microRNA information: hsa-miR-379-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-379-5p | miRbase |
Accession: | MIMAT0000733 | miRbase |
Precursor name: | hsa-mir-379 | miRbase |
Precursor accession: | MI0000787 | miRbase |
Symbol: | MIR379 | HGNC |
RefSeq ID: | NR_029871 | GenBank |
Sequence: | UGGUAGACUAUGGAACGUAGG |
Reported expression in cancers: hsa-miR-379-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-379-5p | breast cancer | deregulation | "This analysis pinpointed miR-204 miR-211 and miR-3 ......" | 22629385 | |
hsa-miR-379-5p | liver cancer | downregulation | "MicroRNA 379 5p inhibits tumor invasion and metast ......" | 26944318 |
Reported cancer pathway affected by hsa-miR-379-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-379-5p | liver cancer | PI3K/Akt signaling pathway | "MicroRNA 379 5p inhibits tumor invasion and metast ......" | 26944318 |
Reported cancer prognosis affected by hsa-miR-379-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-379-5p | breast cancer | staging | "miR 379 regulates cyclin B1 expression and is decr ......" | 23874748 | Western blot |
hsa-miR-379-5p | kidney papillary renal cell cancer | staging; poor survival | "In the training stage the expression levels of 12 ......" | 25906110 | |
hsa-miR-379-5p | liver cancer | metastasis; staging; cell migration | "MicroRNA 379 5p inhibits tumor invasion and metast ......" | 26944318 | |
hsa-miR-379-5p | liver cancer | cell migration | "Effects of microRNA 379 5p on proliferation migrat ......" | 27266355 | MTT assay; Transwell assay; Western blot |
hsa-miR-379-5p | lung squamous cell cancer | drug resistance | "To better understand the molecular mechanisms of m ......" | 20371173 | |
hsa-miR-379-5p | prostate cancer | metastasis; progression; poor survival | "miR 154* and miR 379 in the DLK1 DIO3 microRNA meg ......" | 25324143 |
Reported gene related to hsa-miR-379-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-379-5p | breast cancer | CCNB1 | "miR 379 regulates cyclin B1 expression and is decr ......" | 23874748 |
hsa-miR-379-5p | prostate cancer | DIO3 | "miR 154* and miR 379 in the DLK1 DIO3 microRNA meg ......" | 25324143 |
hsa-miR-379-5p | prostate cancer | DLK1 | "miR 154* and miR 379 in the DLK1 DIO3 microRNA meg ......" | 25324143 |
hsa-miR-379-5p | breast cancer | PCNA | "miR 379 regulates cyclin B1 expression and is decr ......" | 23874748 |
hsa-miR-379-5p | liver cancer | PTK2 | "Moreover miR-379-5p exerted this function by direc ......" | 26944318 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-379-5p | PEX11B | 9 cancers: BLCA; BRCA; ESCA; LIHC; LUSC; OV; PAAD; PRAD; UCEC | MirTarget | TCGA BLCA -0.054; TCGA BRCA -0.146; TCGA ESCA -0.082; TCGA LIHC -0.063; TCGA LUSC -0.074; TCGA OV -0.072; TCGA PAAD -0.091; TCGA PRAD -0.07; TCGA UCEC -0.064 |
hsa-miR-379-5p | UNC13B | 9 cancers: BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BRCA -0.055; TCGA COAD -0.172; TCGA ESCA -0.235; TCGA KIRP -0.051; TCGA LIHC -0.101; TCGA LUAD -0.241; TCGA LUSC -0.11; TCGA PRAD -0.203; TCGA STAD -0.158 |
Enriched cancer pathways of putative targets