microRNA information: hsa-miR-3928-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-3928-3p | miRbase |
| Accession: | MIMAT0018205 | miRbase |
| Precursor name: | hsa-mir-3928 | miRbase |
| Precursor accession: | MI0016438 | miRbase |
| Symbol: | MIR3928 | HGNC |
| RefSeq ID: | NR_037496 | GenBank |
| Sequence: | GGAGGAACCUUGGAGCUUCGGC |
Reported expression in cancers: hsa-miR-3928-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-3928-3p | sarcoma | downregulation | "MiR-3928 expression level was assayed by qRT-PCR. ......" | 24854843 | qPCR |
Reported cancer pathway affected by hsa-miR-3928-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-3928-3p | sarcoma | Apoptosis pathway | "Down regulation of miR 3928 promoted osteosarcoma ......" | 24854843 |
Reported cancer prognosis affected by hsa-miR-3928-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-3928-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-3928-3p | sarcoma | CDK6 | "ERBB3 IL-6R and CDK6 may be the targeted genes of ......" | 24854843 |
| hsa-miR-3928-3p | sarcoma | ERBB3 | "ERBB3 IL-6R and CDK6 may be the targeted genes of ......" | 24854843 |
Expression profile in cancer corhorts:
