microRNA information: hsa-miR-411-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-411-3p | miRbase |
| Accession: | MIMAT0004813 | miRbase |
| Precursor name: | hsa-mir-411 | miRbase |
| Precursor accession: | MI0003675 | miRbase |
| Symbol: | MIR411 | HGNC |
| RefSeq ID: | NR_030389 | GenBank |
| Sequence: | UAUGUAACACGGUCCACUAACC |
Reported expression in cancers: hsa-miR-411-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-411-3p | liver cancer | upregulation | "In this study we report that miR-411 expression is ......" | 25776495 |
Reported cancer pathway affected by hsa-miR-411-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-411-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-411-3p | " ......" |
Reported cancer prognosis affected by hsa-miR-411-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-411-3p | breast cancer | metastasis | "miR 411 5p inhibits proliferation and metastasis o ......" | 27264952 | |
| hsa-miR-411-3p | breast cancer | cell migration | "The expression and functions of microRNA miR-411 h ......" | 27572271 | Western blot; Luciferase; MTT assay |
| hsa-miR-411-3p | lung cancer | cell migration; poor survival | "An independent cohort of 60 lung ACs was used for ......" | 24833665 |
Reported gene related to hsa-miR-411-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-411-3p | lung cancer | FOXO1 | "miR 411 contributes the cell proliferation of lung ......" | 26572153 |
| hsa-miR-411-3p | breast cancer | GRB2 | "miR 411 5p inhibits proliferation and metastasis o ......" | 27264952 |
| hsa-miR-411-3p | liver cancer | ITCH | "miR 411 regulated ITCH expression and promoted cel ......" | 25776495 |
| hsa-miR-411-3p | sarcoma | SPRY4 | "SPRY4 and miR-411 mRNA levels correlated with TGF- ......" | 26291313 |