microRNA information: hsa-miR-409-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-409-3p | miRbase |
| Accession: | MIMAT0001639 | miRbase |
| Precursor name: | hsa-mir-409 | miRbase |
| Precursor accession: | MI0001735 | miRbase |
| Symbol: | MIR409 | HGNC |
| RefSeq ID: | NR_029975 | GenBank |
| Sequence: | GAAUGUUGCUCGGUGAACCCCU |
Reported expression in cancers: hsa-miR-409-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-409-3p | bladder cancer | downregulation | "Previous studies have shown that miR-409-3p is dys ......" | 23820886 | |
| hsa-miR-409-3p | breast cancer | upregulation | "Selected candidates identified in the initial scre ......" | 22927033 | qPCR |
| hsa-miR-409-3p | breast cancer | deregulation | "While miR-409-3p has been shown to play important ......" | 26631969 | |
| hsa-miR-409-3p | breast cancer | downregulation | "The purpose of this study was to examine the expre ......" | 27079864 | qPCR |
| hsa-miR-409-3p | colon cancer | downregulation | "miR-409-3p has been shown to be downregulated in v ......" | 26935807 | |
| hsa-miR-409-3p | colorectal cancer | downregulation | "In this study we identified miR-409-3p as a tumor ......" | 25991585 | |
| hsa-miR-409-3p | gastric cancer | downregulation | "In this study miR-409-3p was found to be downregul ......" | 22179828 | |
| hsa-miR-409-3p | gastric cancer | downregulation | "Here we report that miR-409-3p was significantly d ......" | 22388101 | |
| hsa-miR-409-3p | lung cancer | downregulation | "The aim of this study is to investigate the clinic ......" | 25278243 | qPCR |
| hsa-miR-409-3p | prostate cancer | upregulation | "Stromal fibroblast derived miR 409 promotes epithe ......" | 25065597 |
Reported cancer pathway affected by hsa-miR-409-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-409-3p | breast cancer | cell cycle pathway | "We demonstrate that resveratrol regulates apoptoti ......" | 26890143 | |
| hsa-miR-409-3p | gastric cancer | Apoptosis pathway | "MicroRNA 409 3p regulates cell proliferation and a ......" | 22388101 | |
| hsa-miR-409-3p | lung cancer | PI3K/Akt signaling pathway; Apoptosis pathway | "MicroRNA 409 3p functions as a tumor suppressor in ......" | 25278243 |
Reported cancer prognosis affected by hsa-miR-409-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-409-3p | acute myeloid leukemia | poor survival | "High levels of miR-196b and miR-644 were independe ......" | 24072101 | |
| hsa-miR-409-3p | breast cancer | staging | "Further we validated our previously reported circu ......" | 24194846 | |
| hsa-miR-409-3p | breast cancer | metastasis | "MicroRNA 409 3p regulates cell invasion and metast ......" | 27079864 | Wound Healing Assay; Colony formation; Luciferase; Western blot; Transwell assay |
| hsa-miR-409-3p | breast cancer | staging; metastasis; differentiation; poor survival; worse prognosis; recurrence | "Low expression of miR 409 3p is a prognostic marke ......" | 27735035 | |
| hsa-miR-409-3p | colorectal cancer | metastasis; cell migration | "MicroRNA 409 3p suppresses colorectal cancer invas ......" | 25991585 | |
| hsa-miR-409-3p | colorectal cancer | metastasis; tumor size | "Downregulation of microRNA 409 3p promotes aggress ......" | 26084278 | Transwell assay |
| hsa-miR-409-3p | gastric cancer | metastasis; staging | "MicroRNA 409 suppresses tumour cell invasion and m ......" | 22179828 | |
| hsa-miR-409-3p | lung cancer | worse prognosis; staging; metastasis; differentiation | "MicroRNA 409 3p functions as a tumor suppressor in ......" | 25278243 | |
| hsa-miR-409-3p | prostate cancer | metastasis; tumorigenesis; progression; poor survival | "miR 409 3p/ 5p promotes tumorigenesis epithelial t ......" | 24963047 | |
| hsa-miR-409-3p | prostate cancer | tumorigenesis | "Stromal fibroblast derived miR 409 promotes epithe ......" | 25065597 | |
| hsa-miR-409-3p | sarcoma | cell migration; metastasis | "MicroRNA 409 3p inhibits osteosarcoma cell migrati ......" | 26992637 | Luciferase |
Reported gene related to hsa-miR-409-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-409-3p | bladder cancer | MET | "MicroRNA 409 3p inhibits migration and invasion of ......" | 23820886 |
| hsa-miR-409-3p | lung cancer | MET | "MicroRNA 409 3p functions as a tumor suppressor in ......" | 25278243 |
| hsa-miR-409-3p | breast cancer | AKT1 | "miR 409 3p suppresses breast cancer cell growth an ......" | 26631969 |
| hsa-miR-409-3p | colon cancer | BECN1 | "miR 409 3p sensitizes colon cancer cells to oxalip ......" | 26935807 |
| hsa-miR-409-3p | sarcoma | CTNND1 | "Bioinformatics analysis showed that catenin-δ1 CT ......" | 26992637 |
| hsa-miR-409-3p | colorectal cancer | GAB1 | "MicroRNA 409 3p suppresses colorectal cancer invas ......" | 25991585 |
| hsa-miR-409-3p | glioblastoma | MGMT | "However statistical models incorporating both miR- ......" | 27057640 |
| hsa-miR-409-3p | bladder cancer | MMP2 | "We further showed that MMP2 and MMP9 may be downst ......" | 23820886 |
| hsa-miR-409-3p | bladder cancer | MMP9 | "We further showed that MMP2 and MMP9 may be downst ......" | 23820886 |
| hsa-miR-409-3p | colorectal cancer | NLK | "Notably we found the NLK could be a potential targ ......" | 26084278 |
| hsa-miR-409-3p | gastric cancer | PHF10 | "MicroRNA 409 3p regulates cell proliferation and a ......" | 22388101 |
| hsa-miR-409-3p | gastric cancer | RDX | "MicroRNA 409 suppresses tumour cell invasion and m ......" | 22179828 |
| hsa-miR-409-3p | prostate cancer | STAG2 | "miR-409 promoted tumorigenesis through repression ......" | 25065597 |
| hsa-miR-409-3p | breast cancer | ZEB1 | "MicroRNA 409 3p regulates cell invasion and metast ......" | 27079864 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-409-3p | KLF15 | 14 cancers: BLCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; PITA | TCGA BLCA -0.288; TCGA COAD -0.401; TCGA ESCA -0.329; TCGA KIRC -0.213; TCGA LGG -0.223; TCGA LIHC -0.137; TCGA LUAD -0.283; TCGA LUSC -0.313; TCGA OV -0.129; TCGA PRAD -0.159; TCGA SARC -0.211; TCGA THCA -0.136; TCGA STAD -0.716; TCGA UCEC -0.113 |
hsa-miR-409-3p | ZNF540 | 9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; LUSC; SARC; THCA | MirTarget | TCGA BLCA -0.206; TCGA BRCA -0.121; TCGA COAD -0.178; TCGA KIRC -0.118; TCGA KIRP -0.163; TCGA LUAD -0.112; TCGA LUSC -0.175; TCGA SARC -0.08; TCGA THCA -0.152 |
hsa-miR-409-3p | TUBE1 | 11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; OV; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.077; TCGA COAD -0.163; TCGA ESCA -0.081; TCGA KIRC -0.093; TCGA KIRP -0.175; TCGA LGG -0.088; TCGA LUSC -0.066; TCGA OV -0.056; TCGA THCA -0.081; TCGA STAD -0.127; TCGA UCEC -0.071 |
hsa-miR-409-3p | RCOR3 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; OV; SARC; THCA; STAD | MirTarget; PITA | TCGA BLCA -0.133; TCGA BRCA -0.087; TCGA COAD -0.138; TCGA ESCA -0.066; TCGA KIRC -0.085; TCGA KIRP -0.098; TCGA LGG -0.07; TCGA LUAD -0.087; TCGA OV -0.082; TCGA SARC -0.069; TCGA THCA -0.054; TCGA STAD -0.169 |
hsa-miR-409-3p | DENND4C | 9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; OV; SARC; STAD | MirTarget | TCGA BLCA -0.106; TCGA COAD -0.128; TCGA ESCA -0.121; TCGA LGG -0.086; TCGA LUAD -0.054; TCGA LUSC -0.175; TCGA OV -0.08; TCGA SARC -0.07; TCGA STAD -0.149 |
hsa-miR-409-3p | RNF103 | 10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUSC; PRAD; SARC; STAD; UCEC | PITA | TCGA BLCA -0.092; TCGA BRCA -0.056; TCGA COAD -0.106; TCGA ESCA -0.159; TCGA LIHC -0.06; TCGA LUSC -0.065; TCGA PRAD -0.083; TCGA SARC -0.073; TCGA STAD -0.169; TCGA UCEC -0.05 |
hsa-miR-409-3p | PLA2G12A | 9 cancers: BLCA; BRCA; COAD; KIRC; LUSC; OV; PRAD; SARC; STAD | PITA | TCGA BLCA -0.061; TCGA BRCA -0.083; TCGA COAD -0.088; TCGA KIRC -0.087; TCGA LUSC -0.073; TCGA OV -0.051; TCGA PRAD -0.08; TCGA SARC -0.051; TCGA STAD -0.098 |
hsa-miR-409-3p | ARSD | 9 cancers: BLCA; ESCA; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | mirMAP | TCGA BLCA -0.095; TCGA ESCA -0.251; TCGA LIHC -0.065; TCGA LUAD -0.071; TCGA LUSC -0.099; TCGA OV -0.071; TCGA PAAD -0.133; TCGA PRAD -0.101; TCGA SARC -0.061 |
hsa-miR-409-3p | CPEB3 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.154; TCGA CESC -0.088; TCGA COAD -0.119; TCGA ESCA -0.214; TCGA HNSC -0.153; TCGA KIRC -0.075; TCGA KIRP -0.068; TCGA LUAD -0.081; TCGA LUSC -0.167; TCGA OV -0.078; TCGA STAD -0.261; TCGA UCEC -0.104 |
hsa-miR-409-3p | NKTR | 9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.11; TCGA HNSC -0.081; TCGA KIRC -0.087; TCGA KIRP -0.238; TCGA LGG -0.119; TCGA LUAD -0.056; TCGA LUSC -0.101; TCGA SARC -0.057; TCGA STAD -0.133 |
hsa-miR-409-3p | NDUFA5 | 13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; OV; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.085; TCGA BRCA -0.11; TCGA COAD -0.132; TCGA ESCA -0.123; TCGA KIRC -0.091; TCGA KIRP -0.112; TCGA LIHC -0.051; TCGA LUSC -0.065; TCGA OV -0.063; TCGA PRAD -0.074; TCGA THCA -0.088; TCGA STAD -0.144; TCGA UCEC -0.067 |
hsa-miR-409-3p | PCBD2 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.08; TCGA BRCA -0.103; TCGA CESC -0.083; TCGA ESCA -0.102; TCGA HNSC -0.118; TCGA KIRC -0.111; TCGA KIRP -0.059; TCGA LGG -0.109; TCGA LUAD -0.081; TCGA LUSC -0.105; TCGA OV -0.108; TCGA PRAD -0.053; TCGA SARC -0.062; TCGA THCA -0.068; TCGA STAD -0.125 |
hsa-miR-409-3p | CMC1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD | mirMAP | TCGA BLCA -0.064; TCGA BRCA -0.146; TCGA CESC -0.059; TCGA ESCA -0.107; TCGA HNSC -0.09; TCGA LIHC -0.052; TCGA LUSC -0.089; TCGA OV -0.076; TCGA PAAD -0.101; TCGA PRAD -0.074 |
hsa-miR-409-3p | RINL | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; THCA | mirMAP | TCGA BLCA -0.112; TCGA BRCA -0.202; TCGA CESC -0.086; TCGA ESCA -0.255; TCGA HNSC -0.157; TCGA KIRC -0.105; TCGA KIRP -0.067; TCGA LUAD -0.056; TCGA THCA -0.076 |
hsa-miR-409-3p | GOLGA6L9 | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD | mirMAP | TCGA BLCA -0.141; TCGA BRCA -0.092; TCGA HNSC -0.147; TCGA KIRC -0.151; TCGA KIRP -0.348; TCGA LGG -0.198; TCGA LUAD -0.075; TCGA OV -0.148; TCGA PAAD -0.172; TCGA PRAD -0.142 |
hsa-miR-409-3p | EFCAB2 | 11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUSC; OV; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.078; TCGA BRCA -0.082; TCGA COAD -0.17; TCGA KIRC -0.146; TCGA KIRP -0.083; TCGA LGG -0.098; TCGA LUSC -0.187; TCGA OV -0.095; TCGA SARC -0.059; TCGA THCA -0.091; TCGA UCEC -0.078 |
hsa-miR-409-3p | C8orf44 | 10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.082; TCGA BRCA -0.1; TCGA COAD -0.148; TCGA KIRC -0.101; TCGA KIRP -0.167; TCGA LGG -0.051; TCGA LUAD -0.08; TCGA PRAD -0.088; TCGA SARC -0.056; TCGA THCA -0.071 |
hsa-miR-409-3p | FAM193B | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD | miRNATAP | TCGA BLCA -0.105; TCGA BRCA -0.15; TCGA CESC -0.091; TCGA HNSC -0.144; TCGA KIRC -0.126; TCGA KIRP -0.254; TCGA LGG -0.084; TCGA LUAD -0.053; TCGA LUSC -0.077; TCGA PAAD -0.132; TCGA PRAD -0.078 |
hsa-miR-409-3p | SCAI | 10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.06; TCGA COAD -0.105; TCGA HNSC -0.108; TCGA KIRC -0.06; TCGA KIRP -0.096; TCGA LUAD -0.115; TCGA LUSC -0.196; TCGA PRAD -0.067; TCGA SARC -0.072; TCGA STAD -0.159 |
hsa-miR-409-3p | CLYBL | 12 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.18; TCGA CESC -0.136; TCGA ESCA -0.278; TCGA KIRC -0.098; TCGA KIRP -0.081; TCGA LUAD -0.077; TCGA LUSC -0.095; TCGA OV -0.112; TCGA SARC -0.084; TCGA THCA -0.071; TCGA STAD -0.166; TCGA UCEC -0.084 |
hsa-miR-409-3p | CDNF | 12 cancers: BRCA; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.138; TCGA ESCA -0.231; TCGA KIRP -0.074; TCGA LGG -0.127; TCGA LIHC -0.082; TCGA LUAD -0.089; TCGA LUSC -0.117; TCGA OV -0.135; TCGA PRAD -0.094; TCGA THCA -0.117; TCGA STAD -0.162; TCGA UCEC -0.108 |
hsa-miR-409-3p | PARD6B | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC | PITA | TCGA BRCA -0.29; TCGA CESC -0.113; TCGA COAD -0.134; TCGA ESCA -0.28; TCGA HNSC -0.246; TCGA KIRC -0.149; TCGA KIRP -0.1; TCGA LUAD -0.106; TCGA LUSC -0.278; TCGA PAAD -0.257; TCGA SARC -0.237; TCGA UCEC -0.111 |
hsa-miR-409-3p | TRIM14 | 10 cancers: BRCA; CESC; ESCA; HNSC; LUSC; OV; PAAD; PRAD; SARC; UCEC | mirMAP | TCGA BRCA -0.066; TCGA CESC -0.089; TCGA ESCA -0.108; TCGA HNSC -0.113; TCGA LUSC -0.089; TCGA OV -0.114; TCGA PAAD -0.147; TCGA PRAD -0.113; TCGA SARC -0.096; TCGA UCEC -0.089 |
hsa-miR-409-3p | ALDH5A1 | 11 cancers: BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC | mirMAP | TCGA BRCA -0.174; TCGA COAD -0.27; TCGA HNSC -0.124; TCGA LGG -0.051; TCGA LIHC -0.078; TCGA LUAD -0.133; TCGA LUSC -0.125; TCGA OV -0.106; TCGA PRAD -0.087; TCGA THCA -0.075; TCGA UCEC -0.109 |
hsa-miR-409-3p | RAB3IP | 9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD | mirMAP | TCGA BRCA -0.116; TCGA ESCA -0.138; TCGA HNSC -0.105; TCGA KIRC -0.141; TCGA KIRP -0.163; TCGA LGG -0.114; TCGA LUAD -0.108; TCGA LUSC -0.063; TCGA PRAD -0.095 |
hsa-miR-409-3p | VSIG10 | 13 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | mirMAP | TCGA BRCA -0.074; TCGA CESC -0.102; TCGA ESCA -0.254; TCGA KIRC -0.087; TCGA KIRP -0.079; TCGA LGG -0.135; TCGA LIHC -0.056; TCGA LUAD -0.108; TCGA LUSC -0.283; TCGA OV -0.104; TCGA PAAD -0.152; TCGA PRAD -0.064; TCGA SARC -0.087 |
hsa-miR-409-3p | EMP2 | 10 cancers: CESC; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA CESC -0.107; TCGA HNSC -0.152; TCGA LIHC -0.083; TCGA LUAD -0.179; TCGA LUSC -0.322; TCGA PAAD -0.22; TCGA PRAD -0.093; TCGA SARC -0.078; TCGA STAD -0.111; TCGA UCEC -0.08 |
hsa-miR-409-3p | MPP7 | 10 cancers: COAD; ESCA; HNSC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget; PITA; miRNATAP | TCGA COAD -0.229; TCGA ESCA -0.2; TCGA HNSC -0.112; TCGA LUAD -0.143; TCGA LUSC -0.18; TCGA OV -0.13; TCGA SARC -0.521; TCGA THCA -0.051; TCGA STAD -0.494; TCGA UCEC -0.16 |
Enriched cancer pathways of putative targets