microRNA information: hsa-miR-410-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-410-3p | miRbase |
Accession: | MIMAT0002171 | miRbase |
Precursor name: | hsa-mir-410 | miRbase |
Precursor accession: | MI0002465 | miRbase |
Symbol: | MIR410 | HGNC |
RefSeq ID: | NR_030156 | GenBank |
Sequence: | AAUAUAACACAGAUGGCCUGU |
Reported expression in cancers: hsa-miR-410-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-410-3p | breast cancer | downregulation | "miR-410-3p acts as an oncogene or tumor-suppressor ......" | 27221455 | qPCR |
hsa-miR-410-3p | esophageal cancer | deregulation | "Differentially-expressed miRNAs were analyzed usin ......" | 23534712 | Reverse transcription PCR |
hsa-miR-410-3p | lung squamous cell cancer | upregulation | "miR-410 acts as an oncogene or tumor suppressor ge ......" | 26149213 |
Reported cancer pathway affected by hsa-miR-410-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-410-3p | breast cancer | Epithelial mesenchymal transition pathway | "miR 410 3p suppresses breast cancer progression by ......" | 27221455 | Colony formation; MTT assay; Luciferase |
hsa-miR-410-3p | pancreatic cancer | cell cycle pathway | "MicroRNA 410 functions as a tumor suppressor by ta ......" | 25646808 | |
hsa-miR-410-3p | sarcoma | Apoptosis pathway | "VEGF mediated suppression of cell proliferation an ......" | 25385479 | Western blot; Luciferase; Flow cytometry; MTT assay |
Reported cancer prognosis affected by hsa-miR-410-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-410-3p | breast cancer | progression | "miR 410 3p suppresses breast cancer progression by ......" | 27221455 | Colony formation; MTT assay; Luciferase |
hsa-miR-410-3p | gastric cancer | metastasis | "MicroRNA 410 suppresses migration and invasion by ......" | 25136862 | Luciferase |
hsa-miR-410-3p | lung squamous cell cancer | progression | "MicroRNA 410 promotes cell proliferation by target ......" | 26149213 | |
hsa-miR-410-3p | ovarian cancer | poor survival; staging | "RNA from a training set of 62 cases was hybridized ......" | 21354599 |
Reported gene related to hsa-miR-410-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-410-3p | pancreatic cancer | AGT | "MicroRNA 410 functions as a tumor suppressor by ta ......" | 25646808 |
hsa-miR-410-3p | pancreatic cancer | AGTR1 | "In contrast inhibition of miR-410 increased the ex ......" | 25646808 |
hsa-miR-410-3p | lung squamous cell cancer | BRD7 | "MicroRNA 410 promotes cell proliferation by target ......" | 26149213 |
hsa-miR-410-3p | colorectal cancer | DNMT3A | "Furthermore both miR-410 and DNMT3A are upregulate ......" | 25272045 |
hsa-miR-410-3p | colorectal cancer | FHL1 | "MiR 410 is overexpressed in liver and colorectal t ......" | 25272045 |
hsa-miR-410-3p | ovarian cancer | MAPK1IP1L | "The data suggest that an MiSS that contains miR-41 ......" | 21354599 |
hsa-miR-410-3p | gastric cancer | MDM2 | "MicroRNA 410 suppresses migration and invasion by ......" | 25136862 |
hsa-miR-410-3p | pancreatic cancer | PECAM1 | "miR-410 overexpression inhibited angiogenesis in m ......" | 25646808 |
hsa-miR-410-3p | breast cancer | SNAI1 | "miR 410 3p suppresses breast cancer progression by ......" | 27221455 |
hsa-miR-410-3p | sarcoma | VEGFA | "VEGF mediated suppression of cell proliferation an ......" | 25385479 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-410-3p | FMR1 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; OV; SARC; STAD | MirTarget | TCGA BLCA -0.09; TCGA BRCA -0.115; TCGA ESCA -0.084; TCGA HNSC -0.078; TCGA LIHC -0.084; TCGA LUSC -0.074; TCGA OV -0.075; TCGA SARC -0.057; TCGA STAD -0.067 |
hsa-miR-410-3p | BPNT1 | 9 cancers: BRCA; CESC; ESCA; HNSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BRCA -0.115; TCGA CESC -0.055; TCGA ESCA -0.101; TCGA HNSC -0.064; TCGA OV -0.063; TCGA PAAD -0.109; TCGA PRAD -0.071; TCGA STAD -0.085; TCGA UCEC -0.076 |
Enriched cancer pathways of putative targets