microRNA information: hsa-miR-384
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-384 | miRbase |
| Accession: | MIMAT0001075 | miRbase |
| Precursor name: | hsa-mir-384 | miRbase |
| Precursor accession: | MI0001145 | miRbase |
| Symbol: | MIR384 | HGNC |
| RefSeq ID: | NR_029909 | GenBank |
| Sequence: | AUUCCUAGAAAUUGUUCAUA |
Reported expression in cancers: hsa-miR-384
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-384 | liver cancer | downregulation | "Here we found that miR-384 was significantly downr ......" | 27542674 |
Reported cancer pathway affected by hsa-miR-384
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-384
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-384
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-384 | liver cancer | INSR | "Insulin receptor substrate 1IRS1 was identified as ......" | 27542674 |
| hsa-miR-384 | liver cancer | IRS1 | "MiR 384 regulated IRS1 expression and suppressed c ......" | 27542674 |