulation | "miR-378 regulates osteoblast differentiation and p ......" | 25562172 | qPCR |
| hsa-miR-378a-3p | lung cancer | upregulation | "The effect of miR-378 upregulation on tumor growth ......" | 26781643 | |
| hsa-miR-378a-3p | lung squamous cell cancer | deregulation | "The most potently down-regulated was miR-378. Over ......" | 23617628 | |
| hsa-miR-378a-3p | prostate cancer | downregulation | "Thereafter RNA was polyadenylated and reverse tran ......" | 25153390 | qPCR |
| hsa-miR-378a-3p | prostate cancer | downregulation | "Here we evaluated the anti-proliferative role of m ......" | 26346167 |
Reported cancer pathway affected by hsa-miR-378a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-378a-3p | acute myeloid leukemia | Apoptosis pathway | "Overexpression of miR 378 is frequent and may affe ......" | 23582927 | |
| hsa-miR-378a-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "Clinical and biological significance of miR 378a 3 ......" | 24412052 | Colony formation |
| hsa-miR-378a-3p | colorectal cancer | Apoptosis pathway | "MiR-378 is frequently downregulated in colorectal ......" | 25328987 | Luciferase |
| hsa-miR-378a-3p | gastric cancer | VEGF signaling pathway | "We found that microRNA-195 miR-195 and microRNA-37 ......" | 23333942 | |
| hsa-miR-378a-3p | gastric cancer | cell cycle pathway; Apoptosis pathway | "MiR 378 inhibits progression of human gastric canc ......" | 24139413 | |
| hsa-miR-378a-3p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "MiR 378 as a biomarker for response to anti angiog ......" | 24680769 | |
| hsa-miR-378a-3p | sarcoma | Apoptosis pathway; cell cycle pathway | "Deep Sequencing the microRNA profile in rhabdomyos ......" | 25427715 | Western blot; Cell migration assay |
Reported cancer prognosis affected by hsa-miR-378a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-378a-3p | acute myeloid leukemia | tumorigenesis; poor survival; cell migration; worse prognosis | "Overexpression of miR 378 is frequent and may affe ......" | 23582927 | |
| hsa-miR-378a-3p | acute myeloid leukemia | poor survival | "The 5' flanking region of miR 378 is hypomethylate ......" | 26191124 | |
| hsa-miR-378a-3p | breast cancer | worse prognosis | "miR 378a 3p modulates tamoxifen sensitivity in bre ......" | 26255816 | |
| hsa-miR-378a-3p | breast cancer | staging; progression; cell migration | "Microarray profiling of the MMTV-PyMT model reveal ......" | 26749280 | Luciferase |
| hsa-miR-378a-3p | chronic myeloid leukemia | staging | "Methylation of miR 378 in Chronic Myeloid Leukemia ......" | 26913395 | |
| hsa-miR-378a-3p | colorectal cancer | staging; differentiation; poor survival; tumorigenesis | "Clinical and biological significance of miR 378a 3 ......" | 24412052 | Colony formation |
| hsa-miR-378a-3p | colorectal cancer | poor survival; worse prognosis | "MiR 378 is an independent prognostic factor and in ......" | 24555885 | Luciferase |
| hsa-miR-378a-3p | colorectal cancer | worse prognosis; drug resistance | "MiR-378 is frequently downregulated in colorectal ......" | 25328987 | Luciferase |
| hsa-miR-378a-3p | colorectal cancer | drug resistance | "Previous studies have connected higher expression ......" | 26496897 | |
| hsa-miR-378a-3p | esophageal cancer | drug resistance | "An in-vitro model of acquired chemotherapy resista ......" | 25356050 | |
| hsa-miR-378a-3p | gastric cancer | progression; cell migration | "MiR 378 inhibits progression of human gastric canc ......" | 24139413 | |
| hsa-miR-378a-3p | kidney renal cell cancer | malignant trasformation; staging; metastasis | "Analysis of serum microRNAs miR 26a 2* miR 191 miR ......" | 22542158 | |
| hsa-miR-378a-3p | kidney renal cell cancer | staging | "Markedly dysregulated miRNAs in RCC cases were sub ......" | 25556603 | |
| hsa-miR-378a-3p | kidney renal cell cancer | staging; poor survival | "Combination of MiR 378 and MiR 210 Serum Levels En ......" | 26426010 | |
| hsa-miR-378a-3p | liver cancer | worse prognosis; poor survival | "A genetic variant in primary miR 378 is associated ......" | 24751683 | |
| hsa-miR-378a-3p | liver cancer | differentiation; drug resistance; cell migration; metastasis | "MiR 378 promotes the migration of liver cancer cel ......" | 25562172 | |
| hsa-miR-378a-3p | lung cancer | drug resistance | "The objectives of the study were to determine the ......" | 26781643 | Luciferase |
| hsa-miR-378a-3p | lung squamous cell cancer | metastasis; cell migration | "In this study using RT-PCR and further northern bl ......" | 22052152 | |
| hsa-miR-378a-3p | lung squamous cell cancer | metastasis; progression | "Interplay between heme oxygenase 1 and miR 378 aff ......" | 23617628 | |
| hsa-miR-378a-3p | ovarian cancer | drug resistance; progression; poor survival | "MiR 378 as a biomarker for response to anti angiog ......" | 24680769 | |
| hsa-miR-378a-3p | prostate cancer | staging; worse prognosis; poor survival; recurrence; progression | "Loss of miR 378 in prostate cancer a common regula ......" | 25153390 | |
| hsa-miR-378a-3p | sarcoma | differentiation; cell migration | "Deep Sequencing the microRNA profile in rhabdomyos ......" | 25427715 | Western blot; Cell migration assay |
Reported gene related to hsa-miR-378a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-378a-3p | colorectal cancer | IGF1R | "Furthermore miR-378a-3p over-expression or down-re ......" | 24412052 |
| hsa-miR-378a-3p | liver cancer | IGF1R | "The insulin-like growth factor 1 receptor IGF1R wa ......" | 24119742 |
| hsa-miR-378a-3p | sarcoma | IGF1R | "Interestingly members of the miR-378 family presen ......" | 25427715 |
| hsa-miR-378a-3p | gastric cancer | MAPK1 | "MiR 378 inhibits progression of human gastric canc ......" | 24139413 |
| hsa-miR-378a-3p | prostate cancer | MAPK1 | "MiR 378 suppresses prostate cancer cell growth thr ......" | 26346167 |
| hsa-miR-378a-3p | colorectal cancer | BRAF | "Previous studies have connected higher expression ......" | 26496897 |
| hsa-miR-378a-3p | colorectal cancer | CDC40 | "Bioinformatics analysis further deduced that CDC40 ......" | 25328987 |
| hsa-miR-378a-3p | gastric cancer | CDK6 | "Expression of cyclin-dependent kinase 6 and vascul ......" | 23333942 |
| hsa-miR-378a-3p | liver cancer | FUS | "MiR 378 promotes the migration of liver cancer cel ......" | 25562172 |
| hsa-miR-378a-3p | breast cancer | GOLT1A | "miR 378a 3p modulates tamoxifen sensitivity in bre ......" | 26255816 |
| hsa-miR-378a-3p | lung squamous cell cancer | HMOX1 | "Interplay between heme oxygenase 1 and miR 378 aff ......" | 23617628 |
| hsa-miR-378a-3p | acute myeloid leukemia | IBSP | "Methylation status of miR-378 5'-flanking region w ......" | 26191124 |
| hsa-miR-378a-3p | prostate cancer | KLK2 | "Loss of miR 378 in prostate cancer a common regula ......" | 25153390 |
| hsa-miR-378a-3p | prostate cancer | KLK4 | "Loss of miR 378 in prostate cancer a common regula ......" | 25153390 |
| hsa-miR-378a-3p | colorectal cancer | KRAS | "Previous studies have connected higher expression ......" | 26496897 |
| hsa-miR-378a-3p | breast cancer | PPARGC1B | "Depletion of Runx1 in late-stage breast cancer cel ......" | 26749280 |
| hsa-miR-378a-3p | breast cancer | RUNX1 | "One of these miR-378 was inversely correlated with ......" | 26749280 |
| hsa-miR-378a-3p | colorectal cancer | VIM | "Luciferase assay was performed to assess miR-378 b ......" | 24555885 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-378a-3p | FLNA | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.491; TCGA COAD -0.68; TCGA ESCA -0.318; TCGA HNSC -0.162; TCGA KIRC -0.149; TCGA KIRP -0.094; TCGA LIHC -0.197; TCGA LUSC -0.233; TCGA SARC -0.382; TCGA STAD -0.351; TCGA UCEC -0.168 |
hsa-miR-378a-3p | NLGN2 | 13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.21; TCGA COAD -0.489; TCGA ESCA -0.345; TCGA HNSC -0.162; TCGA KIRC -0.19; TCGA KIRP -0.292; TCGA LIHC -0.113; TCGA LUAD -0.123; TCGA OV -0.125; TCGA SARC -0.171; TCGA THCA -0.101; TCGA STAD -0.25; TCGA UCEC -0.172 |
hsa-miR-378a-3p | STXBP1 | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.389; TCGA COAD -0.347; TCGA ESCA -0.285; TCGA HNSC -0.159; TCGA KIRP -0.067; TCGA LUSC -0.19; TCGA PAAD -0.275; TCGA STAD -0.399; TCGA UCEC -0.127 |
hsa-miR-378a-3p | SULF1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.866; TCGA BRCA -0.257; TCGA CESC -0.34; TCGA COAD -0.81; TCGA ESCA -0.695; TCGA HNSC -0.234; TCGA KIRP -0.459; TCGA LGG -0.398; TCGA LIHC -0.302; TCGA LUAD -0.145; TCGA LUSC -0.246; TCGA SARC -0.407; TCGA STAD -0.469; TCGA UCEC -0.261 |
hsa-miR-378a-3p | MPP3 | 9 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.411; TCGA BRCA -0.107; TCGA HNSC -0.175; TCGA KIRP -0.291; TCGA LIHC -0.442; TCGA LUAD -0.129; TCGA SARC -0.155; TCGA THCA -0.197; TCGA STAD -0.133 |
hsa-miR-378a-3p | SERINC1 | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.08; TCGA CESC -0.054; TCGA COAD -0.159; TCGA ESCA -0.189; TCGA KIRC -0.069; TCGA LUSC -0.173; TCGA PAAD -0.124; TCGA STAD -0.078; TCGA UCEC -0.079 |
hsa-miR-378a-3p | FCGR1A | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.666; TCGA BRCA -0.214; TCGA CESC -0.264; TCGA COAD -0.583; TCGA ESCA -0.468; TCGA HNSC -0.178; TCGA LGG -0.261; TCGA LIHC -0.16; TCGA LUSC -0.478; TCGA PRAD -0.312; TCGA STAD -0.244 |
hsa-miR-378a-3p | SSPN | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; STAD | MirTarget | TCGA BLCA -0.137; TCGA COAD -0.518; TCGA ESCA -0.536; TCGA KIRC -0.092; TCGA KIRP -0.1; TCGA LGG -0.238; TCGA LIHC -0.245; TCGA LUSC -0.549; TCGA STAD -0.33 |
hsa-miR-378a-3p | PAPPA | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; UCEC | MirTarget | TCGA BLCA -0.423; TCGA CESC -0.535; TCGA COAD -0.474; TCGA ESCA -0.274; TCGA HNSC -0.182; TCGA KIRC -0.3; TCGA LUAD -0.223; TCGA LUSC -0.425; TCGA UCEC -0.536 |
hsa-miR-378a-3p | FCGR1B | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PRAD | MirTarget | TCGA BLCA -0.592; TCGA BRCA -0.153; TCGA CESC -0.267; TCGA COAD -0.483; TCGA ESCA -0.402; TCGA HNSC -0.149; TCGA LGG -0.256; TCGA LIHC -0.137; TCGA LUSC -0.407; TCGA PRAD -0.265 |
hsa-miR-378a-3p | TMEM86A | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.081; TCGA BRCA -0.065; TCGA CESC -0.123; TCGA COAD -0.198; TCGA ESCA -0.195; TCGA HNSC -0.219; TCGA LGG -0.05; TCGA LUSC -0.298; TCGA PRAD -0.126; TCGA STAD -0.157 |
hsa-miR-378a-3p | TMEM130 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.5; TCGA BRCA -0.189; TCGA CESC -0.252; TCGA COAD -0.783; TCGA ESCA -0.722; TCGA HNSC -0.288; TCGA KIRC -0.443; TCGA KIRP -0.869; TCGA LIHC -0.551; TCGA LUSC -0.725; TCGA OV -0.226; TCGA PAAD -0.419; TCGA PRAD -0.593; TCGA STAD -0.515; TCGA UCEC -0.141 |
hsa-miR-378a-3p | GNAO1 | 9 cancers: BLCA; COAD; ESCA; LGG; LUSC; OV; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.546; TCGA COAD -0.756; TCGA ESCA -0.448; TCGA LGG -0.104; TCGA LUSC -0.204; TCGA OV -0.173; TCGA SARC -0.436; TCGA STAD -0.579; TCGA UCEC -0.178 |
hsa-miR-378a-3p | TSPAN11 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; UCEC | mirMAP | TCGA BLCA -0.237; TCGA CESC -0.276; TCGA COAD -0.312; TCGA ESCA -0.28; TCGA HNSC -0.127; TCGA LGG -0.08; TCGA LUAD -0.421; TCGA LUSC -0.506; TCGA OV -0.199; TCGA UCEC -0.417 |
hsa-miR-378a-3p | HIVEP3 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.313; TCGA BRCA -0.073; TCGA COAD -0.261; TCGA ESCA -0.393; TCGA KIRC -0.086; TCGA KIRP -0.123; TCGA LUSC -0.416; TCGA STAD -0.194; TCGA UCEC -0.21 |
hsa-miR-378a-3p | KIAA1614 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.271; TCGA CESC -0.201; TCGA COAD -0.411; TCGA ESCA -0.351; TCGA HNSC -0.142; TCGA LIHC -0.391; TCGA LUSC -0.323; TCGA SARC -0.24; TCGA STAD -0.273; TCGA UCEC -0.288 |
hsa-miR-378a-3p | ABL2 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.158; TCGA CESC -0.119; TCGA COAD -0.145; TCGA ESCA -0.213; TCGA HNSC -0.194; TCGA KIRP -0.088; TCGA LIHC -0.192; TCGA LUAD -0.062; TCGA LUSC -0.148; TCGA OV -0.054; TCGA STAD -0.144; TCGA UCEC -0.109 |
hsa-miR-378a-3p | HHIPL1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; OV; STAD | mirMAP | TCGA BLCA -0.464; TCGA CESC -0.288; TCGA COAD -0.714; TCGA ESCA -0.448; TCGA HNSC -0.305; TCGA KIRC -0.202; TCGA LIHC -0.164; TCGA LUSC -0.388; TCGA OV -0.108; TCGA STAD -0.346 |
hsa-miR-378a-3p | NME4 | 9 cancers: BRCA; CESC; HNSC; LGG; LUAD; OV; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.158; TCGA CESC -0.201; TCGA HNSC -0.167; TCGA LGG -0.061; TCGA LUAD -0.186; TCGA OV -0.075; TCGA PRAD -0.113; TCGA THCA -0.114; TCGA STAD -0.134 |
hsa-miR-378a-3p | IGF1R | 12 cancers: BRCA; COAD; KIRP; LGG; LIHC; LUAD; OV; PAAD; SARC; THCA; STAD; UCEC | miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.411; TCGA COAD -0.165; TCGA KIRP -0.071; TCGA LGG -0.064; TCGA LIHC -0.309; TCGA LUAD -0.127; TCGA OV -0.207; TCGA PAAD -0.235; TCGA SARC -0.168; TCGA THCA -0.107; TCGA STAD -0.189; TCGA UCEC -0.097 |
hsa-miR-378a-3p | ZNF260 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; STAD | MirTarget | TCGA BRCA -0.096; TCGA ESCA -0.158; TCGA KIRC -0.052; TCGA KIRP -0.066; TCGA LGG -0.111; TCGA LIHC -0.115; TCGA LUAD -0.133; TCGA OV -0.065; TCGA PRAD -0.056; TCGA STAD -0.137 |
hsa-miR-378a-3p | QSOX1 | 10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; UCEC | mirMAP | TCGA BRCA -0.177; TCGA CESC -0.175; TCGA HNSC -0.097; TCGA KIRC -0.151; TCGA KIRP -0.09; TCGA LIHC -0.518; TCGA LUAD -0.081; TCGA LUSC -0.267; TCGA OV -0.109; TCGA UCEC -0.16 |
hsa-miR-378a-3p | KIF6 | 10 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUSC; OV; STAD; UCEC | mirMAP | TCGA BRCA -0.298; TCGA CESC -0.303; TCGA HNSC -0.21; TCGA KIRP -0.226; TCGA LGG -0.293; TCGA LIHC -0.175; TCGA LUSC -0.494; TCGA OV -0.154; TCGA STAD -0.526; TCGA UCEC -0.171 |
hsa-miR-378a-3p | BRD3 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.105; TCGA ESCA -0.08; TCGA KIRC -0.082; TCGA KIRP -0.139; TCGA LGG -0.116; TCGA LIHC -0.082; TCGA SARC -0.082; TCGA STAD -0.112; TCGA UCEC -0.091 |
hsa-miR-378a-3p | GRIK2 | 10 cancers: BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; OV; PAAD; STAD | miRNATAP | TCGA BRCA -0.118; TCGA CESC -0.218; TCGA COAD -0.33; TCGA ESCA -0.579; TCGA KIRP -0.383; TCGA LUAD -0.248; TCGA LUSC -0.477; TCGA OV -0.206; TCGA PAAD -0.76; TCGA STAD -0.363 |
hsa-miR-378a-3p | ERRFI1 | 9 cancers: CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; UCEC | miRNAWalker2 validate | TCGA CESC -0.117; TCGA ESCA -0.26; TCGA HNSC -0.132; TCGA KIRP -0.218; TCGA LUAD -0.185; TCGA LUSC -0.349; TCGA PAAD -0.419; TCGA THCA -0.257; TCGA UCEC -0.14 |
hsa-miR-378a-3p | C15orf52 | 10 cancers: CESC; COAD; KIRC; KIRP; LGG; LIHC; LUSC; SARC; STAD; UCEC | mirMAP | TCGA CESC -0.247; TCGA COAD -0.275; TCGA KIRC -0.142; TCGA KIRP -0.103; TCGA LGG -0.128; TCGA LIHC -0.183; TCGA LUSC -0.339; TCGA SARC -0.429; TCGA STAD -0.364; TCGA UCEC -0.118 |
hsa-miR-378a-3p | MAFK | 10 cancers: CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.099; TCGA HNSC -0.096; TCGA KIRC -0.125; TCGA KIRP -0.181; TCGA LUAD -0.231; TCGA LUSC -0.114; TCGA PRAD -0.078; TCGA THCA -0.084; TCGA STAD -0.082; TCGA UCEC -0.09 |
hsa-miR-378a-3p | TIGD1 | 9 cancers: KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA KIRP -0.195; TCGA LGG -0.168; TCGA LIHC -0.277; TCGA LUAD -0.202; TCGA OV -0.153; TCGA PAAD -0.149; TCGA PRAD -0.229; TCGA THCA -0.179; TCGA STAD -0.107 |
Enriched cancer pathways of putative targets