microRNA information: hsa-miR-409-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-409-5p | miRbase |
| Accession: | MIMAT0001638 | miRbase |
| Precursor name: | hsa-mir-409 | miRbase |
| Precursor accession: | MI0001735 | miRbase |
| Symbol: | MIR409 | HGNC |
| RefSeq ID: | NR_029975 | GenBank |
| Sequence: | AGGUUACCCGAGCAACUUUGCAU |
Reported expression in cancers: hsa-miR-409-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-409-5p | prostate cancer | upregulation | "Stromal fibroblast derived miR 409 promotes epithe ......" | 25065597 |
Reported cancer pathway affected by hsa-miR-409-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-409-5p | gastric cancer | Apoptosis pathway | "MicroRNA 409 3p regulates cell proliferation and a ......" | 22388101 |
Reported cancer prognosis affected by hsa-miR-409-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-409-5p | breast cancer | metastasis | "MicroRNA 409 3p regulates cell invasion and metast ......" | 27079864 | Colony formation; Western blot; Transwell assay |
| hsa-miR-409-5p | colorectal cancer | metastasis | "MicroRNA 409 3p suppresses colorectal cancer invas ......" | 25991585 | |
| hsa-miR-409-5p | colorectal cancer | metastasis | "Downregulation of microRNA 409 3p promotes aggress ......" | 26084278 | |
| hsa-miR-409-5p | gastric cancer | metastasis | "MicroRNA 409 suppresses tumour cell invasion and m ......" | 22179828 | |
| hsa-miR-409-5p | prostate cancer | metastasis; tumorigenesis; poor survival | "miR 409 3p/ 5p promotes tumorigenesis epithelial t ......" | 24963047 | |
| hsa-miR-409-5p | prostate cancer | tumorigenesis | "Stromal fibroblast derived miR 409 promotes epithe ......" | 25065597 | |
| hsa-miR-409-5p | sarcoma | cell migration | "MicroRNA 409 3p inhibits osteosarcoma cell migrati ......" | 26992637 |
Reported gene related to hsa-miR-409-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-409-5p | bladder cancer | MET | "MicroRNA 409 3p inhibits migration and invasion of ......" | 23820886 |
| hsa-miR-409-5p | lung cancer | MET | "MicroRNA 409 3p functions as a tumor suppressor in ......" | 25278243 |
| hsa-miR-409-5p | breast cancer | AKT1 | "miR 409 3p suppresses breast cancer cell growth an ......" | 26631969 |
| hsa-miR-409-5p | colon cancer | BECN1 | "miR 409 3p sensitizes colon cancer cells to oxalip ......" | 26935807 |
| hsa-miR-409-5p | colorectal cancer | GAB1 | "MicroRNA 409 3p suppresses colorectal cancer invas ......" | 25991585 |
| hsa-miR-409-5p | gastric cancer | PHF10 | "MicroRNA 409 3p regulates cell proliferation and a ......" | 22388101 |
| hsa-miR-409-5p | gastric cancer | RDX | "MicroRNA 409 suppresses tumour cell invasion and m ......" | 22179828 |
| hsa-miR-409-5p | prostate cancer | STAG2 | "miR-409 promoted tumorigenesis through repression ......" | 25065597 |
| hsa-miR-409-5p | breast cancer | ZEB1 | "MicroRNA 409 3p regulates cell invasion and metast ......" | 27079864 |
Expression profile in cancer corhorts:
